Lecture T1: Pattern Matching

Size: px
Start display at page:

Download "Lecture T1: Pattern Matching"

Transcription

1 Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems. Consider miniml strct mchines. Consider enerl clsses of prolems. Why Lern Theory In theory... Deeper understndin of wht is computer nd computin. Foundtion of ll modern computers. Pure science. Philosophicl implictions. Simple mchine with N sttes. Finite Stte Automton In prctice... We serch: theory of pttern mtchin. Sequentil circuit: theory of finite stte utomt. Compilers: theory of context free rmmr. Cryptorphy: theory of complexity. Dt compression: theory of informtion. 3 4

2 Finite Stte Automt C Code for FSA Simple mchine with N sttes. Strt in stte. Red n input it. Move to new stte depends on input it nd current stte Stop when lst it red. yes if end in ccept stte(s) no otherwise strt stte 3 ccept stte fs3.c #include <stdio.h> #define STATES 4 #define START_STATE #define ACCEPT_STATE 3 int min(void) { int i, stte = START_STATE; int trnsition[states][] = { {, }, {3, }, {, }, {, } }; use D rry Yes lso clled ccepted or reconized inputs from lnue.! Yes:,,,,...! No: ll others. Trnsition Tle Stte 3 3 } while (scnf("%d", &i)!= EOF) stte = trnsition[stte][i]; if (stte == ACCEPT_STATE) printf("yes.\n"); else printf("no.\n"); return ; Trnsition Tle Stte A Second Exmple An Appliction: Bounce Filter Consider the followin two stte FSA. Bounce filter: remove isolted s nd s in input. Input: Output (one-it dely): w Wht it strins does it ccept? Yes:,,,! All it strins with n odd numer of s. BB G W No:,,,! All it strins with n even numer of s. GG B no ccept stte insted output color of ech stte you visit 7 8

3 An Appliction: Bounce Filter Bounce filter: remove isolted s nd s in input. Input: Output (one-it dely): w Text Serchin Build n FSA tht ccepts ll strins tht contin ct s sustrin. ttct cct Stte interprettions. W: strt BB: t lest two consecutive s. G: sequence of s followed y. GG: t lest two consecutive s. B: sequence of s followed y. ct Strt uildin: c t φ c c ct ct Stte nme represents lrest prefix of "ct" tht input currently mtches. 9 Text Serchin Build n FSA tht ccepts ll strins tht contin ct s sustrin. ttct cct Finish uildin: ct c ct We Serch Appliction We serch enines uild FSA s. Stndrd We serch for: cos 6 pttern mtchin! Finds one mtchin pe on whole Internet. Serch enines hve different methods for specifyin ptterns. Which one is most powerful? Theory of computtion helps us ddress such issues. φ c c c t ct t ct 4 5

4 Unix Pttern Mtchin Tool: erep Crossword Puzzle or Scrle Too Hrd? Generl reulr expressions pttern mtchin. Acts s filter. /usr/dict/words is list of (5,43) words in dictionry. /u/cs6/files/textfiles/wordlist.txt is list of 34,936 words. Sends lines from stdin to stdout tht "mtch" rument strin. Elementry Exmples %erep eth clsslist 3/Smythe/Elizeth/6/esmythe 3/Bethke/Kristen/3/kethke % erep /3/ clsslist 3/Mrin/Anthony/3/mrin 3/Arellno/Belen/3/rellno... 3/Weiss/Jco/3/weiss Find ll lines in file clsslist with sustrin eth List ll people in precept 3. More Exmples % erep hh /usr/dict/words echhed hihhnded Two consecutive h s. withheld withhold % erep u.u.u /usr/dict/words cumulus A dot mtches ny sinle chrcter %erep zeulodon moydick.txt rechristened the monster zeulodon nd in his %erep ct humn.dt cccccctctttt 6 % erep..oo..oo /usr/dict/words loodroot nincompoophood schoolook ut not "cookook" schoolroom 7 Erep Pttern Conventions Still More Exmples Conventions for erep: c ny non-specil chrcter mtches itself. ny sinle chrcter r* zero or more occurrence of r r+ one or more occurrence of r r? zero or one occurrence of r (r) roupin r r loicl OR [eiou] ny vowel [^ eiou] ny non-vowel ^ einnin of line $ end of line Fls for erep: erep -v mtch ll lines except those specified y pttern Unix % erep n(ie ei)ther /usr/dict/words neither % erep ct(tc)*ct humn.dt tctctc % erep ct(tc)*ct student.dt ttcttctctcctttc % erep ^y.(..)*y$ /usr/dict/words yesterdy % erep -v [eiou] /usr/dict/words erep... rhythm syzyy Do spell checkin y specifyin wht you know. Strts nd ends with y, odd numer of chrcters. Find ll words with no vowels nd 6 or more letters. 8 9

5 Fundmentl Questions: Theoreticl Minimum Fundmentl Questions: Theoreticl Minimum Specifyin "pttern" for erep cn e complex. ^[^eiou]*[^eiou]*e[^eiou]*i[^eiou]*o[^eiou]*u[^eiou]*! stemious! fcetious Which spects re essentil? Unix erep reulr expressions re useful. But more complex thn theoreticl minimum. Reulr expressions. Mtch WHOLE strin. (to convert to equivlent erep pttern, surround y ^ nd $) reulr expression: ( )* erep pttern: ^( )*$ c ny non-specil chrcter mtches itself r* zero or more occurrence of r (r) roupin r r loicl OR r r conctente (usully suppress symol). ny sinle chrcter [eiou] ny vowel [^ eiou] ny non-vowel r+ one or more occurrences of r not needed r? zero or one occurrence of r -v mtch ll ptterns except Fundmentl Questions: Wht Kinds of Ptterns Fundmentl Questions: Wht Kinds of Ptterns Wht kinds of ptterns cn e specified y reulr expressions? (ll ut one of followin) Wht kinds of ptterns cn e specified y reulr expressions? (ll ut one of followin) All it strins tht: Exmple Bein with nd end with. Equl numer of s nd s. Hve no consecutive s. Hs nd odd numer of s. Hs s sustrin. All it strins tht: Reulr Expression Bein with nd end with. ( )* Equl numer of s nd s. not possile Hve no consecutive s. ( )*( *) Hs nd odd numer of s. (***)*(**) Hs s sustrin. ( )*( )* 3

6 Forml Lnues An ALPHABET is finite set of symols. Binry lphet = {, } Lower-cse lphet = {,, c, d,..., y, z} Genetic lphet = {, c, t, } A STRING is finite sequence of symols in the lphet. is strin in the inry lphet. tiers is strin in the lower-cse lphet. cctct is strin in the enetic lphet. Forml Lnues Cn cst ny computtion s lnue reconition prolem. Is x = 3,536,48,73 prime numer?! L = {, 3, 5, 7,, 3, 7,... }! Is x in lnue L? FSA. Mchine determines whether strin is in lnue. Reulr expression. Shorthnd method for specifyin lnue. A FORMAL LANGUAGE is n (unordered) set of strins in n lphet. Cn hve infinitely mny strins. Exmples: {,,,,,,...} {,,,,,...} (***)*(**) even # of s exctly one 4 5 Dulity Between FSA s nd RE s Oservtion: for ech FSA we crete, we cn find reulr expression tht mtches the sme strins tht the FSA ccepts. Is this lwys the cse?! Yes. Wht out the OTHER wy round?! Yes. I don t see why? FSA re simple mchines. Limittions of FSA N sttes cn t "rememer" more thn N thins. Some lnues require "rememerin" more thn N thins. No FSA cn reconize the lnue of ll it strins with n equl numer of s nd s. A wrmup exercise: Sty tuned: see Lecture T. If xyz ccepted then so is xyz 6 7

7 Limittions of FSA No FSA cn reconize the lnue of ll it strins with n equl numer of s nd s. Suppose n N-stte FSA cn reconize this lnue. Consider followin input: N+ s N+ s Lookin Ahed Tody. Defined simple strct mchine = FSA. Cple of pttern mtchin. Incple of "countin." Need to consider more powerful mchines. Hmm. Which will we run out of first? FSA must ccept this strin. Some stte x is revisited durin first N+ s since only N sttes. x x Mchine would ccept sme strin without intervenin s. Future lectures. Define n strct mchine. Understnd how it works nd wht it cn do. Find thins it cn t do. Define more powerful mchine. Repet until we run out of prolems or mchines. This strin doesn t hve n equl numer of s nd s. 8 9 Lecture T: Supplementl Notes C Code for FSA fs.c #include <stdio.h> int min(void) { int c, stte = ; while ((c = etchr())!= EOF) { if (stte == && c == ) stte = ; if (stte == && c == ) stte = ; if (stte == && c == ) stte = 3; if (stte == && c == ) stte = ; if (stte == && c == ) stte = ; if (stte == && c == ) stte = ; if (stte == 3 && c == ) stte = ; if (stte == 3 && c == ) stte = ; } } if (stte == 3) printf("yes.\n"); else printf("no.\n"); return ; strihtforwrd to convert FSA s into C prorm or to uild with hrdwre 3

8 A Fourth Exmple A Fourth Exmple FSA to decide if inteer (represented in inry) is divisile y 3? FSA to decide if input (convert inry to deciml) is divisile y 3? is strt nd ccept stte Wht it strins does it ccept? Yes: (3 ), (6 ), (9 ), ( ), (5 ), (8 ), inteers divisile y 3. No: ( ), ( ), (4 ), (5 ), (7 ), inteers not divisile y 3. How does it work? Stte : input so fr is divisile y 3. Stte : input hs reminder upon division y 3. Stte : input hs reminder upon division y 3. Trnsition exmple. Input ( ) ends in stte. If next it is then sty in stte : (4 ). Addin to lst it is sme s multiplyin numer y. Remins divisile y Reulr Expressions Rules for cretin reulr expressions (RE s): or or ε symols () roupin conctention + loicl OR * closure ( or more replictions) use + insted of where nd re reulr expressions. Exmples: ε = empty strin ()* ε,,,,... ( + )*,,,,,... (****)* ε,,,,... 37

Lecture T4: Pattern Matching

Lecture T4: Pattern Matching Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Lecture 18: Theory of Computation

Lecture 18: Theory of Computation Introduction to Theoreticl CS ecture 18: Theory of Computtion Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Pentium IV running inux kernel.4. Don't

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Introduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example

Introduction to Computer Engineering EECS 203  dickrp/eecs203/ CMOS transmission gate (TG) TG example Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center

The Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org

More information

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012 1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

7. Theory of Computation. Regular Expressions. Introduction to Theoretical CS. Why Learn Theory?

7. Theory of Computation. Regular Expressions. Introduction to Theoretical CS. Why Learn Theory? Introduction to Theoreticl CS 7. Theory of Computtion Q. Wht cn computer do? Q. Wht cn computer do with limited resources? Generl pproch. Don't tlk out specific mchines or prolems. Consider miniml strct

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

Introduction to Theoretical CS

Introduction to Theoretical CS 3/5/1 7: Theory of Computtion Introduction to Theoreticl CS Two fundmentl questions. Wht cn computer do? (the most fundmentl question) Wht cn computer do with limited resources? (more prcticl) Pentium

More information

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables

George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

The dictionary model allows several consecutive symbols, called phrases

The dictionary model allows several consecutive symbols, called phrases A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion

More information

Mathematics Background

Mathematics Background For more roust techer experience, plese visit Techer Plce t mthdshord.com/cmp3 Mthemtics Bckground Extending Understnding of Two-Dimensionl Geometry In Grde 6, re nd perimeter were introduced to develop

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program: Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information

Course Administration

Course Administration /4/7 Spring 7 EE 363: Computer Orgniztion Arithmetic for Computers Numer Representtion & ALU Avinsh Kodi Deprtment of Electricl Engineering & Computer Science Ohio University, Athens, Ohio 457 E-mil: kodi@ohio.edu

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Compiler Construction D7011E

Compiler Construction D7011E Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information