Lecture T4: Pattern Matching
|
|
- Sydney Clark
- 6 years ago
- Views:
Transcription
1 Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct mchines. Consider generl clsses of relted problems. 2 Tody. Simplest type of mchine tht is still interesting = FSA. Clss of (pttern mtching) problems tht it cn solve. Future lectures. More complicted mchines nd problems. 3/29/ Copyright 2, Kevin Wyne T.8 Why Lern Theory In theory... Deeper understnding of wht is computer nd computing. Foundtion of ll modern computers. Pure science. Philosophicl implictions. In prctice... Web serch: theory of pttern mtching. Sequentil circuit: theory of finite stte utomt. Compilers: theory of context free grmmr. Cryptogrphy: theory of complexity. Web Serch Exmple Stndrd Web serch for +censorship +net might yield million hits, ordered s follows: Observtion: not mny useful pges. 3/29/ Copyright 2, Kevin Wyne T.9 3/29/ Copyright 2, Kevin Wyne T.
2 3/29/ Copyright 2, Kevin Wyne T. Web Serch Exmple Stndrd Web serch for +censorship +net might yield million hits, ordered s follows: Jon Kleinberg s clever lgorithm produces "uthorittive" pges without humn fine-tuning: (Electronic Frontier Foundtion) (Center for Democrcy nd Technology) (Voters Telecommunictions Wtch) (Americn Civil Liberties Union) Unix Tools Unix. A lrge number of simple tools. Some fundmentl pttern mtching tools. egrep, wk, sed, more, emcs, perl Useful for vriety of pplictions including Web serch. Not C progrmming, though tools re s powerful. Directly relted to fundmentls tenets of computer science. Bsed on theoreticl principles. Involves computing eigenvectors of Web mtrix! Use google.com 3/29/ Copyright 2, Kevin Wyne T.2 egrep Crossword Puzzle or Scrbble Too Hrd? Generl regulr expressions pttern mtching. Acts s filter. Sends lines from stdin to stdout tht "mtch" rgument string. Elementry Exmples %egrep beth clsslist 2/Condliffe/Elizbeth/3/condlife 3/Dnher/Elizbeth/8/ednher 3/Smythe/Elizbeth/6/esmythe 3/Bethke/Kristen/3/kbethke % egrep /3/ clsslist 3/Mrin/Anthony/3/mrin 3/Prker/Andrew/3/prker... 3/Weiss/Jcob/3/weiss Find ll lines in file clsslist with substring beth List ll people in precept 3. %egrep zeuglodon mobydick.txt rechristened the monster zeuglodon nd in his 3/29/ Copyright 2, Kevin Wyne T.3 /usr/dict/words is list of (25,43) words in dictionry. More Exmples % egrep hh /usr/dict/words bechhed highhnded Two consecutive h s. withheld withhold % egrep u.u.u /usr/dict/words cumulus % egrep..oo..oo /usr/dict/words bloodroot schoolbook Why not "cookbook"? schoolroom % egrep -c..oo..oo /usr/dict/words 3 A dot mtches ny single chrcter count number of mtches 3/29/ Copyright 2, Kevin Wyne T.4
3 3/29/ Copyright 2, Kevin Wyne T.5 % mn egrep Excerpts From "mn egrep" Unix Nme: egrep - serch file using full regulr expressions Syntx: egrep [option...] expression [file...] Description: Serch the input files (stndrd input defult) for lines mtching pttern. Normlly, ech line found is copied to the stndrd output. Tke cre when using specil chrcters in the expression becuse they re lso meningful to the Shell. It is sfest to enclose the entire expression rgument in single quotes. Options: -c Produces count of mtching lines only. -i Considers upper nd lowercse letter identicl. -n Precedes ech mtching line with its line number. -v Displys ll lines tht do not mtch. Grep Pttern Conventions Conventions for egrep: c ny non-specil chrcter mtches itself. ny single chrcter r* zero or more occurrence of r (r) grouping r r2 logicl OR [...] ny chrcter in [-z] [^...] ny chrcter not in [-z] ^ beginning of line $ end of line Restrictions: Lines re limited to 256 chrs; longer lines re truncted. 3/29/ Copyright 2, Kevin Wyne T.6 Still More Exmples Pttern Mtching Alterntives in Unix Unix % egrep n(ie ei)ther /usr/dict/words neither % egrep ctg(tc)*gct humn.dt ggtctggctggc % egrep ctg(tc)*gct student.dt ttctgtctctcgctttc % egrep ^y.(..)*y$ /usr/dict/words yesterdy % grep -v [eiou] /usr/dict/words grep... rhythm syzygy Do spell checking by specifying wht you know. Strts nd ends with y, odd number of chrcters. Find ll words with no vowels nd 6 or more letters. Pttern mtching. grep, egrep more Substitution editing. emcs, ex sed: filter, line by line substitution sed s/pples/ornges/g file.txt Pttern mtching lnguges. wk, perl Mtching, substitution, pttern mnipultion, vribles, numeric cpbilities, control nd logic. 3/29/ Copyright 2, Kevin Wyne T.7 3/29/ Copyright 2, Kevin Wyne T.8
4 3/29/ Copyright 2, Kevin Wyne T.9 Regulr Expressions Regulr Expressions Specifying "pttern" for grep cn be complex. ^[^eiou]*[^eiou]*e[^eiou]*i[^eiou]*o[^eiou]*u[^eiou]*! fcetious Wht kinds of ptterns cn be specified? Mtch ll lines contining n even number? Mtch ll lines contining prime number? Which spects re essentil? Unix egrep regulr expressions re useful. But more complex thn theoreticl minimum. Rules for creting regulr expressions (RE s): or symbols () grouping b conctention + b logicl OR use + insted of * closure ( or more replictions) where nd b re regulr expressions. Exmples: ()* ε = empty string ε,,,,... ( + )*,,,,,... (****)* ε,,,,... 3/29/ Copyright 2, Kevin Wyne T.2 Forml Lnguges Why Study Forml Lnguges? An lphbet is finite set of symbols. Binry lphbet = {, } Lower-cse lphbet = {, b, c, d,..., y, z} Genetic lphbet = {, c, t, g} Cn cst ny computtion s lnguge recognition problem. Is x = 23,536,48,273 prime number?! L = {2, 3, 5, 7,, 3, 7,... }! Is x in lnguge L? A string is finite sequence of symbols in the lphbet. is string in the binry lphbet. tigers is string in the lower-cse lphbet. cctgct is string in the genetic lphbet. A forml lnguge is n (unordered) set of strings in n lphbet. Cn hve infinitely mny strings. Exmples: {,,,,,,...} {,,,,,...} 3/29/ Copyright 2, Kevin Wyne T.2 3/29/ Copyright 2, Kevin Wyne T.22
5 3/29/ Copyright 2, Kevin Wyne T.23 Regulr Lnguges Mchines Every RE describes lnguge (the set of ll strings tht mtch). (***)* describes the lnguge of ll bit strings with n even number of s: {,,,,...} Regulr lnguge. Any lnguge tht cn be described by RE. Which lnguges re regulr? (ll but one of the following) Cn cst ny computtion s lnguge recognition problem. Is x = 23,536,48,273 prime number? L = {2, 3, 5, 7,, 3, 7,... } Is x in lnguge L? Strt by trying to understnd simple lnguges. Build mchine to recognize regulr lnguges. All bit strings tht: Exmple Begin with nd end with. Hve multiple of 3 s. Hve more s thn s. Hve no consecutive s. 3/29/ Copyright 2, Kevin Wyne T.25 Finite Stte Automt C Code for ()* FSA Simple mchine with N sttes. Strt in stte. Red n input bit. Move to new stte depends on input bit nd current stte Stop when lst bit red. yes if end in ccept stte(s) no otherwise Yes lso clled ccepted or recognized inputs from lnguge. FSA to right ccepts ll bit strings of the form ()* Rejects ll others. strt stte 2 3 ccept stte fs.c int min(void) { int c, stte = START_STATE; while ((c = getchr())!= EOF) { if (stte == && c == ) stte = 2; if (stte == && c == ) stte = ; if (stte == && c == ) stte = 3; if (stte == && c == ) stte = 2; if (stte == 2 && c == ) stte = 2; if (stte == 2 && c == ) stte = 2; if (stte == 3 && c == ) stte = 2; if (stte == 3 && c == ) stte = ; } if (stte == ACCEPT_STATE) printf("accepted\n"); else printf("rejected\n"); return ; 3/29/ Copyright 2, Kevin Wyne T.27 3/29/ Copyright 2, Kevin Wyne T.28
6 3/29/ Copyright 2, Kevin Wyne T.29 Better C Code for FSA #include <stdio.h> #define STATES 4 #define ALPHABET_SIZE 2 #define START_STATE #define ACCEPT_STATE 3 fs.c int min(void) { int c, stte = START_STATE int trnsition[states][alphabet_size] = { {2, }, {3, 2}, {2, 2}, {2, } }; while ((c = getchr())!= EOF) if (c >= && c < + ALPHABET_SIZE) stte = trnsition[stte][c - ]; if (stte == ACCEPT_STATE) printf("accepted\n"); else printf("rejected\n"); return ; } A Second Exmple Consider the following two stte FSA. Wht bit strings does it ccept? Yes:,,,, ll bit strings with n odd number of s. No:,,,, ll bit strings with n even number of s. Recognizes sme lnguge s (***)* (**) even # of s exctly one 3/29/ Copyright 2, Kevin Wyne T.3 A Third Exmple More Applictions Build n FSA tht ccepts ll strings tht contin ct s substring. tgctg cctg cgt Finish building: c cgt φ c c c t ct gt cgt g 3/29/ Copyright 2, Kevin Wyne T.35 3/29/ Copyright 2, Kevin Wyne T.36
7 3/29/ Copyright 2, Kevin Wyne T.37 Dulity Between FSA s nd RE s Observtion: every FSA we crete genertes regulr lnguge. (the inputs ccepted cn be specified by regulr expression) Is this lwys the cse?! Yes. It s no coincidence. Wht bout the OTHER wy round? Suppose I give you regulr expression. Cn you lwys crete FSA tht ccepts precisely the sme strings?! Yes. I don t see why? FSA re simple mchines. Limittions of FSA N sttes cn t remember more thn N things. Some lnguges require remembering more thn N things. No FSA cn recognize the lnguge of ll bit strings with n equl number of s nd s. A wrmup exercise: Sty tuned: see Lecture T2. If xyz ccepted then so is xyz 3/29/ Copyright 2, Kevin Wyne T.38 Limittions of FSA No FSA cn recognize the lnguge of ll bit strings with n equl number of s nd s. Suppose n N-stte FSA cn recognize this lnguge. Consider following input: FSA must ccept this string. N+ s N+ s Some stte x is revisited during first N+ s since only N sttes. x x Limittions of Regulr Lnguges Consequence: there re lnguges tht re not regulr. No FSA cn recognize the lnguge of ll bit strings with n equl number of s nd s. We climed tht FSA s re equivlent to regulr expressions, i.e., for ny regulr lnguge, there is FSA tht ccepts precisely those strings the lnguge of ll strings ccepted by ny specific FSA is regulr Hence, the lnguge bove cnnot be regulr. Mchine would ccept sme string without intervening s. "FSA s cn t count." This string doesn t hve n equl number of s nd s. 3/29/ Copyright 2, Kevin Wyne T.39 3/29/ Copyright 2, Kevin Wyne T.4
8 3/29/ Copyright 2, Kevin Wyne T.4 Looking Ahed A Fourth Exmple Tody. Defined simple bstrct mchine = FSA. Cpble of pttern mtching. Incpble of "counting." Need to consider more powerful mchines. Hmm. Which will we run out of first? FSA to decide if input (convert binry to deciml) is divisible by 3? 2 Future lectures. Define n bstrct mchine. Understnd how it works nd wht it cn do. Find things it cn t do. Define more powerful mchine. Repet until we run out of problems or mchines. is strt nd ccept stte Wht bit strings does it ccept? Yes: (3 ), (6 ), (9 ), (2 ), (5 ), integers whose binry representtion is divisible by 3. No:,,,,, integers not divisible by 3. 3/29/ Copyright 2, Kevin Wyne T.42 A Fourth Exmple An Appliction: Bounce Filter FSA to decide if input (convert binry to deciml) is divisible by 3? How does it work? Stte : input so fr is divisible by 3. Stte : input hs reminder upon division by 3. Stte 2: input hs reminder 2 upon division by 3. Trnsition exmple. Input (2) ends in stte. If next bit is then sty in stte. Adding to lst bit is sme s multiplying number by 2. Remins divisible by 3. 2 Bounce filter: remove isolted s nd s in input. Input: Output (one-bit dely): - x/y: if input is x, then chnge stte nd OUTPUT y / / / / / / / 2 3 / 3/29/ Copyright 2, Kevin Wyne T.43 3/29/ Copyright 2, Kevin Wyne T.44
9 3/29/ Copyright 2, Kevin Wyne T.45 An Appliction: Bounce Filter Bounce filter: remove isolted s nd s in input. Input: Output (one-bit dely): - x/y: if input is x, then chnge stte nd OUTPUT y Stte interprettions. : t lest two consecutive s : sequence of s followed by 2: t lest two consecutive s 3: sequence of s followed by
Lecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationECE 468/573 Midterm 1 September 28, 2012
ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationSome Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing
Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationLecture 18: Theory of Computation
Introduction to Theoreticl CS ecture 18: Theory of Computtion Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Pentium IV running inux kernel.4. Don't
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationCS 321 Programming Languages and Compilers. Bottom Up Parsing
CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationContext-Free Grammars
Context-Free Grmmrs Describing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions describe precisely the strings in the lnguge.
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationSpring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.
15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge
More informationLecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure
Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More informationProblem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.
Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)
More informationCompiler Construction D7011E
Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationFall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev
Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationAutomata Processor. Tobias Markus Computer Architecture Group, University of Heidelberg
1 Automt Processor Tobis Mrkus Computer Architecture Group, University of Heidelberg Abstrct This pper gives brief overview over nondeterministic utomt nd the Automt Processor n rchitecture implemented
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More information10/9/2012. Operator is an operation performed over data at runtime. Arithmetic, Logical, Comparison, Assignment, Etc. Operators have precedence
/9/22 P f Performing i Si Simple l Clcultions C l l ti with ith C#. Opertors in C# nd Opertor Precedence 2. Arithmetic Opertors 3. Logicl Opertors 4. Bitwise Opertors 5. Comprison Opertors 6. Assignment
More informationLEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class
LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationSample Midterm Solutions COMS W4115 Programming Languages and Translators Monday, October 12, 2009
Deprtment of Computer cience Columbi University mple Midterm olutions COM W4115 Progrmming Lnguges nd Trnsltors Mondy, October 12, 2009 Closed book, no ids. ch question is worth 20 points. Question 5(c)
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationPYTHON PROGRAMMING. The History of Python. Features of Python. This Course
The History of Python PYTHON PROGRAMMING Dr Christin Hill 7 9 November 2016 Invented by Guido vn Rossum* t the Centrum Wiskunde & Informtic in Amsterdm in the erly 1990s Nmed fter Monty Python s Flying
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationScanner Termination. Multi Character Lookahead
If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationStates and Statecharts. Outline
Outline Introduction Sttes Finite Automt Useful Fetures of FSA Sttechr t Bsics Sttechr t Exmples Conclusions Introduction Gols 1. Understnd stte s n mjor modeling component 2. Review finite utomt, for
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More information