Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
|
|
- Margaret Manning
- 5 years ago
- Views:
Transcription
1 Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3 words) Free word Allocted word Now: Explicit lloctors (.k.. mnul memory mngement) Lter: implicit lloctors (.k.. utomtic memory mngement) pointer to newly llocted block of t lest tht size void* mlloc(size_t size); void free(void* ptr); number of contiguous bytes required pointer to llocted block to free 3 Alloctor Gols: mlloc/free 1. Progrmmer does not decide loctions of distinct objects. Progrmmer decides: wht size, when needed, when no longer needed Internl Frgmenttion pylod smller thn block block 2. Fst lloction. mllocs/second or bytes mlloc'd/second pylod 3. High memory utiliztion. Most of hep contins necessry progrm dt. Little wsted spce. Enemy: frgmenttion unused memory tht cnnot be llocted. Cuses metdt lignment policy decisions Internl frgmenttion 6
2 Externl Frgmenttion (64-bit words) Totl free spce lrge enough, but no contiguous free block lrge enough p1 = mlloc(32); p2 = mlloc(40); p3 = mlloc(48); free(p2); p4 = mlloc(48); Implementtion Issues 1. Determine how much to free given just pointer. 2. Keep trck of free blocks. 3. Pick block to llocte. 4. Choose wht do with extr spce when llocting structure tht is smller thn the free block used. 5. Mke freed block vilble for future reuse. Depends on the pttern of future requests. 7 8 Knowing How Much to Free Keep length of block in heder word preceding block Tkes extr spce! Keeping Trck of Free Blocks Method 1: Implicit list of ll blocks using length p0 = mlloc(32); free(p0); 48 p0 metdt dt pylod Method 2: Explicit list of free blocks using pointers Method 3: Seglist Different free lists for different size blocks More methods tht we will skip 9 10
3 Implicit Free List: Block Formt Implicit Free List: Hep Lyout Block metdt: 1. Block size 2. Alloction sttus Store in one heder word. 1 word pylod (ppliction dt, when llocted) Stel LSB for sttus flg. LSB = 1: llocted LSB = 0: free Strt of hep Block Heder (metdt) block llocted? Specil end-hep word Looks like heder of zero-size llocte block optionl pdding -byte ligned sizes hve 4 zeroes in low-order bits Initil word cn't be prt of block. My force internl frgmenttion. Pylods strt t -byte (2-word) lignment. Blocks sizes re multiples of bytes. Free word Allocted word Allocted word wsted Implicit Free List: Finding Free Block First fit: Serch list from beginning, choose first free block tht fits Implicit Free List: Allocting Free Block 48 Next fit: Do first-fit strting where previous serch finished p = mlloc(24); Allocted spce free spce. Use it ll? Split it up? Best fit: Serch the list, choose the best free block: fits, with fewest bytes left over 32 p Block Splitting 13 Now showing lloction sttus flg implicitly with shding. 14
4 Implicit Free List: Freeing Block Colescing Free Blocks 32 p free(p) p Colesce with following free block. free(p); Cler llocted flg logiclly gone mlloc(40); Externl frgmenttion! Enough spce, not one block. 15 Colesce with preceding free block? Bidirectionl Colescing: Boundry Tgs [Knuth73] Constnt-Time Colescing: 4 cses Heder Boundry tg (footer) pylod (ppliction dt, when llocted) optionl pdding n 0 n 0 n+ n+ n+ n+m n+ 17 n+m1+ 19
5 Summry: Implicit Free Lists Implementtion: Allocte: Free: simple O(blocks in hep) O(1) Memory utiliztion: depends on plcement policy Not widely used in prctice some specil purpose pplictions Explicit Free Lists Allocted block: pylod (ppliction dt, when llocted) (sme s implicit free list) optionl pdding Free block: next pointer prev pointer Explicit list of free blocks rther thn implicit list of ll blocks. Splitting, boundry tgs, colescing re generl to ll lloctors Explicit Free Lists: List vs. Memory Order Explicit Free Lists: Allocting Free Block Abstrctly: doubly-linked lists Next A B C Previous Before Concretely: free list blocks in ny memory order After (with splitting) A Next C B Previous List Order Memory Order 22 = mlloc( ) 23
6 Explicit Free Lists: Freeing Block Insertion policy: Where in the free list do you dd freed block? LIFO (lst-in-first-out) policy Pro: simple nd constnt time Con: studies suggest frgmenttion is worse thn ddress ordered Freeing with LIFO Policy: between free blocks Before Hed free( ) Address-ordered policy Con: liner-time serch to insert freed blocks Pro: studies suggest frgmenttion is lower thn LIFO Splice out predecessor nd successor blocks, colesce ll 3 memory blocks nd insert the new block t the hed of the list. After LIFO Exmple: 4 cses of freed block neighbor sttus. Hed Summry: Explicit Free Lists Summry: Alloctor Policies Implementtion: firly simple All policies offer trde-offs in frgmenttion nd throughput. Allocte: O(free blocks) vs. O(ll blocks) Free: O(1) vs. O(1) Memory utiliztion: depends on plcement policy lrger minimum (next/prev) vs. implicit list Used widely in prctice, often with more optimiztions. Plcement policy: First-fit, next-fit, best-fit, etc. Seglists pproximte best-fit in low time Splitting policy: Alwys? Sometimes? Size bound? Colescing policy: Immedite vs. deferred Splitting, boundry tgs, colescing re generl to ll lloctors
Outlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example
Outlines Dynmic Memory Alloc@on CSCI 01: Mchine Architecture nd Orgniz@on Bsic concepts Implicit free lists Explicit free lists Pen- Chung Yew Deprtment Computer Science nd Engineering University of Minnesot
More informationPage. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example
Hrsh Relity Memory Mtters Memory is not unbounded It must be llocted nd mnged 1 Mny lictions re memory dominted Esecilly those bsed on comlex, grh lgorithms Memory referencing bugs esecilly ernicious Effects
More informationPage 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes
Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S
More informationKeeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists
Dynmic Memory Alloction II Nov 7, 2002 clss22.ppt 15-213 The course tht gives CMU its Zip! Topics Explicit doubly-linked ree lists Segregted ree lists Grbge collection Memory-relted perils nd pitlls Keeping
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationReal-Time Programming in Java
ARTIST2 Summer School 2008 in Europe Autrns (ner Grenole), Frnce Septemer 8-12, 8 2008 Rel-Time Progrmming in Jv Rel-Time in the Age of Complex Systems Invited Speker: Dvid F. Bcon IBM Reserch 0 Clssicl
More informationOutline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations
CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCoprocessor memory definition. Loic Pallardy / Arnaud Pouliquen
Coprocessor memory definition Loic Pllrdy / Arnud Pouliquen Objective 2 The gol of following slides is to sum up on-going discussion in OpenAP weekly bout Remoteproc/Rpmsg memory lloction. Following proposl
More informationEnginner To Engineer Note
Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181
More information520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection
Dynmic Memory Mngement 50 Principles of Progrmming Lnguges 35: Grbge Collection Christin Collberg collberg@cs.rizon.edu Deprtment of Computer Science University of Arizon The run-time system linked in
More informationOutline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers
CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationDynamic Memory Allocation
1 Dynamic Memory Allocation Anne Bracy CS 3410 Computer Science Cornell University Note: these slides derive from those by Markus Püschel at CMU 2 Recommended Approach while (TRUE) { code a little; test
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More information05-247r2 SAT: Add 16-byte CDBs and PIO modes 1 September 2005
To: T10 Technicl Committee From: Robert Sheffield, Intel (robert.l.sheffield@intel.com) Dte: 1 September 2005 Subject: 05-247r2 SAT: Add 16-byte CDBs nd PIO modes Revision history Revision 0 (16 June 2005)
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationMemory Allocation II. CSE 351 Autumn Instructor: Justin Hsia
Memory Allocation II CSE 351 Autumn 2017 Instructor: Justin Hsia Teaching Assistants: Lucas Wotton Michael Zhang Parker DeWilde Ryan Wong Sam Gehman Sam Wolfson Savanna Yee Vinny Palaniappan http://xkcd.com/1909/
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationDynamic Memory Allocation
Dynamic Memory Allocation CS61, Lecture 10 Prof. Stephen Chong October 4, 2011 Announcements 1/2 Assignment 4: Malloc Will be released today May work in groups of one or two Please go to website and enter
More informationData Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationEasyMP Network Projection Operation Guide
EsyMP Network Projection Opertion Guide Contents 2 Introduction to EsyMP Network Projection EsyMP Network Projection Fetures... 5 Disply Options... 6 Multi-Screen Disply Function... 6 Movie Sending Mode...
More informationCaches I. CSE 351 Spring Instructor: Ruth Anderson
L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCaches I. CSE 351 Autumn 2018
Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationMemory Allocation II. CSE 351 Autumn Instructor: Justin Hsia
Memory Allocation II CSE 351 Autumn 2016 Instructor: Justin Hsia Teaching Assistants: Chris Ma Hunter Zahn John Kaltenbach Kevin Bi Sachin Mehta Suraj Bhat Thomas Neuman Waylon Huang Xi Liu Yufang Sun
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationMcAfee Network Security Platform
Mnger Applince Quick Strt Guide Revision B McAfee Network Security Pltform This guide is high-level description of how to instll nd configure the Mnger Applince. For more detiled instlltion informtion,
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-188 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationa Technical Notes on using Analog Devices' DSP components and development tools
Engineer To Engineer Note EE-146 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationCreating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationEpson Projector Content Manager Operation Guide
Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationA Progressive Register Allocator for Irregular Architectures
A Progressive Register Alloctor for Irulr Architectures Dvid Koes nd Seth Copen Goldstein Computer Science Deprtment Crnegie Mellon University {dkoes,seth}@cs.cmu.edu Abstrct Register lloction is one of
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationTCP/ICN: Carrying TCP over Content Centric and Named Data Networks
TCP/ICN: Crrying TCP over Content Centric nd Nmed Dt Networks Ily Moiseenko Cisco Systems Dve Orn Cisco Systems Outline I. Introduction II. Design Bsic fetching proxy Relible prefetching proxy Unrelible
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More information3.5.1 Single slit diffraction
3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.
More informationEngineer-to-Engineer Note
Engineer-to-Engineer Note EE-295 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil
More informationRegistering as a HPE Reseller. Quick Reference Guide for new Partners in Asia Pacific
Registering s HPE Reseller Quick Reference Guide for new Prtners in Asi Pcific Registering s new Reseller prtner There re five min steps to e new Reseller prtner. Crete your Appliction Copyright 2017 Hewlett
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationEngineer-to-Engineer Note
Engineer-to-Engineer Note EE-069 Technicl notes on using Anlog Devices DSPs, processors nd development tools Visit our Web resources http://www.nlog.com/ee-notes nd http://www.nlog.com/processors or e-mil
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationvcloud Director Service Provider Admin Portal Guide vcloud Director 9.1
vcloud Director Service Provider Admin Portl Guide vcloud Director 9. vcloud Director Service Provider Admin Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/
More informationAddress/Data Control. Port latch. Multiplexer
4.1 I/O PORT OPERATION As discussed in chpter 1, ll four ports of the 8051 re bi-directionl. Ech port consists of ltch (Specil Function Registers P0, P1, P2, nd P3), n output driver, nd n input buffer.
More informationvcloud Director Tenant Portal Guide vcloud Director 9.0
vcloud Director Tennt Portl Guide vcloud Director 9.0 vcloud Director Tennt Portl Guide You cn find the most up-to-dte technicl documenttion on the VMwre We site t: https://docs.vmwre.com/ The VMwre We
More informationDynamic Memory Allocation. Gerson Robboy Portland State University. class20.ppt
Dynamic Memory Allocation Gerson Robboy Portland State University class20.ppt Harsh Reality Memory is not unbounded It must be allocated and managed Many applications are memory dominated Especially those
More informationEasyMP Multi PC Projection Operation Guide
EsyMP Multi PC Projection Opertion Guide Contents 2 Introduction to EsyMP Multi PC Projection 5 EsyMP Multi PC Projection Fetures... 6 Connection to Vrious Devices... 6 Four-Pnel Disply... 6 Chnge Presenters
More informationvcloud Director Tenant Portal Guide vcloud Director 9.1
vcloud Director Tennt Portl Guide vcloud Director 9.1 You cn find the most up-to-dte technicl documenttion on the VMwre website t: https://docs.vmwre.com/ If you hve comments bout this documenttion, submit
More informationKnowledge States: A Tool in Randomized Online Algorithms
: A Tool in Rndomized Online Algorithms Center for the Advnced Study of Algorithms School of Computer Science University of Nevd, Ls Vegs ADS 2007 couthors: Lwrence L. Lrmore, John Nog, Rüdiger Reischuk
More information