Introduction to Theoretical CS
|
|
- Leonard Lane
- 6 years ago
- Views:
Transcription
1 3/5/1 7: Theory of Computtion Introduction to Theoreticl CS Two fundmentl questions. Wht cn computer do? (the most fundmentl question) Wht cn computer do with limited resources? (more prcticl) Pentium IV running inux kernel.4. Generl pproch. Don't tlk out specific mchines or prolems. Consider miniml strct mchines (DFA nd clss of prolems it cn solve). Consider generl clsses of prolems (next section more complicted mchines). Some of these questions seem ridiculously generl, ut we will descrie well-developed theories thn cn ddress these. ou need to understnd these issues or you'll e t disdvntge when solving prcticl pplictions. Why ern Theory In theory... Deeper understnding of wht is computer nd computing. Foundtion of ll modern computers. Pure science. Philosophicl implictions. In prctice... Pttern serch in ioinformtics: theory of pttern mtching. Sequentil circuits: theory of finite stte utomt. Compilers: theory of context free grmmrs. Cryptogrphy: theory of computtionl complexity. Dt compression, sequence nlysis: theory of informtion. "In theory there is no difference etween theory nd prctice. In prctice there is." -ogi Berr Introduction to Computer Science oert Sedgewick nd Kevin Wyne 3 egulr Expressions nd DFAs * (****)* 1 0 Wht s the regulr expression here? * ** ** 1 0 Pttern Mtching Applictions Test if string mtches some pttern. Process nturl lnguge. Scn for virus signtures. Serch for informtion using Google. Access informtion in digitl lirries. etrieve informtion from exis/exis. Serch-nd-replce in word processors. Filter text (spm, etnny, Crnivore, mlwre). Vlidte dt-entry fields (dtes, emil, U, credit crd). Serch for mrkers in humn genome using POSITE ptterns. Prse text files. Compile Jv progrm. Crwl nd index the We. ed in dt stored in TO input file formt. Automticlly crete Jv documenttion from Jvdoc comments. Introduction to Computer Science oert Sedgewick nd Kevin Wyne Introduction to Computer Science oert Sedgewick nd Kevin Wyne 6 1
2 3/5/1 egulr Expressions: Bsic Opertions egulr Expressions: Exmples Pttern Mtching in Google egulr expression. ottion to specify set of strings. egulr expression. ottion is surprisingly expressive. Google. Supports * for full word wildcrd nd for union. Opertion egulr Expression es o Conctention every other string Wildcrd.u.u.u. cumulus jugulum succuus tumultuous Union every other string Closure * ( ) every other string Prentheses ε ()* 7 egulr Expression es o.* sp.* contins the trigrph sp * (****)* multiple of three s.*0... fifth to lst digits is 0 gcg (cgg gg)* ctg frgile X syndrome indictor rsperry crispred gcgcggctg gcgcggggctg suspce suspecies gcgcgg cggcggcggctg gcgcggctg Frgile X syndrome is common cuse of mentl retrdtion epets: norml rnge: 5-50; crrier 51-00; disrupts production of FM protein nd usully cuses retrdtion (FM fcilittes trnsltion of essentil neuronl As) 8 9 Generlized egulr Expressions egulr Expressions in Jv Solving the Pttern Mtch Prolem egulr expressions re stndrd progrmmer's tool. Built in to Jv, Perl, Unix, Python,.... Additionl opertions typiclly dded for convenience. Ex: [-e]+ is shorthnd for ( c d e)( c d e)*. Opertion egulr Expression es o cde de One or more (c)+de ccde cde cpitlized cmelcse Chrcter clsses [A-Z-z][-z]* Word 4illegl Exctly k [0-9]{5-[0-9]{ egtions [^eiou]{6 rhythm decde Vlidity checking. Is input in the set descried y the re? pulic clss Vlidte { pulic sttic void min(string[] rgs) { String re = rgs[0]; String input = rgs[1]; System.out.println(input.mtches(re)); powerful string lirry method need help solving crosswords? % jv E "..oo..oo." loodroot legl Jv identifier % jv E "[$_A-Z-z][$_A-Z-z0-9]*" ident13 vlid emil ddress (simplified) % jv E "[-z]+@([-z]+\.)+(edu com)" ogt@cs.princeton.edu need quotes to "escpe" the shell egulr expressions re concise wy to descrie ptterns. How would you implement String.mtches? Hrdwre: uild deterministic finite stte utomton (DFA). Softwre: simulte DFA. DFA: simple mchine tht solves the pttern mtch prolem. Different mchine for ech pttern. Accepts or rejects string specified on input tpe. Focus on or flse questions for simplicity
3 3/5/1 Deterministic Finite Stte Automton (DFA) Wht does this DFA do? Theory of DFAs nd Es Simple mchine with sttes. Begin in strt stte. ed first input symol. Move to new stte, depending on current stte nd input symol. epet until lst input symol red. Accept string if unleled rc leves lst stte. DFA It recognizes itstrings with numer of 1 s divisile y 3, so 1101, , The regulr expression is: 0* 0* 1 0* 1 0* 1 0* E. Concise wy to descrie set of strings. DFA. Mchine to recognize whether given string is in given set. Dulity: for ny DFA, there exists regulr expression to descrie the sme set of strings; for ny regulr expression, there exists DFA tht recognizes the sme set. multiple of 3 's * (****)* multiple of 3 's Input Prcticl consequence of dulity proof: to mtch regulr expression ptterns, (i) uild DFA nd (ii) simulte DFA on input string Descriing more complex lnguges: FAs Implementing Pttern Mtcher Appliction: Hrvester FAs nondeterministic finite utomton An FA is finite stte mchine where for ech pir of stte nd input symol there my e severl possile next sttes Prolem: given regulr expression, crete progrm tht tests whether given input is in set of strings descried. Step 1: uild the DFA. A compiler! See COS 6 or COS 30. Step : simulte it with given input. Esy. Hrvest informtion from input strem. Hrvest ptterns from DA. % jv Hrvester "gcg(cgg gg)*ctg" chromosomex.txt gcgcggcggcggcggcggctg gcgcggcggcggggcggggcggctg Stte stte = strt; while (!ChrStdIn.isEmpty()) { chr c = ChrStdIn.redChr(); stte = stte.next(c); System.out.println(stte.ccept()); Hrvest emil ddresses from we for spm cmpign. % jv Hrvester "[-z]+@([-z]+\\.)+(edu com net tv)" ogt@cs.princeton.edu emil vlidtor (simplified) pop@cs.princeton.edu wyne@cs.princeton.edu
4 3/5/1 Appliction: Hrvester Appliction: Prsing Dt File Fundmentl Questions Hrvest informtion from input strem. Use Pttern dt type to compile regulr expression to FA. Use Mtcher dt type to simulte FA. import jv.util.regex.pttern; import jv.util.regex.mtcher; pulic clss Hrvester { pulic sttic void min(string[] rgs) { String re = rgs[0]; In in = new In(rgs[1]); String input = in.redall(); Pttern pttern = Pttern.compile(re); Mtcher mtcher = pttern.mtcher(input); while (mtcher.find()) { System.out.println(mtcher.group()); 19 Ex: prsing n CBI genome dt file. OCUS AC p DA liner HTG 13-OV-003 DEFIITIO Ornithorhynchus ntinus clone CM1-393H9, ACCESSIO AC VESIO AC GI: KEWODS HTG; HTGS_PHASE; HTGS_DAFT. SOUCE Ornithorhynchus ntinus (pltypus) OIGI 1 tgttttct ttgccgtgc tgttttttcc cggtttttc gtcggtgtt ggggccc 61 gtgttctgt ttgtttttg ctgccgt gctgctcgt gtctctgc tgcgct // comment 11 gccgcggg gtgcc gtttgtgtg ctgt gggctgt ttcttct ggtgcg ccccccgct tgtcgc ttctttgt tg // String re = "[ ]*[0-9]+([ctg ]*).*"; Pttern pttern = Pttern.compile(re); In in = new In(filenme); String line; while ((line = in.redine())!= null) { Mtcher mtcher = pttern.mtcher(line); if (mtcher.find()) { extrct the E prt in prentheses String s = mtcher.group(1).replceall(" ", ""); // do something with s replce this E with this string 0 Which lnguges CAOT e descried y ny E? Bit strings with equl numer of 0s nd 1s. Deciml strings tht represent prime numers. Genomic strings tht re Wtson-Crick complemented plindromes. Mny more.... How cn we extend Es to descrie richer sets of strings? Context free grmmr (e.g., Jv). eference: Q. How cn we mke simple mchines more powerful? Q. Are there ny limits on wht kinds of prolems mchines cn solve? 1 Summry Turing Mchine: Components Progrmmer. egulr expressions re powerful pttern mtching tool. Implement regulr expressions with finite stte mchines. Theoreticin. egulr expression is compct description of set of strings. DFA is n strct mchine tht solves pttern mtch prolem for regulr expressions. DFAs nd regulr expressions hve limittions. ou. Prcticl ppliction of core CS principles. 7.5: Turing Mchines Chllenge: Design simplest mchine tht is "s powerful" s conventionl computers. Aln Turing ( ) Aln Turing sought the most primitive model of computing device. Tpe. Stores input, output, nd intermedite results. One ritrrily long strip, divided into cells. Finite lphet of symols. Tpe hed. Points to one cell of tpe. eds symol from ctive cell. Writes symol to ctive cell. Moves left or right one cell t time. Write overwrites whtever symol is current. tpe tpe hed Wht s the key difference from DFAs? memory cn write to tpe nd move ck nd forth Introduction to Computer Science oert Sedgewick nd Kevin Wyne 4 4
5 3/5/1 Turing Mchine: Fetch, Execute Turing Mchine: Fetch, Execute Turing Mchine: Initiliztion nd Termintion Sttes. Finite numer of possile mchine configurtions. Determines wht mchine does nd which wy tpe hed moves. Stte trnsition digrm. Ex. if in stte nd input symol is 1 then: overwrite the 1 with x, move to stte 0, move tpe hed to left. 4 Sttes. Finite numer of possile mchine configurtions. Determines wht mchine does nd which wy tpe hed moves. Stte trnsition digrm. Ex. if in stte nd input symol is 1 then: overwrite the 1 with x, move to stte 0, move tpe hed to left. 4 Initiliztion. Set input on some portion of tpe. Set tpe hed. # # # # Set initil stte. Termintion. Stop if enter yes, no, or hlt stte. Infinite loop possile. 4 Before # # x x x # # After # # x x x 1 x 1 0 # # # # x x x x x x # # Exmple: Equl umer of 0's nd 1's Turing Mchine Summry Aln Turing find 1 Gol: simplest mchine tht is "s powerful" s conventionl computers. Surprising Fct 1. Such mchines re very simple. Surprising Fct. Some prolems cnnot e solved y A computer. Aln Turing ( ). Fther of computer science. Computer Science s oel Prize is clled the Turing Awrd. find left end skip x ccept find 0 reject Universlity/computility Consequences. lecture Precursor to generl purpose progrmmle mchines. Exposes fundmentl limittions of ll computers. Enles us to study the physics nd universlity of computtion. o need to seek more powerful mchines! It ws not only mtter of strct mthemtics, not only ply of symols, for it involved thinking out wht people did in the physicl world. It ws ply of imgintion like tht of Einstein or von eumnn, douting the xioms rther thn mesuring effects. Wht he hd done ws to comine such nïve mechnistic picture of the mind with the precise logic of pure mthemtics. His mchines soon to e clled Turing mchines offered ridge, connection etween strct symols, nd the physicl world. -John Hodges # # # # Aln Turing (left) Elder rother (right)
Lecture 18: Theory of Computation
Introduction to Theoreticl CS ecture 18: Theory of Computtion Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Pentium IV running inux kernel.4. Don't
More information7. Theory of Computation. Regular Expressions. Introduction to Theoretical CS. Why Learn Theory?
Introduction to Theoreticl CS 7. Theory of Computtion Q. Wht cn computer do? Q. Wht cn computer do with limited resources? Generl pproch. Don't tlk out specific mchines or prolems. Consider miniml strct
More informationPattern Matching. exact pattern matching Knuth-Morris-Pratt RE pattern matching grep
Pttern Mtching exct pttern mtching Knuth-Morris-Prtt RE pttern mtching grep exct pttern mtching Knuth-Morris-Prtt RE pttern mtching grep References: Algorithms in C (nd edition), Chpter 9 (pdf online)
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationShould be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night
Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd
More informationString Searching. String Search. Applications. Brute Force: Typical Case
String Serch String Serching String serch. Given pttern string p, find first mtch in text t. Model. Cn't fford to preprocess the text. Prmeters. N = length of text, M = length of pttern. typiclly N >>
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev
Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University
Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCompilation
Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCompiler Construction D7011E
Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More information12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>
DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationLexical Analysis and Lexical Analyzer Generators
1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationScanner Termination. Multi Character Lookahead
If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationExample: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:
Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationVirtual Machine (Part I)
Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()
More informationRegular Expressions and Automata using Miranda
Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationAutomata Processor. Tobias Markus Computer Architecture Group, University of Heidelberg
1 Automt Processor Tobis Mrkus Computer Architecture Group, University of Heidelberg Abstrct This pper gives brief overview over nondeterministic utomt nd the Automt Processor n rchitecture implemented
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationRegular Expressions. Why Learn Theory? !! Fundamental questions: Q. What can a computer do? Q. What can a computer do with limited resources?
Introduction to Theoretical Computer Science Introduction to Theoretical CS Fundamental questions: Q. What can a computer do? Q. What can a computer do with limited resources? General approach. Don't talk
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationIntroduction to Theoretical CS. Regular Expressions. Why Learn Theory? Why Learn Theory?
Why Learn Theory? Introduction to Theoretical CS Fundamental questions: Q. What can a computer do? Q. What can a computer do with limited resources? General approach. Don't talk about specific machines
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationThe dictionary model allows several consecutive symbols, called phrases
A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationUNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES
UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More informationPrinciples of Programming Languages
Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex
More informationMathematics Background
For more roust techer experience, plese visit Techer Plce t mthdshord.com/cmp3 Mthemtics Bckground Extending Understnding of Two-Dimensionl Geometry In Grde 6, re nd perimeter were introduced to develop
More informationStates and Statecharts. Outline
Outline Introduction Sttes Finite Automt Useful Fetures of FSA Sttechr t Bsics Sttechr t Exmples Conclusions Introduction Gols 1. Understnd stte s n mjor modeling component 2. Review finite utomt, for
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationValidation of XML Document Updates based on XML Schema in XML Databases * Sang-Kyun Kim 1, Myungcheol Lee 2 and Kyu-Chul Lee 1
Vlidtion of XML Document Updtes sed on XML Schem in XML Dtses * Sng-Kyun Kim 1, Myungcheol Lee 2 nd Kyu-hul Lee 1 1 Dept. of omputer ngineering, hungnm Ntionl University, KORA {skkim,kclee}@ce.cnu.c.kr
More informationContext-Free Grammars
Context-Free Grmmrs Describing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions describe precisely the strings in the lnguge.
More information