On String Matching in Chunked Texts
|
|
- Cassandra Davidson
- 5 years ago
- Views:
Transcription
1 On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI HUT, Finlnd On String Mtching in Chunked Texts p. 1
2 Overview Problem Dt consists of chunks Brief history of previous solutions New lgorithms Some experimentl results Conclusions On String Mtching in Chunked Texts p. 2
3 Problem Exct pttern mtching on strings: find ll positions where given pttern cn be found in text Text of length n: T = t 1 t 2 t n Pttern of length m: P = p 1 p 2 p m Texts re specil: chunked On String Mtching in Chunked Texts p. 3
4 Texts re chunked Now texts consist of consecutive fixed-length chunks:... Ech byte position (,,, ) in every chunk hs chrcter distribution of its own A chunk cn lso be interpreted s chrcter of lrger lphbet q is the probbility tht two rndomly chosen bytes from text nd pttern mtch Thierry Lecroq: Experiments on string mtching in memory structures. SPE, 28(5): , On String Mtching in Chunked Texts p. 4
5 Some pttern mtching lgorithms Boyer Moore (BM) Horspool (Hor) shift is simplified: bsed on chrcter tht is ligned with the end of the pttern Sundy s Quick Serch (QS) shift is bsed on chrcter tht is fter the end of the pttern Zhu Tkok, Bez-Ytes, etc. shift is bsed on two or more chrcters On String Mtching in Chunked Texts p. 5
6 Implementtion Alredy Boyer & Moore noticed tht rndom text chrcter rrely mtches with the corresponding chrcter in pttern So usully lgorithms check one chrcter nd move forwrd skip loop TBM = Tuned Boyer Moore uses ufst skip loop (originl implementtion by Hume & Sundy) Gurd: n dditionl test before comprison of the entire pttern On String Mtching in Chunked Texts p. 6
7 The speed of QS nd Hor should be lmost equl If chrcters re sttisticlly independent of ech other Expected shift length of Hor is 1 (1 q)m q Expected shift length of QS is 1 (1 q)m+1 q When comprison is mde forwrd; n exmple: On String Mtching in Chunked Texts p. 7
8 Exmple of the behvior of QS b b b * * * * * * m(m+1) 2 comprisons per 2m chrcters in text QS works here in O(nm) On String Mtching in Chunked Texts p. 8
9 Peculir behvior When comprison is mde forwrd P = m,t = ( m 1 b) n/m Hor works in O(n/m) nd QS in O(nm) P = m 4 c 3,T = (b m 2 cb) n/m QS works in O(n/m) but Hor in O(nm) On String Mtching in Chunked Texts p. 9
10 Lecroq s dt / short integers Shorts symbols mx.freq. zeros 1/q Overll = bytes Regulrities: 5 + i 32 \x00 ; 21 + i 32 \x40 ; 13 + i i 64 \x10 ; 29 + i i 64 \x90 On String Mtching in Chunked Texts p. 10
11 Lecroq s dt / doubles Doubles symbols mx.freq. zeros 1/q Overll On String Mtching in Chunked Texts p. 11
12 Lecroq s dt nd experiments Dt ws dumps from computer memory On shorts, TBM ws fstest on short ptterns nd QS on long ptterns On doubles, BM ws fstest Lecroq did not consider the effects cused by chunks. He ws more interested in the effect of the lphbet size When potentil mtch ws found, it ws checked tht it ends on chunk border On String Mtching in Chunked Texts p. 12
13 Wht would work better Positions with no or little vrition re chllenging We could use two bytes so tht t lest the other byte would hit position with rich vrying content. We could lso peek forwrd greedily to get longer shifts We could shift in synchronized fshion (with chunk borders) nd check the content of the most rndom byte position in the lst chunk of the pttern On String Mtching in Chunked Texts p. 13
14 Fork(h, P = p 1 p 2 p m, T = t 1 t 2 t n ) /* Preprocessing */ 1: for ll c Σ do tmpd[c] m 2: for i 1 to m 1 do tmpd[p i ] m i 3: shift tmpd[p m ]; tmpd[p m ] 0 4: for ll c1 Σ do 5: if tmpd[c1] < h then 6: for ll c2 Σ do d[c1,c2] tmpd[c1] 7: else 8: for ll c2 Σ do d[c1,c2] m + h 9: for i 1 to h do d[c1,p i ] m + h i 10: for i 1 to m h do 11: if tmpd[p i ] h then d[p i,p i+h ] m i /* Serching is on next slide */ On String Mtching in Chunked Texts p. 14
15 Fork(h, P = p 1 p 2 p m, T = t 1 t 2 t n ) /* Serching */ 12: t n+1 t n+2 m P + P /* Stopper */ 13: j m 14: while j n do 15: repet k d[t j,t j+h ]; j j + k until k = 0 16: if j n then 17: if t j m+1 t j 1 = p 1 p m 1 nd j is multiple of w then Report mtch 18: j j + shift On String Mtching in Chunked Texts p. 15
16 Sync(h, P = p 1 p 2 p m, T = t 1 t 2 t n ) /* Preprocessing */ 1: for ll c Σ do d1[c] m 2: for i w h step w to m h 1 do d1[p i ] (m h) i /* Serching */ 3: s p m h 4: t n+1..t n+m s m /* Stopper for inner while */ 5: j m 6: while j n do 7: while t j h s do j j + d1[t j h ] 8: if t j m+1..t j = P then Report mtch 9: j j + d1[s] On String Mtching in Chunked Texts p. 16
17 Results for shorts Time (sec) Running times per pttern in seconds for shorts Pttern length (bytes) Hor TBM Fork 3 BM QS Sync 3 On String Mtching in Chunked Texts p. 17
18 Results for shorts (long ptterns) Time (sec) Running times per pttern in seconds for shorts Pttern length (bytes) Hor TBM Fork 3 BM QS Sync 3 On String Mtching in Chunked Texts p. 18
19 Results for doubles 1.8 Running times per pttern in seconds for doubles Time (sec) TBM Hor QS BM Fork 4 Sync Pttern length (bytes) On String Mtching in Chunked Texts p. 19
20 Concluding remrks Test runs were repeted on two rchitectures: on Sprc nd on AMD Athlon Thunderbird Librry routine memcmp slower thn explicit comprison On Sync prmeter h corresponding smllest q works usully best On Fork the smll vlues seem to be good for prmeter h On String Mtching in Chunked Texts p. 20
21 Conclusions Choice of test position is sometimes crucil Skip loop improves speed in prctice, if test chrcter is not too common Insted of mximizing the verge shift length, it is often fster to keep the skip loop running String mtching results re dt dependent e.g. chunked dt cn hve very different effect on different lgorithms On String Mtching in Chunked Texts p. 21
Algorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationCompression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv
Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationA New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method
A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationLecture T4: Pattern Matching
Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More informationCS 430 Spring Mike Lam, Professor. Parsing
CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationNearest Keyword Set Search in Multi-dimensional Datasets
Nerest Keyword Set Serch in Multi-dimensionl Dtsets Vishwkrm Singh Deprtment of Computer Science University of Cliforni Snt Brbr, USA Emil: vsingh014@gmil.com Ambuj K. Singh Deprtment of Computer Science
More informationLexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay
Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationCompanion Mathematica Notebook for "What is The 'Equal Weight View'?"
Compnion Mthemtic Notebook for "Wht is The 'Equl Weight View'?" Dvid Jehle & Brnden Fitelson July 9 The methods used in this notebook re specil cses of more generl decision procedure
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationAssignment 4. Due 09/18/17
Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationII. THE ALGORITHM. A. Depth Map Processing
Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationHVLearn: Automated Black-box Analysis of Hostname Verification in SSL/TLS Implementations
2017 IEEE Symposium on Security nd Privcy HVLern: Automted Blck-box Anlysis of Hostnme Verifiction in SSL/TLS Implementtions Suphnnee Sivkorn, George Argyros, Kexin Pei, Angelos D. Keromytis, nd Sumn Jn
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques Brin Kernighn wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Junwen Li, li@cs, CS 217,258-0451 Yong Wng,yongwng@cs, CS
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationThe Structure of Forward, Reverse, and Transverse Path Graphs in The Pattern Recognition Algorithms of Sellers
The Structure of Forwrd, Reverse, nd Trnsverse Pth Grhs in The Pttern Recognition Algorithms of Sellers Lewis Lsser Dertment of Mthemtics nd Comuter Science York College/CUNY Jmic, New York 11451 llsser@york.cuny.edu
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More information5 Regular 4-Sided Composition
Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationFunctor (1A) Young Won Lim 8/2/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationECEN 468 Advanced Logic Design Lecture 36: RTL Optimization
ECEN 468 Advnced Logic Design Lecture 36: RTL Optimiztion ECEN 468 Lecture 36 RTL Design Optimiztions nd Trdeoffs 6.5 While creting dtpth during RTL design, there re severl optimiztions nd trdeoffs, involving
More informationCOS 333: Advanced Programming Techniques
COS 333: Advnced Progrmming Techniques How to find me wk@cs, www.cs.princeton.edu/~wk 311 CS Building 609-258-2089 (ut emil is lwys etter) TA's: Mtvey Arye (rye), Tom Jlin (tjlin), Nick Johnson (npjohnso)
More informationSpring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.
15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge
More informationFault injection attacks on cryptographic devices and countermeasures Part 2
Fult injection ttcks on cryptogrphic devices nd countermesures Prt Isrel Koren Deprtment of Electricl nd Computer Engineering University of Msschusetts Amherst, MA Countermesures - Exmples Must first detect
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationFunctor (1A) Young Won Lim 10/5/17
Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationChapter Spline Method of Interpolation More Examples Electrical Engineering
Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.
More informationThe Distributed Data Access Schemes in Lambda Grid Networks
The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationFall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.
15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationAn Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization
An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction
More informationOutline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP
ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression
More informationNaming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you.
Nming 3D ojects 1 Nme the 3D ojects lelled in these models. Use the word nk to help you. Word nk cue prism sphere cone cylinder pyrmid D A C F A B C D cone cylinder cue cylinder E B E prism F cue G G pyrmid
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationCSE 401 Midterm Exam 11/5/10 Sample Solution
Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationString Searching. String Search. Applications. Brute Force: Typical Case
String Serch String Serching String serch. Given pttern string p, find first mtch in text t. Model. Cn't fford to preprocess the text. Prmeters. N = length of text, M = length of pttern. typiclly N >>
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationExperiments on string matching in memory structures
Experiments on string matching in memory structures Thierry Lecroq LIR (Laboratoire d'informatique de Rouen) and ABISS (Atelier de Biologie Informatique Statistique et Socio-Linguistique), Universite de
More informationCHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE
CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE 3.1 Scheimpflug Configurtion nd Perspective Distortion Scheimpflug criterion were found out to be the best lyout configurtion for Stereoscopic PIV, becuse
More informationLECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
More informationDouble Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals
Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls
More information