A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
|
|
- Meghan Carroll
- 6 years ago
- Views:
Transcription
1 A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin Richrds 1 Tlk 13/Mr/98
2 Introduction Consider the propositionl expression: (( ) c) ( ( ) c) The corresponding tree is: nd imp or eqv c not c eqv Mrtin Richrds 2 Tlk 13/Mr/98
3 Lel Edges Invent vrile nmes for the unlelled edges: t6 t2 nd t5 t1 imp t4 or eqv c not c t3 eqv Mrtin Richrds 3 Tlk 13/Mr/98
4 Set Root to Zero Set the root vrile to zero (flse) nd see if this leds to n inconsistency. 0 t2 nd t5 t1 imp t4 or eqv c not c t3 eqv Mrtin Richrds 4 Tlk 13/Mr/98
5 Set of Terms The tree corresponds to the following set of terms. 0 t2 t1 nd imp eqv t2 t5 t1 c t5 t4 t3 or not eqv t4 c t3 Mrtin Richrds 5 Tlk 13/Mr/98
6 Inference Rules The terms re modified nd possily eliminted y the ppliction of inference rules which sometimes yield vrile mpping informtion. Mpping informtion Vrile mpping informtion is set of items of the form: or where x = 0 x = 1 x = y x = ȳ x nd y re vriles. Mrtin Richrds 6 Tlk 13/Mr/98
7 0 t2 t1 nd imp eqv t2 t5 t1 c t5 t4 t3 or not eqv t4 c t3 Mpping: t 4 = t 3 0 t2 t1 nd imp eqv t2 t5 t1 c t5 t3 imp eqv t3 c Mrtin Richrds 7 Tlk 13/Mr/98
8 0 t2 t1 nd imp eqv t2 t5 t1 c t5 t3 imp eqv t3 c Mpping: t 4 = t 3, t 3 = t 1 0 t2 t1 nd imp eqv t2 t5 t1 c t5 imp t1 c Mrtin Richrds 8 Tlk 13/Mr/98
9 0 t2 t1 nd imp eqv t2 t5 t1 c t5 imp t1 c Mpping: t 4 = t 3, t 3 = t 1, t 5 = t 2 0 t2 t1 nd imp eqv t2 t2 t1 c Mrtin Richrds 9 Tlk 13/Mr/98
10 0 t2 t1 nd imp eqv t2 t2 t1 c Mpping: t 4 = t 3, t 3 = t 1, t 5 = t 2, t 2 = 0 0 t1 imp eqv t1 c Mrtin Richrds 10 Tlk 13/Mr/98
11 0 t1 imp eqv t1 c Mpping: t 4 = t 3, t 3 = t 1, t 5 = t 2, t 2 = 0, t 1 = 1, c = 0 1 eqv Mrtin Richrds 11 Tlk 13/Mr/98
12 1 eqv Mpping: t 4 = t 3, t 3 = t 1, t 5 = t 2, t 2 = 0, t 1 = 1, c = 0, = There re now no terms left. An inconsistency hs not een found, so the originl expression ws not tutology. These direct derivtions cn e done in liner time. Mrtin Richrds 12 Tlk 13/Mr/98
13 Unfortuntely We cnnot, in generl, expect direct derivtions to solve the prolem, (since tutology checking hs exponentil cost). If we pply the technique to: (( ) ( ) ( ) we otin: nor gt lt 0 nd Mrtin Richrds 13 Tlk 13/Mr/98
14 We cn esily see tht nor gt lt 0 nd hs no solution since first term implies: = 01, 10, 11 second term implies: = 00, 01, 11 third term implies: = 00, 10, 11 fourth term implies: = 00, 01, 10 Mrtin Richrds 14 Tlk 13/Mr/98
15 The Dilemm Rule 1. Select vrile, v i, sy, tht hs not yet een ssigned vlue. 2. Set it to 0 nd 1 in turn nd pply the direct inferences until convergence, yielding vrile mppings M 0 nd M 1, respectively. 3. If oth settings led to inconsistencies then the terms cnnot e stisfied. 4. If just one setting leds to n inconsistency, return the other mpping. 5. If neither setting leds to n inconsistency, return the intesection of M 0 nd M 1, i.e. the set of mpping items tht occur in oth M 0 nd M Repet for ll other vriles. Mrtin Richrds 15 Tlk 13/Mr/98
16 7. Repet the process using pirs of vriles, v i v j, setting them to ll possile vlues (00, 01, 10 nd 11), tking the intersection of the four mppings produced. 8. Repet similrly with ll sets of 3, 4,... n vriles until either no terms remin or n inconsistency is found. When the lgorithm is considering k vriles, it is sid to e t recursion depth k. Hopefully, the prolem will e solved efore the recursion depth gets too lrge. The prolem will certinly e solved t recursion depth n, if not efore. Any strtegy to reduce the recursion depth is vlule. Mrtin Richrds 16 Tlk 13/Mr/98
17 Mpping Intersection Suppose M 0 ={v 1 = 0, v 2 = 1, v 2 = v 4, v 5 = v 6 } nd M 1 ={v 1 = 0, v 2 = 0, v 3 = v 5, v 5 = v 6 } then the intersection is {v 1 = 0, v 5 = v 6 } Mrtin Richrds 17 Tlk 13/Mr/98
18 Using Tridic Reltions The terms so fr considered represent the reltion etween the opernds nd result of dydic Boolen opertors. For exmple, x nd y z sys tht the only vlid settings of xyz re: 000, 001, 010 or 111 There re just 16 dydic Boolen opertors, ut there re 256 reltions over 3 Boolen vriles. We extend Ståmrck s Algorithm to use such reltions in the term set. Mrtin Richrds 18 Tlk 13/Mr/98
19 Eight Bit Representtion The reltion R(x, y, z) cn e represented using it pttern of length 8, s follows: x y z c d e f g h The its h = 1 000ɛR g = 1 001ɛR f = 1 010ɛR e = 1 011ɛR d = 1 100ɛR c = 1 101ɛR = 1 110ɛR = 1 111ɛR Mrtin Richrds 19 Tlk 13/Mr/98
20 Nottion We will use Rcdefgh to identify the reltion with it pttern cdefgh. The terms in the previous exmple: nor gt lt 0 nd cn e written s: R (0,, ) R (0,, ) R (0,, ) R (0,, ) Mrtin Richrds 20 Tlk 13/Mr/98
21 New Inferences Mny more inference rules re now ville. We cn, for instnce, comine R (0,, ) nd R (0,, ) to yield R (0,, ). Reltion Triplets R R R Mrtin Richrds 21 Tlk 13/Mr/98
22 Derivtion The terms in the previous exmple re: R (0,, ) R (0,, ) R (0,, ) R (0,, ) Comining terms 3 nd 4 gives: R (0,, ) R (0,, ) R (0,, ) Comining terms 2 nd 3 gives: R (0,, ) R (0,, ) Comining these two terms gives: R (0,, ) This is term tht cnnot e stisfied, so n inconsistency hs een found. Mrtin Richrds 22 Tlk 13/Mr/98
23 Oservtions Hving 256 reltions my seem to e disdvntge, ut there re compenstions. As we hve seen, the recursion depth my e reduced. Terms cn e put into cnonicl form to llow esy elimintion of equivlent terms. Mny more inferences re possile. Inferences cn e done y tle lookup or y simple it pttern opertions. Mrtin Richrds 23 Tlk 13/Mr/98
24 Cnoniclistion A term cn e put into cnonicl form y the following steps: 1. Replce R(x, y, z) y R (0, y, z), if the reltion does not depend on x. For exmple, replce R (x, y, z) y R (0, y, z), since the upper nd lower 4 its of R re equl. 2. Replce R(x, y, y) y the equivlent R (x, y, 0). For exmple, replce R (x, y, y) y R (x, y, 0), i.e. msk R with R Replce R(1, y, z) y the equivlent R (0, y, z). For exmple, replce R (1, y, z) y R (0, y, z), i.e. right shift y 4. Mrtin Richrds 24 Tlk 13/Mr/98
25 4. Replce R(0, y, z) y the equivlent R (0, y, z). For exmple, replce R (0, y, z) y R (0, y, z), i.e. msk R with R Do the ove trnsformtions for ll permuttions of (x, y, z). 6. Return R(x, y, z) with the vriles (x, y, z) in dictionry order. The resulting cnonicl term will hve one of the following forms: Rcdefgh(x, y, z) R0000cd(0, y, z) R000000(0, 0, z) R (0, 0, 0) Mrtin Richrds 25 Tlk 13/Mr/98
26 Deducing Mppings Given term Rcdefgh(x, y, z), we my e le to deduce new mpping informtion. For instnce, if cd = 0000 then x = 0. By similr mens, we cn deduce whether x = 1, x = y or x = ȳ. Term Deduction R0000efgh(x, y, z) x = 0 Rcd0000 (x, y, z) x = 1 R00de00h(x, y, z) R0c00fg0 (x, y, z)... There re 12 such mppings. x = y x = ȳ They cn e deduced y simple msking opertions or y tle lookup. Mrtin Richrds 26 Tlk 13/Mr/98
27 Pirwise Inferences As we hve lredy seen, if we hve two terms R(x, y, z) nd S(x, y, z) referring to the sme vriles, then they cn e replced y the single term (R S)(x, y, z). Mrtin Richrds 27 Tlk 13/Mr/98
28 Pirwise Inferences If we hve two terms R(, x, y) nd S(, x, y) with two vriles in common then we cn sometimes simplify R nd/or S, nd we cn sometimes deduce reltion etween nd. For exmple, T erm T riplets R (, x, y) R (, x, y) The first disllows the pttern xy = 11 nd the second disllows xy = 00, so, tken together we cn deduce: R (, x, y) R (, x, y) Mrtin Richrds 28 Tlk 13/Mr/98
29 Pirwise Inferences R (, x, y) R (, x, y) From these we cn deduce informtion out, nmely =, nd tken seprtely the terms llow us to deduce new informtion out xy, (nmely: = x = ȳ), nd xy (nmely: = x = ȳ). All these deductions cn e mde esily y mens of itwise opertions on the reltion it ptterns. Another inference rule pplies to pir of terms of the form R(x, 0, z) nd S(0, y, z), replcing them y T (x, y, z). Agin, the it pttern representtion of T is esily clculted from R nd S. Mrtin Richrds 29 Tlk 13/Mr/98
30 Using Lrger Reltions We hve seen how the mechnism works with reltions over three Boolen vriles. Wht out reltions over 4, 5,... n vriles? The length of the reltion it pttern is 2 n nd the numer of vrile mpping items is n(n + 1). When n = 4, 16-its re required to represent the reltion nd there re 20 mpping items. When n = 8, the reltion tkes eight 32-it word to represent, which is typiclly equl to the spce require to represent the eight vriles. Such term cn thus e represented in it words. A term over 6 vriles would require 8 words. n = 8 is proly good compromise. Mrtin Richrds 30 Tlk 13/Mr/98
31 Nottion We will use Rn to denote the set of terms contining generl reltions over n vriles. A typicl element of Rn is R(v 1,... v n ). BinOp is the suset of R3 in which ll terms re restricted to reltions corresponding to the 16 dydic Boolen opertors. Ståmrck s vrile mpping cn e thought of s the suset (EqNe) of R2, restricted to 12 of the 16 possile reltions over 2 Boolens. The four tht re omitted involve impliction, possily comined with negtion. We will cll this suset of R2: Imp. Mrtin Richrds 31 Tlk 13/Mr/98
32 R2 Reltions Reltion xy Pirs Condition R0000 F lse R x = 0 y = 0 R x = 0 y = 1 R x = 0 R x = 1 y = 0 R y = 0 R x = ȳ R x ȳ R x = 1 y = 1 R x = y R y = 1 R x y R x = 1 R x ȳ R x y R T rue Mrtin Richrds 32 Tlk 13/Mr/98
33 R2 If circulr chin of implictions cn e found in R2 then either ll the vrile in the chin re equl or n inconsistency is present. For exmple: x y, ȳ z, z x = x = y = z x y, ȳ z, z x = Inconsistent Such deductions should e mde s soon s they re detectle. Elements of EqN e correspond to renming, nd cn e removed s soon s the renming is done. We re thus left with n R2 structure contining only terms from Imp tht contin no cycles nd we need n efficient lgorithm to detect cycles when new items re dded (to either Imp or EqNe). It is well known tht R2 cn e solved in liner time. Mrtin Richrds 33 Tlk 13/Mr/98
34 PERM R(v 1, v 2,..., v n ) = R (v i, v j,..., v k ) where i, j,...k is permuttion of 1, 2,..., n Exmple R (x, y, z) = R (x, z, y) Mrtin Richrds 34 Tlk 13/Mr/98
35 UNDUP R(v 1, v 1, v 3,..., v n ) = R (v 1, 0, v 3,..., v n ) Exmple R (x, x, y) = R (x, 0, y) By comining PERM nd UNDUP, ll repeted vriles in term cn e removed. Mrtin Richrds 35 Tlk 13/Mr/98
36 ELIMVAR R(v 1, v 2,..., v n ) = R (0, v 2,..., v n ) if v 1 is not used in ny other term Exmple R (x, y, z) = R (0, y, z) Mrtin Richrds 36 Tlk 13/Mr/98
37 INDEP R(v 1, v 2,..., v n ) = R (0, v 2,..., v n ) if the truth of this term does not depend on the vlue of v 1 Exmple R (x, y, z) = R (0, y, z) Mrtin Richrds 37 Tlk 13/Mr/98
38 ONE R(1, v 2,..., v n ) = R (0, v 2,..., v n ) Exmple R (1, y, z) = R (0, y, z) Mrtin Richrds 38 Tlk 13/Mr/98
39 ZERO R(0, v 2,..., v n ) = R (0, v 2,..., v n ) Exmple R (x, y, z) = R (0, y, z) Mrtin Richrds 39 Tlk 13/Mr/98
40 UNIT R(v 1, v 2,..., v n ) = S(v i, v j ) Exmple R (x, y, z) = R1011(x, y) Mrtin Richrds 40 Tlk 13/Mr/98
41 PAIR2 s(, ) R(v 1, v 2,..., v n ) = R (v 1, v 2,..., v n ) Exmple R1011(x, y) R (x, y, z) = R (x, y, z) Mrtin Richrds 41 Tlk 13/Mr/98
42 PAIRGEN R(v 1, v 2,..., v n ) S(w 1, w 2,..., w n ) = T (v i, w j ) Exmple R (, y, z) R (, y, z) = R1011(, ) Mrtin Richrds 42 Tlk 13/Mr/98
43 PAIRSIMP R(v 1, v 2,..., v n ) S(w 1, w 2,..., w n ) = R (v 1, v 2,..., v n ) S (w 1, w 2,..., w n ) Exmple R (, y, z) R (, y, z) = R (, y, z) R (, y, z) Mrtin Richrds 43 Tlk 13/Mr/98
44 PAIRCOMB R(v 1, 0,..., v n ) S(0, v 2,..., v n ) = T (v 1, v 2,..., v n ) Exmple R (, 0, y, z) R (0,, y, z) = R (,, y, z) Mrtin Richrds 44 Tlk 13/Mr/98
45 FACTOR R(v 1,..., v i, v i+1,..., v n ) = S(0,..., 0, v 0,..., v i ) T (0,..., 0, v i+1,..., v n ) if the given reltion cn e prtitioned into two reltions over independent sets of vriles. This is only useful when n > 5. It increses the pplicility of PAIRCOMB. Mrtin Richrds 45 Tlk 13/Mr/98
46 Finl Remrks This pproch reduces the numer of terms, the numer of vriles, nd the depth nd fnout of the recursion. This pproch increses the numer of inference rules nd simplifies their ppliction. Multi-vrite reltions llow the representtion of higher level properties of circuit. Another form of dilemm rule is possile. Pick rndom reltion over n vriles R (x, y, z), sy, nd its complement R (x, y, z), nd use these s the lterntives in the dilemm rule. This is more useful when n > 3. Mrtin Richrds 46 Tlk 13/Mr/98
47 Lst Thought If multi-vrite reltions re good ide, it might e worth using reltions over 16 or perhps 32 vriles, representing the reltions y OBDDs insted of it ptterns. Mrtin Richrds 47 Tlk 13/Mr/98
48 Anlogy Mrtin Richrds 48 Tlk 13/Mr/98
COMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationbox Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:
Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References
More informationMisrepresentation of Preferences
Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationUNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES
UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationInference of node replacement graph grammars
Glley Proof 22/6/27; :6 File: id293.tex; BOKCTP/Hin p. Intelligent Dt Anlysis (27) 24 IOS Press Inference of node replcement grph grmmrs Jcek P. Kukluk, Lwrence B. Holder nd Dine J. Cook Deprtment of Computer
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationSome necessary and sufficient conditions for two variable orthogonal designs in order 44
University of Wollongong Reserch Online Fculty of Informtics - Ppers (Archive) Fculty of Engineering n Informtion Sciences 1998 Some necessry n sufficient conitions for two vrile orthogonl esigns in orer
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationNotes for Graph Theory
Notes for Grph Theory These re notes I wrote up for my grph theory clss in 06. They contin most of the topics typiclly found in grph theory course. There re proofs of lot of the results, ut not of everything.
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationSummer Review Packet For Algebra 2 CP/Honors
Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationPPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationL2-Python-Data-Structures
L2-Python-Dt-Structures Mrch 19, 2018 1 Principl built-in types in Python (Python ) numerics: int, flot, long, complex sequences: str, unicode, list, tuple, byterry, buffer, xrnge mppings: dict files:
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationLily Yen and Mogens Hansen
SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationFall 2018 Midterm 2 November 15, 2018
Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More information