Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
|
|
- Patricia Kennedy
- 5 years ago
- Views:
Transcription
1 Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries
2 In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer id. Given query string q, query reports: the id of q if it exists in S nothing otherwise. Exmple Suppose tht S {,,,,,,, }. Let the ids of these strings e (from left to right) 1, 2,..., 8, respectively. Given q, query returns id 3, wheres given q, it returns nothing. Y. To, April 9, 2013 Tries
3 Think How is this prolem relted to inverted indexes nd serch engines? Y. To, April 9, 2013 Tries
4 Nottions nd A Nive Solution Let A e the lphet (i.e., every chrcter of ny string must come from A). s e the length of string s, i.e., the numer of chrcters in s. m S, i.e., the numer of strings in S. n the totl length of the strings in S, i.e., n s S s. When A is smll nd ll strings in S re short (e.g., s 10 for ll s S), the exct mtching prolem on strings cn e reduced to exct mtching on integers. For exmple, consider tht ech string s represents n English word, nd tht every s hs length t most 10. We cn mp s to n integer from 0 to Think Why does the method no longer work if A is lrge or strings cn e ritrrily long? Y. To, April 9, 2013 Tries
5 Next, we will descrie nother solution sed on dt structure clled trie. First, let us define the concept of prefix. Let s e string of length t. We cn write its chrcters (from left to right) s s[1], s[2],..., s[t], respectively. Then, for ny i [1, t], the string formed y the sequence s[1],..., s[i] is clled prefix of s. Specilly, n empty string is lso prefix of s. Exmple s hs 6 prefixes:,,,,, nd. Let S e set of strings. We sy tht string s is possile prefix of S if s is prefix of t lest one string in S. Y. To, April 9, 2013 Tries
6 A set S of strings is clled prefix-free if no string in S is prefix of ny other string in S. Every set of strings cn e mde prefix-free y ppending specil termintion symol to ech string in S. Exmple Let S {,,,,,,, }. We cn convert S to S {,,,,,,, }, which is prefix-free. From now on, we will consider tht S is prefix-free, nd tht every string in S ends with. Y. To, April 9, 2013 Tries
7 Tries The trie on S is tree T defined s follows: Ech node u of T corresponds to distinct possile prefix of S. Let P(u) e the prefix tht u represents. Let u e node, nd v child node of u. Then: P(u) is prefix of P(v). P(v) P(u) + 1. Ech node u is leled with chrcter c, which is the lst chrcter of P(u). Y. To, April 9, 2013 Tries
8 Exmple: Let S {,,,,,,, }. The trie is: Note tht every -node u corresponds to distinct string s S. We therefore store the id of s t u. Y. To, April 9, 2013 Tries
9 Lemm The trie on S hs t most n nodes. Y. To, April 9, 2013 Tries
10 How do we nswer n exct mtching query with q? How out q? Y. To, April 9, 2013 Tries
11 How to delete the string? How out inserting? Y. To, April 9, 2013 Tries
12 Notice tht the efficiency of queries, insertions nd deletions depends on how well we cn solve the following prolem: Given node u nd chrcter σ A {}, how to find the child of v of u tht corresponds to σ? Different trdeoffs exist: By orgnizing the child nodes of u in n rry, we cn find v in O(1) time, ut the rry occupies O( A ) spce. By orgnizing the child nodes of u in inry serch tree (BST), we cn find v in O(log A ) time, nd the tree occupies O( f ) spce, where f is the numer of child nodes of u. Y. To, April 9, 2013 Tries
13 Theorem By using the rry implementtion, trie occupies O( A n) spce, nswers query with string q in O( q ) time, nd supports the insertion nd deletion of string s in O( A s ) time. By using the BST implementtion, trie occupies O(n) spce, nswers query with string q in O( q log A ) time, nd supports the insertion nd deletion of string s in O( s log A ) time. Y. To, April 9, 2013 Tries
14 Next, we will descrie nother trie vrint, clled lnced trie, which occupies O(n) spce, nd nswers query with string q in O(log m + q ) time. The trie, however, is sttic, nmely, it does not support insertions nd deletions. Y. To, April 9, 2013 Tries
15 From now on, we consider tht S is sorted lpheticlly (plcing efore ll chrcters of A). In generl, given set S of x sorted strings, we refer to the one in S whose rnk is x/2 s the medin of S. Exmple The medin of {,,,,,,, } is. Furthermore, given prefix p, denote y S(p) the set of strings in S with prefix p. Exmple Let S {,,,,,,, }. Then S() {,, }. Y. To, April 9, 2013 Tries
16 We lso need to define wht it mens y conctention. The conctention of two strings s 1 nd s 2 forms string y ppending the chrcters of s 2 t the end of s 1. Exmple If s 1 nd s 2, then conctention gives. If s 1 nd s 2, then conctention gives. Similrly, if s 1 nd s 2, conctention gives. Y. To, April 9, 2013 Tries
17 Let S e set of strings. The lnced trie on S is tree T defined s follows: Every node u in T corresponds to set S(u) of strings, nd crries lel L(u) nd positionl index I (u), which will e formlly defined elow. L(u) is the i-th chrcter of the medin of S(u), where i I (u). Ech u corresponds to possile prefix P(u) of S, where P(u) is the conctention of the lels of the nodes on the pth from the root to u. If u is the root, S(u) S, nd I (u) 1. u is lef if S(u) 1 nd I (u) s, where s is the (only) string in S(u). An internl u hs t most 3 child nodes u <, u, nd u > such tht: S(u <) is the set of strings in S(u) lpheticlly less thn P(u). I (u <) I (u). S(u ) is the set of strings in S(u) tht hve P(u) s their prefixes. I (u ) I (u) + 1. S(u >) is the set of remining strings in S(u). I (u >) I (u) Y. To, April 9, 2013 Tries
18 Exmple: Let S {,,,,,,, }. The lnced trie is: (, 1) (, 2) (, 3) (, 2) < (, 3) (, 4) (, 3) < < (, 4) (, 4) (, 5) (, 3) (, 4) > (, 6) (, 5) (, 5) (, 4) (, 5) < > (, 6) (, 5) (, 6) (, 5) (, 6) Ech node u is denoted in the form (L(u), I (u)). > (, 6) Y. To, April 9, 2013 Tries
19 (, 1) (, 2) (, 3) (, 2) < (, 3) (, 4) (, 3) < < (, 4) (, 4) (, 5) (, 3) (, 4) > (, 6) (, 5) (, 5) (, 4) (, 5) < > (, 6) (, 5) (, 6) (, 5) (, 6) > (, 6) How do we nswer n exct mtching query with q? How out q? Y. To, April 9, 2013 Tries
20 Theorem A lnced trie occupies O(n) spce, nd nswers query with string q in O(log m + q ) time Y. To, April 9, 2013 Tries
What are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationLecture 10: Suffix Trees
Computtionl Genomics Prof. Ron Shmir, Prof. Him Wolfson, Dr. Irit Gt-Viks School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' רון שמיר, פרופ' חיים וולפסון, דר' עירית גת-ויקס ביה"ס למדעי
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationSuffix trees. December Computational Genomics
Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationAn Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure
, Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationDeterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1
Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationOn String Matching in Chunked Texts
On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationI/O Efficient Dynamic Data Structures for Longest Prefix Queries
I/O Efficient Dynmic Dt Structures for Longest Prefix Queries Moshe Hershcovitch 1 nd Him Kpln 2 1 Fculty of Electricl Engineering, moshik1@gmil.com 2 School of Computer Science, himk@cs.tu.c.il, Tel Aviv
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationChapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids
Chpter44 Polygons nd solids Contents: A Polygons B Tringles C Qudrilterls D Solids E Constructing solids 74 POLYGONS AND SOLIDS (Chpter 4) Opening prolem Things to think out: c Wht different shpes cn you
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationHere is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to
djcent tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. me the djcent cute ngles in this digrm rm is shred y + + me vertex point for + + + is djcent to + djcent simply mens
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION
CIS 1068 Progrm Design nd Astrction Spring2015 Midterm Exm 1 Nme SOLUTION Pge Points Score 2 15 3 8 4 18 5 10 6 7 7 7 8 14 9 11 10 10 Totl 100 1 P ge 1. Progrm Trces (41 points, 50 minutes) Answer the
More informationThe dictionary model allows several consecutive symbols, called phrases
A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationSuffix Trees and Arrays
Suffix Trees and Arrays Yufei Tao KAIST May 1, 2013 We will discuss the following substring matching problem: Problem (Substring Matching) Let σ be a single string of n characters. Given a query string
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationCS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationNotes for Graph Theory
Notes for Grph Theory These re notes I wrote up for my grph theory clss in 06. They contin most of the topics typiclly found in grph theory course. There re proofs of lot of the results, ut not of everything.
More informationThe Fundamental Theorem of Calculus
MATH 6 The Fundmentl Theorem of Clculus The Fundmentl Theorem of Clculus (FTC) gives method of finding the signed re etween the grph of f nd the x-xis on the intervl [, ]. The theorem is: FTC: If f is
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationbinary trees, expression trees
COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More information4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy
/9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCSE 549: Suffix Tries & Suffix Trees. All slides in this lecture not marked with * of Ben Langmead.
CSE 549: Suffix Tries & Suffix Trees All slides in this lecture not mrked with * of Ben Lngmed. KMP is gret, ut T = m P = n (note: m,n re opposite from previous lecture) Without preprocessing (KMP) Given
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More information