Finite-State Techniques for Speech Recognition
|
|
- Gervais Todd
- 5 years ago
- Views:
Transcription
1 Finite-Stte Techniques for Speech Recognition motivtion definitions finite-stte cceptor (FSA) finite-stte trnsducer (FST) deterministic FSA/FST weighted FSA/FST opertions closure, union, conctention intersection, composition epsilon removl, determiniztion, minimiztion on-the-fly implementtion FSTs in speech recognition:recognition cscde reserch systems within SLS impcted by FST frmework conclusion Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
2 Motivtion mny speech recognition components/constrints re finite-stte lnguge models (e.g., n-grms, on-the-fly CFGs) lexicons phonologicl rules N-best lists word grphs recognition pths should use sme representtion nd lgorithms for ll consistency mke powerful lgorithms vilble t ll levels flexibility to combine or fctor in unforeseen wys AT&T [Pereir, Riley, Ljolje, Mohri, et l.] Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
3 Finite-Stte Acceptor (FSA) b ε b 3 ccepts ( b) b definition: finite number of sttes one initil stte t lest one finl stte trnsition lbels: lbel from lphbet Σ must mtch input symbol ɛ consumes no input ccepts regulr lnguge Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
4 Finite-Stte Trnsducer (FST) b: :b ε:ε ε: 3 e.g., (b) (bb) definition, like FSA except: trnsition lbels: pirs of input:output lbels ɛ on input consumes no input ɛ on output produces no output reltes input sequences to output sequences (mybe mbiguous) FST with lbels x:x is n FSA Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 4
5 Finite-Stte Trnsducer (FST) finl sttes cn hve outputs, but we use ɛ trnsitions insted :b b :b ε:b trnsitions cn hve multiple lbels, but we split them up,b: c:b,c : b:b c:c Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 5
6 Weights /.6 /.4 b/.7 b/.3 /.5 trnsitions nd finl sttes cn hve weights (costs or scores) weight semirings (,,, ), prllel, series: x = x, x = x, x =, = (+,,, ) probbility (sum prllel, multiply series) / b/ /.5 b/.5 (min, +,, ) log probbility (best of prllel, sum series) /.4 b/. b/.3 / Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 6
7 Deterministic FSA or FST input sequence uniquely determines stte sequence no ɛ trnsitions t most one trnsition per lbel for ll sttes ε non-deterministic (NFA) deterministic (DFA) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 7
8 Opertions constructive opertions: closure A nd A + union A B conctention AB complementtion A intersection A B composition A B (FSA only) (FSA only) (FST only, FSA ) identity opertions (optimiztion): epsilon removl determiniztion minimiztion Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 8
9 Closure: A +,A ε A + = b ε A = b ε A = b ε Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 9
10 Union: A B prllel combintion, e.g., ε b c d = ε ε c 3 ε b 5 d Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
11 Conctention: AB seril combintion, e.g., b c d = b ε 3 4 ε c d Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
12 FSA Intersection: A B output sttes ssocited with input stte pirs (, b) output stte is finl only if both nd b re finl trnsition with lbel x only if both nd b hve x trnsition weights combined with x x x y x (,) = (,) y x (x y) x yz = x y (,) x y z Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
13 FST Composition: A B output sttes ssocited with input stte pirs (, b) output stte is finl only if both nd b re finl trnsition with lbel x:y only if hs x:α nd b hs α:y trnsition weights combined with IT:/ih/ IT:[ih] ε:/t/ ε:[tcl] /ih/:[ih] /t/:[t] ε:[t] /t/:[tcl] ε:[t] = (,) (,) (,) (,) ε:[t] (words phonemes) (phonemes phones) = (words phones) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
14 ɛ FST Composition: ɛ Interction A output ɛ llows B to hold B input ɛ llows A to hold ε:b (,) ε:b = (,) ε:b :b (,) (,) multiple pths typiclly filtered (resulting in ded end sttes) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 4
15 FST Composition: Prsing lnguge model from JSGF grmmr compiled into on-the-fly recursive trnsition network (RTN) trnsducer G: <top> = <forecst> <conditions>... ; <forecst> = [wht is the] forecst for <city> {FORECAST}; <city> = boston [msschusetts] {BOS} chicgo [illinois] {ORD}; wht is the forecst for boston G BOS FORECAST output tgs only <forecst> wht is the forecst for <city> boston </city> </forecst> brcketed prse Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 5
16 FST Composition Summry very powerful opertion cn implement other opertions: intersection ppliction of rules/trnsformtions instntition dictionry lookup prsing Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 6
17 Epsilon Removl (Identity) required for determiniztion compute ɛ-closure for ech stte:set of sttes rechble vi ɛ ε ε b c b b c c cn drmticlly increse number of trnsitions (copies) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 7
18 FSA Determiniztion (Identity) subset construction output sttes ssocited with subsets of input sttes tret subset s superposition of its sttes worst cse is exponentil ( N ) loclly optiml:ech stte hs t most Σ trnsitions b b b weights:subsets of (stte, weight) weights might be delyed trnsition weight is subset weights worst cse is infinite (not common) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 8
19 FST Determiniztion (Identity) subsets of (stte, output, weight) outputs nd weights might be delyed trnsition output is lest common prefix of subset outputs /t/:two /uw/:ε /t/:tea /iy/:ε 3 (,ε) /t/:ε (,TWO) (,TEA) /uw/:to /iy/:tea (3,ε) worst cse is infinite (not uncommon due to mbiguity) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 9
20 FST Ambiguity input sequence mps to more thn one output (e.g., homophones) finite mbiguity (delyed to output sttes): :x b:ε :y b:ε 3 b:ε ε:x 3 ε:y Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
21 FST Ambiguity cycles (e.g., closure) cn produce infinite mbiguity infinite mbiguity (cnnot be determinized): :x :y b:ε solution:our implementtion forces outputs t #, specil ɛ :x :y b:ε #:ε b:ε #:x #:y Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
22 Minimiztion (Identity) miniml miniml number of sttes miniml deterministic with miniml number of sttes merge equivlent sttes, will not increse size cyclic O(N log N ), cyclic O(N ) /s/:boston 5 /t/:ε 8 /x/:ε /n/:ε 4 /b/:ε /o/:ε 3 /z/:bosnia 6 /n/:ε 9 /iy/:ε /x/:ε 5 /o/:austin /s/:ε 4 /t/:ε 7 /x/:ε /n/:ε 3 /z/:bosnia 5 /n/:ε 7 /iy/:ε 9 /x/:ε /b/:ε /o/:austin /o/:ε 3 /s/:ε /s/:boston 4 /t/:ε 6 /x/:ε 8 /n/:ε Automtic Speech Recognition Finite-Stte Techniques [Hetherington]
23 Exmple Lexicon ε:ε ε:ε 3 ε:ε 4 ε:ε 5 ε:ε 6 ε:ε 7 ε:ε 8 ε:ε 9 ε:ε ε:ε ε:ε ε:ε 3 ε:ε 4 ε:ε 5 ε:ε 6 ε:ε 7 ε:ε 8 z:zinc 9 z:zillions z:zigzg z:zest z:zeroth 3 z:zeros 4 z:zeroing 5 z:zeroes 6 z:zeroed 7 z:zero 8 z:zenith 9 z:zebrs 3 z:zebr 3 z:zelousness 3 z:zelously 33 z:zelous 34 z:zel n:ε g:ε n:ε 63 b:ε 64 b:ε c:ε 7 7 z:ε 7 t:ε t:ε t:ε g:ε h:ε n:ε 3 4 d:ε 5 h:ε 6 7 u:ε 8 u:ε 9 u:ε n:ε g:ε n:ε y:ε Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
24 Exmple Lexicon: ɛ Removed z:zinc z:zillions 3 z:zigzg 4 z:zest 5 z:zeroth 6 z:zeros 7 z:zeroing 8 z:zeroes 9 z:zeroed z:zero z:zenith z:zebrs 3 z:zebr 4 z:zelousness 5 z:zelously 6 z:zelous 7 z:zel n:ε g:ε n:ε 46 b:ε 47 b:ε c:ε 5 53 z:ε 89 t:ε t:ε t:ε g:ε 95 h:ε 77 n:ε d:ε 98 h:ε u:ε 79 u:ε 8 u:ε 8 n:ε g:ε n:ε y:ε Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 4
25 Exmple Lexicon: Determinized n:zinc 4 c:ε l:zillions n:ε 38 4 g:zigzg 6 z:ε 4 g:ε 3 z:ε n:zenith 7 5 t:ε ε:zero 48 h:ε 3 s:zest 8 t:ε 6 i:zeroing 3 n:ε 3 g:ε 39 3 b:ε 9 7 s:zeros 4 s:zeroes d:zeroed 33 8 t:zeroth 5 6 h:ε ε:zebr s:zebrs 5 9 ε:zel 49 8 u:ε ε:zelous n:zelousness l:zelously y:ε 45 lexicl tree shring t beginning of words:cn prune mny words t once Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 5
26 Exmple Lexicon: Minimized n:zinc 4 c:ε l:zillions g:zigzg 5 n:zelousness n:ε 7 z:ε 7 4 u:ε z:ε 3 ε:zel l:zelously ε:zelous 3 n:ε y:ε 9 g:ε 3 s:zest b:ε n:zenith t:ε t:ε 5 i:zeroing t:zeroth h:ε d:zeroed s:zeroes 3 s:zeros ε:zero 6 3 ε:zebr s:zebrs shring t the end of words Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 6
27 On-The-Fly Implementtion lzy evlution:generte only relevnt sttes/trnsitions enbles use of infinite-stte mchines (e.g., CFG) on-the-fly: composition, intersection union, conctention, closure ɛ removl, determiniztion not on-the-fly: trimming ded sttes minimiztion reverse Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 7
28 FSTs in Speech Recognition cscde of FSTs: (S A) (C } P {{ L G } ) R S:coustic segmenttion* A:ppliction of coustic models* C:context-dependent relbeling (e.g., diphones, triphones) P:phonologicl rules L:lexicon G:grmmr/lnguge model (e.g., n-grm, finite-stte, RTN) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 8
29 FSTs in Speech Recognition in prctice: S A is coustic segmenttion with on-demnd model scoring C P L G:precomputed nd optimized or expnded on the fly composition S A with C P L G computed on demnd during forwrd Viterbi serch might use multiple psses, perhps with different G dvntges: forwrd serch sees single FST R = C P L G, doesn t need specil code for lnguge models, lexicl tree copying, etc... cn bevery fst esy to do cross-word context-dependent models Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 9
30 N -grm Lnguge Model (G): Bigrm in/. in/3.3 in ε/8. Boston/.8 Boston/4.3 ε/7. Boston in/8.7 * Nome/6.3 ε/3. Nome ech distinct word history hs its own stte direct trnsitions for ech existing n-grm ɛ trnsitions to bck-off stte (*), ɛ removl undesirble Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
31 P Phonologicl Rules (P) segmentl system needs to mtch explicit segments ordered rules of the form: {V SV} b {V l r w} => bcl [b] ; {m} b {} => [bcl] b ; {} b {} => bcl b ; {s} s {} => [s] ; {} s {} => s ; rule selection deterministic, rule replcement my be mbiguous compile rules into trnsducer P = P l P r P l pplied left-to-right P r pplied right-to-left Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
32 EM Trining of FST Weights FSA A x given set of exmples x strightforwrd ppliction of EM to trin P(x) our tools cn lso trin n RTN (CFG) FST T x:y given set of exmple pirs x : y strightforwrd ppliction of EM to trin T x,y P(x, y) [ T x y = T x,y det(t y ) ] P(x y) [Byes Rule] FST T x y within cscde S v x T x y U z given v : z x = v S y = U z trin T x y given x : y We hve used these techniques to trin P, L, nd (P L) Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 3
33 Conclusion introduced FSTs nd their bsic opertions use of FSTs throughout system dds consistency nd flexibility consistency enbles powerful lgorithms everywhere (write lgorithms once) flexibility enbles new nd unforeseen cpbilities (but enbles you to hng yourself too) SUMMIT (Jupiter) 5% fster when converted to FST frmework, yet much more flexible Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 33
34 References E. Roche nd Y. Schbes (eds.), Finite-Stte Lnguge Processing, MIT Press, Cmbridge, 997. M. Mohri, Finite-stte trnsducers in lnguge nd speech processing, in Computtionl Linguistics, vol. 3, 997. M. Mohri, M. Riley, D. Hindle, A. Ljolje, F. Pereir, Full expnsion of context-dependent networks in lrge vocbulry speech recognition, in Proc. ICASSP, Settle, Automtic Speech Recognition Finite-Stte Techniques [Hetherington] 34
CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationScanner Termination. Multi Character Lookahead
If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationacronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata
EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More information10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing
Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationLEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class
LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev
Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationEfficient Regular Expression Grouping Algorithm Based on Label Propagation Xi Chena, Shuqiao Chenb and Ming Maoc
4th Ntionl Conference on Electricl, Electronics nd Computer Engineering (NCEECE 2015) Efficient Regulr Expression Grouping Algorithm Bsed on Lbel Propgtion Xi Chen, Shuqio Chenb nd Ming Moc Ntionl Digitl
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationLexical Analysis and Lexical Analyzer Generators
1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies
More informationWFST: Weighted Finite State Transducer. September 12, 2017 Prof. Marie Meteer
+ WFST: Weighted Finite State Transducer September 12, 217 Prof. Marie Meteer + FSAs: A recurring structure in speech 2 Phonetic HMM Viterbi trellis Language model Pronunciation modeling + The language
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationCMPT 379 Compilers. Lexical Analysis
CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule
More informationCS 268: IP Multicast Routing
Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationPrinciples of Programming Languages
Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationSOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES
SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES MARCELLO DELGADO Abstrct. The purpose of this pper is to build up the bsic conceptul frmework nd underlying motivtions tht will llow us to understnd ctegoricl
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationThe Replace Operator
The Replce Opertor Luri Krttunen Rnk Xero Reserch Centre 6, chemin de Mupertuis F-38240 Meyln, Frnce luri.krttunen@ero.fr Astrct This pper introduces to the clculus of regulr epressions replce opertor
More informationECEN 468 Advanced Logic Design Lecture 36: RTL Optimization
ECEN 468 Advnced Logic Design Lecture 36: RTL Optimiztion ECEN 468 Lecture 36 RTL Design Optimiztions nd Trdeoffs 6.5 While creting dtpth during RTL design, there re severl optimiztions nd trdeoffs, involving
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationWeighted Finite State Transducers in Automatic Speech Recognition
Weighted Finite State Transducers in Automatic Speech Recognition ZRE lecture 10.04.2013 Mirko Hannemann Slides provided with permission, Daniel Povey some slides from T. Schultz, M. Mohri and M. Riley
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More information