Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Size: px
Start display at page:

Download "Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation"

Transcription

1 Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3 words) Free word Allocted word Now: Explicit lloctors (.k.. mnul memory mngement) Lter: implicit lloctors (.k.. utomtic memory mngement) pointer to newly llocted block of t lest tht size void* mlloc(size_t size); void free(void* ptr); number of contiguous bytes required pointer to llocted block to free 3 Alloctor Gols: mlloc/free 1. Progrmmer does not decide loctions of distinct objects. Progrmmer decides: wht size, when needed, when no longer needed Internl Frgmenttion pylod smller thn block block 2. Fst lloction. mllocs/second or bytes mlloc'd/second pylod 3. High memory utiliztion. Most of hep contins necessry progrm dt. Little wsted spce. Enemy: frgmenttion unused memory tht cnnot be llocted. Cuses metdt lignment policy decisions Internl frgmenttion 6

2 Externl Frgmenttion (64-bit words) Totl free spce lrge enough, but no contiguous free block lrge enough p1 = mlloc(32); p2 = mlloc(40); p3 = mlloc(48); free(p2); p4 = mlloc(48); Implementtion Issues 1. Determine how much to free given just pointer. 2. Keep trck of free blocks. 3. Pick block to llocte. 4. Choose wht do with extr spce when llocting structure tht is smller thn the free block used. 5. Mke freed block vilble for future reuse. Depends on the pttern of future requests. 7 8 Knowing How Much to Free Keep length of block in heder word preceding block Tkes extr spce! Keeping Trck of Free Blocks Method 1: Implicit list of ll blocks using length p0 = mlloc(32); free(p0); 48 p0 metdt dt pylod Method 2: Explicit list of free blocks using pointers Method 3: Seglist Different free lists for different size blocks More methods tht we will skip 9 10

3 Implicit Free List: Block Formt Implicit Free List: Hep Lyout Block metdt: 1. Block size 2. Alloction sttus Store in one heder word. 1 word pylod (ppliction dt, when llocted) Stel LSB for sttus flg. LSB = 1: llocted LSB = 0: free Strt of hep Block Heder (metdt) block llocted? Specil end-hep word Looks like heder of zero-size llocte block optionl pdding -byte ligned sizes hve 4 zeroes in low-order bits Initil word cn't be prt of block. My force internl frgmenttion. Pylods strt t -byte (2-word) lignment. Blocks sizes re multiples of bytes. Free word Allocted word Allocted word wsted Implicit Free List: Finding Free Block First fit: Serch list from beginning, choose first free block tht fits Implicit Free List: Allocting Free Block 48 Next fit: Do first-fit strting where previous serch finished p = mlloc(24); Allocted spce free spce. Use it ll? Split it up? Best fit: Serch the list, choose the best free block: fits, with fewest bytes left over 32 p Block Splitting 13 Now showing lloction sttus flg implicitly with shding. 14

4 Implicit Free List: Freeing Block Colescing Free Blocks 32 p free(p) p Colesce with following free block. free(p); Cler llocted flg logiclly gone mlloc(40); Externl frgmenttion! Enough spce, not one block. 15 Colesce with preceding free block? Bidirectionl Colescing: Boundry Tgs [Knuth73] Constnt-Time Colescing: 4 cses Heder Boundry tg (footer) pylod (ppliction dt, when llocted) optionl pdding n 0 n 0 n+ n+ n+ n+m n+ 17 n+m1+ 19

5 Summry: Implicit Free Lists Implementtion: Allocte: Free: simple O(blocks in hep) O(1) Memory utiliztion: depends on plcement policy Not widely used in prctice some specil purpose pplictions Explicit Free Lists Allocted block: pylod (ppliction dt, when llocted) (sme s implicit free list) optionl pdding Free block: next pointer prev pointer Explicit list of free blocks rther thn implicit list of ll blocks. Splitting, boundry tgs, colescing re generl to ll lloctors Explicit Free Lists: List vs. Memory Order Explicit Free Lists: Allocting Free Block Abstrctly: doubly-linked lists Next A B C Previous Before Concretely: free list blocks in ny memory order After (with splitting) A Next C B Previous List Order Memory Order 22 = mlloc( ) 23

6 Explicit Free Lists: Freeing Block Insertion policy: Where in the free list do you dd freed block? LIFO (lst-in-first-out) policy Pro: simple nd constnt time Con: studies suggest frgmenttion is worse thn ddress ordered Freeing with LIFO Policy: between free blocks Before Hed free( ) Address-ordered policy Con: liner-time serch to insert freed blocks Pro: studies suggest frgmenttion is lower thn LIFO Splice out predecessor nd successor blocks, colesce ll 3 memory blocks nd insert the new block t the hed of the list. After LIFO Exmple: 4 cses of freed block neighbor sttus. Hed Summry: Explicit Free Lists Summry: Alloctor Policies Implementtion: firly simple All policies offer trde-offs in frgmenttion nd throughput. Allocte: O(free blocks) vs. O(ll blocks) Free: O(1) vs. O(1) Memory utiliztion: depends on plcement policy lrger minimum (next/prev) vs. implicit list Used widely in prctice, often with more optimiztions. Plcement policy: First-fit, next-fit, best-fit, etc. Seglists pproximte best-fit in low time Splitting policy: Alwys? Sometimes? Size bound? Colescing policy: Immedite vs. deferred Splitting, boundry tgs, colescing re generl to ll lloctors

Outlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example

Outlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example Outlines Dynmic Memory Alloc@on CSCI 01: Mchine Architecture nd Orgniz@on Bsic concepts Implicit free lists Explicit free lists Pen- Chung Yew Deprtment Computer Science nd Engineering University of Minnesot

More information

Page. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example

Page. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example Hrsh Relity Memory Mtters Memory is not unbounded It must be llocted nd mnged 1 Mny lictions re memory dominted Esecilly those bsed on comlex, grh lgorithms Memory referencing bugs esecilly ernicious Effects

More information

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S

More information

Keeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists

Keeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists Dynmic Memory Alloction II Nov 7, 2002 clss22.ppt 15-213 The course tht gives CMU its Zip! Topics Explicit doubly-linked ree lists Segregted ree lists Grbge collection Memory-relted perils nd pitlls Keeping

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

MIPS I/O and Interrupt

MIPS I/O and Interrupt MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,

More information

Real-Time Programming in Java

Real-Time Programming in Java ARTIST2 Summer School 2008 in Europe Autrns (ner Grenole), Frnce Septemer 8-12, 8 2008 Rel-Time Progrmming in Jv Rel-Time in the Age of Complex Systems Invited Speker: Dvid F. Bcon IBM Reserch 0 Clssicl

More information

Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations

Outline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Coprocessor memory definition. Loic Pallardy / Arnaud Pouliquen

Coprocessor memory definition. Loic Pallardy / Arnaud Pouliquen Coprocessor memory definition Loic Pllrdy / Arnud Pouliquen Objective 2 The gol of following slides is to sum up on-going discussion in OpenAP weekly bout Remoteproc/Rpmsg memory lloction. Following proposl

More information

Enginner To Engineer Note

Enginner To Engineer Note Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181

More information

520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection

520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection Dynmic Memory Mngement 50 Principles of Progrmming Lnguges 35: Grbge Collection Christin Collberg collberg@cs.rizon.edu Deprtment of Computer Science University of Arizon The run-time system linked in

More information

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers

Outline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Dynamic Memory Allocation

Dynamic Memory Allocation 1 Dynamic Memory Allocation Anne Bracy CS 3410 Computer Science Cornell University Note: these slides derive from those by Markus Püschel at CMU 2 Recommended Approach while (TRUE) { code a little; test

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

05-247r2 SAT: Add 16-byte CDBs and PIO modes 1 September 2005

05-247r2 SAT: Add 16-byte CDBs and PIO modes 1 September 2005 To: T10 Technicl Committee From: Robert Sheffield, Intel (robert.l.sheffield@intel.com) Dte: 1 September 2005 Subject: 05-247r2 SAT: Add 16-byte CDBs nd PIO modes Revision history Revision 0 (16 June 2005)

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Memory Allocation II. CSE 351 Autumn Instructor: Justin Hsia

Memory Allocation II. CSE 351 Autumn Instructor: Justin Hsia Memory Allocation II CSE 351 Autumn 2017 Instructor: Justin Hsia Teaching Assistants: Lucas Wotton Michael Zhang Parker DeWilde Ryan Wong Sam Gehman Sam Wolfson Savanna Yee Vinny Palaniappan http://xkcd.com/1909/

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

pdfapilot Server 2 Manual

pdfapilot Server 2 Manual pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:

More information

Looking up objects in Pastry

Looking up objects in Pastry Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech

More information

Dynamic Memory Allocation

Dynamic Memory Allocation Dynamic Memory Allocation CS61, Lecture 10 Prof. Stephen Chong October 4, 2011 Announcements 1/2 Assignment 4: Malloc Will be released today May work in groups of one or two Please go to website and enter

More information

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.

Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved. Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized

More information

2-3 search trees red-black BSTs B-trees

2-3 search trees red-black BSTs B-trees 2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions

More information

Caches I. CSE 351 Autumn Instructor: Justin Hsia

Caches I. CSE 351 Autumn Instructor: Justin Hsia L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes

More information

EasyMP Network Projection Operation Guide

EasyMP Network Projection Operation Guide EsyMP Network Projection Opertion Guide Contents 2 Introduction to EsyMP Network Projection EsyMP Network Projection Fetures... 5 Disply Options... 6 Multi-Screen Disply Function... 6 Movie Sending Mode...

More information

Caches I. CSE 351 Spring Instructor: Ruth Anderson

Caches I. CSE 351 Spring Instructor: Ruth Anderson L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Caches I. CSE 351 Autumn 2018

Caches I. CSE 351 Autumn 2018 Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Memory Allocation II. CSE 351 Autumn Instructor: Justin Hsia

Memory Allocation II. CSE 351 Autumn Instructor: Justin Hsia Memory Allocation II CSE 351 Autumn 2016 Instructor: Justin Hsia Teaching Assistants: Chris Ma Hunter Zahn John Kaltenbach Kevin Bi Sachin Mehta Suraj Bhat Thomas Neuman Waylon Huang Xi Liu Yufang Sun

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

McAfee Network Security Platform

McAfee Network Security Platform Mnger Applince Quick Strt Guide Revision B McAfee Network Security Pltform This guide is high-level description of how to instll nd configure the Mnger Applince. For more detiled instlltion informtion,

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-188 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

a Technical Notes on using Analog Devices' DSP components and development tools

a Technical Notes on using Analog Devices' DSP components and development tools Engineer To Engineer Note EE-146 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Creating Flexible Interfaces. Friday, 24 April 2015

Creating Flexible Interfaces. Friday, 24 April 2015 Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Computer Arithmetic Logical, Integer Addition & Subtraction Chapter

Computer Arithmetic Logical, Integer Addition & Subtraction Chapter Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Epson Projector Content Manager Operation Guide

Epson Projector Content Manager Operation Guide Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

A Progressive Register Allocator for Irregular Architectures

A Progressive Register Allocator for Irregular Architectures A Progressive Register Alloctor for Irulr Architectures Dvid Koes nd Seth Copen Goldstein Computer Science Deprtment Crnegie Mellon University {dkoes,seth}@cs.cmu.edu Abstrct Register lloction is one of

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

TCP/ICN: Carrying TCP over Content Centric and Named Data Networks

TCP/ICN: Carrying TCP over Content Centric and Named Data Networks TCP/ICN: Crrying TCP over Content Centric nd Nmed Dt Networks Ily Moiseenko Cisco Systems Dve Orn Cisco Systems Outline I. Introduction II. Design Bsic fetching proxy Relible prefetching proxy Unrelible

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.

More information

Engineer-to-Engineer Note

Engineer-to-Engineer Note Engineer-to-Engineer Note EE-295 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil

More information

Registering as a HPE Reseller. Quick Reference Guide for new Partners in Asia Pacific

Registering as a HPE Reseller. Quick Reference Guide for new Partners in Asia Pacific Registering s HPE Reseller Quick Reference Guide for new Prtners in Asi Pcific Registering s new Reseller prtner There re five min steps to e new Reseller prtner. Crete your Appliction Copyright 2017 Hewlett

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Engineer-to-Engineer Note

Engineer-to-Engineer Note Engineer-to-Engineer Note EE-069 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

vcloud Director Service Provider Admin Portal Guide vcloud Director 9.1

vcloud Director Service Provider Admin Portal Guide vcloud Director 9.1 vcloud Director Service Provider Admin Portl Guide vcloud Director 9. vcloud Director Service Provider Admin Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/

More information

Address/Data Control. Port latch. Multiplexer

Address/Data Control. Port latch. Multiplexer 4.1 I/O PORT OPERATION As discussed in chpter 1, ll four ports of the 8051 re bi-directionl. Ech port consists of ltch (Specil Function Registers P0, P1, P2, nd P3), n output driver, nd n input buffer.

More information

vcloud Director Tenant Portal Guide vcloud Director 9.0

vcloud Director Tenant Portal Guide vcloud Director 9.0 vcloud Director Tennt Portl Guide vcloud Director 9.0 vcloud Director Tennt Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre We site t: https://docs.vmwre.com/ The VMwre We

More information

Dynamic Memory Allocation. Gerson Robboy Portland State University. class20.ppt

Dynamic Memory Allocation. Gerson Robboy Portland State University. class20.ppt Dynamic Memory Allocation Gerson Robboy Portland State University class20.ppt Harsh Reality Memory is not unbounded It must be allocated and managed Many applications are memory dominated Especially those

More information

EasyMP Multi PC Projection Operation Guide

EasyMP Multi PC Projection Operation Guide EsyMP Multi PC Projection Opertion Guide Contents 2 Introduction to EsyMP Multi PC Projection 5 EsyMP Multi PC Projection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters

More information

vcloud Director Tenant Portal Guide vcloud Director 9.1

vcloud Director Tenant Portal Guide vcloud Director 9.1 vcloud Director Tennt Portl Guide vcloud Director 9.1 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments bout this documenttion, submit

More information

Knowledge States: A Tool in Randomized Online Algorithms

Knowledge States: A Tool in Randomized Online Algorithms : A Tool in Rndomized Online Algorithms Center for the Advnced Study of Algorithms School of Computer Science University of Nevd, Ls Vegs ADS 2007 couthors: Lwrence L. Lrmore, John Nog, Rüdiger Reischuk

More information