CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

Size: px
Start display at page:

Download "CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig"

Transcription

1 CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of grph splits the plne into regions (sometimes lso clled fces): The complete grph K 5 is not plnr: R4 (outer region) c R1 R3 R2 d Why cn K 5 not e drwn without ny edges crossing? Every plnr grph hs n outer region, which is unounded. Degree of region R, written deg(r), is the numer of edges djcent to R Wht is degree of R1, R2, R3, R4? Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 3/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 4/25 Euler s Formul Euler s Formul: Let G = (V, E) e plnr connected grph with regions R. Then, the following formul lwys holds: R = E V + 2 A X W B C Y Z All plnr representtions of grph split the plne into the sme numer of regions! Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 6/25 1

2 Proof of Euler s Formul Cse 2: G hs t lest one cycle. Cse 1: G does not hve cycles (i.e., tree) If G hs V nodes, how mny edges does it hve? The proof is y induction on the numer of edges. Bse cse: G hs 3 edges (i.e., tringle) How mny regions does it hve? R = 1 = ( V 1) V + 2 Induction: Suppose Euler s formul holds for plnr connected grphs with e edges nd t lest one cycle. We need to show it lso holds for plnr connected grphs with e + 1 edges nd t lest one cycle. Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 7/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 8/25 An Appliction of Euler s Formul Crete G y removing one edge from the cycle hs e edges If G doesn t hve cycles, we know R = e V + 2 (cse 1) If G hs cycles, we know from IH tht R = e V + 2 Now, dd edge ck in; G hs e + 1 edges nd V vertices How mny regions does G hve? R + 1 Suppose connected plnr simple grph G hs 6 vertices, ech with degree 4. How mny regions does plnr representtion of G hve? How mny edges? How mny regions? e + 1 V + 2 = R + 1 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 9/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 10/25 Seven Bridges of Königserg Euler Circuits nd Euler Pths Given grph G, n Euler circuit is simple circuit contining every edge of G. Town of Königserg in Germny divided into four prts y the Pregel river nd hd seven ridges Euler pth is simple pth contining every edge of G. Townspeople wondered if one cn strt t point A, cross ll ridges exctly once, nd come ck to A Mthemticin Euler herd out this puzzle nd solved it Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 11/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 12/25 2

3 Theorem out Euler Circuits Theorem: A connected multigrph G with t lest two vertices contins n Euler circuit if nd only if ech vertex hs even degree. Let s first prove the only if prt. Euler circuit must enter nd leve ech vertex the sme numer of times. But we cn t use ny edge twice Hence, ech vertex must hve even numer of djcent edges. Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 14/25 Proof of Sufficiency Now, prove the if prt much more difficult! By strong induction on the numer of edges e Bse cse: e = 2 Induction: Suppose clim holds for every grph with e edges; show it holds for grph with e + 1 edges Consider grph G with e + 1 edges nd where every vertex hs even degree This mens G must contin cycle, sy C Now, remove ll edges in C from G to otin grph G G my not e connected, suppose it consists of connected components G 1,..., G n Ech vertex in cycle hs exctly two djcent edges tht re prt of the cycle Hence, if ll nodes in G hve even degree, then nodes in ech G i must lso hve even degree Oserve: G cnnot e tree why? Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 15/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 16/25 Now, ech G i is connected nd every vertex hs even degree By IH, ech G i hs n Euler circuit, sy C i We cn now lso uild n Euler circuit for G using these C i s Strt t some vertex v in C, trverse long C until we rech vertex v i in connected component G i Now, trverse C i nd come ck to v i Continue until we re ck t v i This is n Euler circuit ecuse we ve trversed every edge nd hven t repeted ny edges Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 17/25 3

4 Necessry nd Sufficient Conditions for Euler Pths Theorem: A connected multigrph G contins n Euler pth iff there re exctly 0 or 2 vertices of odd degree. Let s first prove necessity: Suppose G hs Euler pth P with strt nd end-points u nd v Cse 1: u, v re the sme then P is n Euler circuit, hence it must hve 0 vertices of degree Cse 2: u, v re distinct Except for u, v, we must enter nd leve ech vertex sme numer of times these must hve even degree Proof of Sufficiency Suppose G hs exctly 0 or 2 vertices with odd degree Cse 1: If no vertices with odd degree, must hve Euler circuit Cse 2: It hs exctly two vertices, sy u, v, with odd degree Now, dd n edge etween u, v to generte grph G All vertices in G hve even degree so G hs Euler circuit This mens G hs Euler pth with strt nd end-points u, v We must leve u one more time thn we enter it, nd we enter v one more time thn we leve it, so they hve odd degree Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 19/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 20/25 Exmple Does this grph hve Euler pth? Hmilton Pths nd Circuits A Hmilton circuit in grph G is simple circuit tht visits every vertex in G exctly once (except the strt node). Grph with n Euler pth: Note tht ll Hmilton circuits re cycles! A Hmilton pth in grph G is simple pth tht visits every vertex in G exctly once. Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 21/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 22/25 Are All Euler Circuits Also Hmilton Circuits? Not every Euler circuit is Hmilton circuit: Hmilton vs Euler Circuits Not every Hmilton circuit is n Euler circuit: c d e Does this grph hve Hmilton pth? Find grph tht hs n Euler circuit, ut no Hmilton circuit Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 23/25 Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 24/25 4

5 Necessry nd Sufficient Criteri for Hmilton Circuits Unlike Euler circuits, no necessry nd sufficient criteri for identifying Hmilton circuits or pths Exercise: Prove tht grph with vertex of degree 1 cnnot hve Hmilton circuit. Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 25/25 5

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997.

F. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997. Forced convex n-gons in the plne F. R. K. Chung y University ofpennsylvni Phildelphi, Pennsylvni 19104 R. L. Grhm AT&T Ls - Reserch Murry Hill, New Jersey 07974 Mrch 2,1997 Astrct In seminl pper from 1935,

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E

4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E 4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Notes for Graph Theory

Notes for Graph Theory Notes for Grph Theory These re notes I wrote up for my grph theory clss in 06. They contin most of the topics typiclly found in grph theory course. There re proofs of lot of the results, ut not of everything.

More information

The Fundamental Theorem of Calculus

The Fundamental Theorem of Calculus MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Graph Theory and DNA Nanostructures. Laura Beaudin, Jo Ellis-Monaghan*, Natasha Jonoska, David Miller, and Greta Pangborn

Graph Theory and DNA Nanostructures. Laura Beaudin, Jo Ellis-Monaghan*, Natasha Jonoska, David Miller, and Greta Pangborn Grph Theory nd DNA Nnostructures Lur Beudin, Jo Ellis-Monghn*, Ntsh Jonosk, Dvid Miller, nd Gret Pngborn A grph is set of vertices (dots) with edges (lines) connecting them. 1 2 4 6 5 3 A grph F A B C

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

APPLICATIONS OF INTEGRATION

APPLICATIONS OF INTEGRATION Chpter 3 DACS 1 Lok 004/05 CHAPTER 5 APPLICATIONS OF INTEGRATION 5.1 Geometricl Interprettion-Definite Integrl (pge 36) 5. Are of Region (pge 369) 5..1 Are of Region Under Grph (pge 369) Figure 5.7 shows

More information

Math 142, Exam 1 Information.

Math 142, Exam 1 Information. Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At

More information

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a

B. Definition: The volume of a solid of known integrable cross-section area A(x) from x = a Mth 176 Clculus Sec. 6.: Volume I. Volume By Slicing A. Introduction We will e trying to find the volume of solid shped using the sum of cross section res times width. We will e driving towrd developing

More information

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012 Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

arxiv: v1 [math.co] 18 Sep 2015

arxiv: v1 [math.co] 18 Sep 2015 Improvements on the density o miml -plnr grphs rxiv:509.05548v [mth.co] 8 Sep 05 János Brát MTA-ELTE Geometric nd Algeric Comintorics Reserch Group rt@cs.elte.hu nd Géz Tóth Alréd Rényi Institute o Mthemtics,

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

arxiv:cs.cg/ v1 18 Oct 2005

arxiv:cs.cg/ v1 18 Oct 2005 A Pir of Trees without Simultneous Geometric Embedding in the Plne rxiv:cs.cg/0510053 v1 18 Oct 2005 Mrtin Kutz Mx-Plnck-Institut für Informtik, Srbrücken, Germny mkutz@mpi-inf.mpg.de October 19, 2005

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

3 4. Answers may vary. Sample: Reteaching Vertical s are.

3 4. Answers may vary. Sample: Reteaching Vertical s are. Chpter 7 Answers Alterntive Activities 7-2 1 2. Check students work. 3. The imge hs length tht is 2 3 tht of the originl segment nd is prllel to the originl segment. 4. The segments pss through the endpoints

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

The Complexity of Nonrepetitive Coloring

The Complexity of Nonrepetitive Coloring The Complexity of Nonrepetitive Coloring Dániel Mrx Institut für Informtik Humoldt-Universitt zu Berlin dmrx@informtik.hu-erlin.de Mrcus Schefer Deprtment of Computer Science DePul University mschefer@cs.depul.edu

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to djcent tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. me the djcent cute ngles in this digrm rm is shred y + + me vertex point for + + + is djcent to + djcent simply mens

More information

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts

Class-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids Chpter44 Polygons nd solids Contents: A Polygons B Tringles C Qudrilterls D Solids E Constructing solids 74 POLYGONS AND SOLIDS (Chpter 4) Opening prolem Things to think out: c Wht different shpes cn you

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

9.1 PYTHAGOREAN THEOREM (right triangles)

9.1 PYTHAGOREAN THEOREM (right triangles) Simplifying Rdicls: ) 1 b) 60 c) 11 d) 3 e) 7 Solve: ) x 4 9 b) 16 80 c) 9 16 9.1 PYTHAGOREAN THEOREM (right tringles) c If tringle is right tringle then b, b re the legs * c is clled the hypotenuse (side

More information

Solutions to Math 41 Final Exam December 12, 2011

Solutions to Math 41 Final Exam December 12, 2011 Solutions to Mth Finl Em December,. ( points) Find ech of the following its, with justifiction. If there is n infinite it, then eplin whether it is or. ( ) / ln() () (5 points) First we compute the it:

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Lost in Translation: A Reflection on the Ballot Problem and André's Original Method

Lost in Translation: A Reflection on the Ballot Problem and André's Original Method Lost in Trnsltion: A Reflection on the Bllot Prolem nd André's Originl Method Mrc Renult Shippensurg University Presented t MthFest August 5, 2007 The Bllot Prolem (1887) In how mny wys cn upsteps nd downsteps

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

arxiv:math/ v2 [math.co] 28 Feb 2006

arxiv:math/ v2 [math.co] 28 Feb 2006 Chord Digrms nd Guss Codes for Grphs rxiv:mth/0508269v2 [mth.co] 28 Feb 2006 Thoms Fleming Deprtment of Mthemtics University of Cliforni, Sn Diego L Joll, C 92093-0112 tfleming@mth.ucsd.edu bstrct lke

More information

Angle Properties in Polygons. Part 1 Interior Angles

Angle Properties in Polygons. Part 1 Interior Angles 2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

Notes slides from before lecture. CSE 21, Winter 2017, Section A00. Lecture 9 Notes. Class URL:

Notes slides from before lecture. CSE 21, Winter 2017, Section A00. Lecture 9 Notes. Class URL: Notes slides from before lecture CSE 21, Winter 2017, Section A00 Lecture 9 Notes Class URL: http://vlsicad.ucsd.edu/courses/cse21-w17/ Notes slides from before lecture Notes February 8 (1) HW4 is due

More information

arxiv: v1 [cs.cg] 9 Dec 2016

arxiv: v1 [cs.cg] 9 Dec 2016 Some Counterexmples for Comptible Tringultions rxiv:62.0486v [cs.cg] 9 Dec 206 Cody Brnson Dwn Chndler 2 Qio Chen 3 Christin Chung 4 Andrew Coccimiglio 5 Sen L 6 Lily Li 7 Aïn Linn 8 Ann Lubiw 9 Clre Lyle

More information

ON THE DEHN COMPLEX OF VIRTUAL LINKS

ON THE DEHN COMPLEX OF VIRTUAL LINKS ON THE DEHN COMPLEX OF VIRTUAL LINKS RACHEL BYRD, JENS HARLANDER Astrct. A virtul link comes with vriety of link complements. This rticle is concerned with the Dehn spce, pseudo mnifold with oundry, nd

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Pythagoras theorem and trigonometry (2)

Pythagoras theorem and trigonometry (2) HPTR 10 Pythgors theorem nd trigonometry (2) 31 HPTR Liner equtions In hpter 19, Pythgors theorem nd trigonometry were used to find the lengths of sides nd the sizes of ngles in right-ngled tringles. These

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information