A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing

Size: px
Start display at page:

Download "A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing"

Transcription

1 A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing Song Liu 1,2, Yi Wang 3, Fei Wang 1,2 * 1 Shanghai Key Lab of Intelligent Information Processing, Shanghai, China. 2 School of Computer Science and Technology, Fudan University, Shanghai, China. 3 School of Life Sciences, Fudan University, Shanghai, China. GIW 2016

2 Background importance Read alignment is usually the first step to do genome sequence analysis and is usually the most time-consuming one methods based on hash table (BLAST,SOAP,MAQ) based on prefix/suffix trie (BWA,Bowtie,SOAP2)

3 Background number A whole genome reads including 304 million pairs of reads (library size is ~200GB) length The length of one read is 150bp time BWA-MEME needs 74 hours to process this data(single thread)

4 Background number A whole genome reads including 304 million pairs of reads(library size is ~200GB) length The length of one read is 150bp time FSVA only needs 13 hours to process this data(single thread)

5 Methods 1 FSVA 2 3

6 Methods Building hash table Figure.1. The process of key calculation Vectorn represents the vector of coordinates of subsequences with the same key n Figure.2. An example of our hash table. The process of key calculation. X " is a 62bit unsigned integer calculated by converting a 31bp subsequence into a binary number. key " is a 32 bit unsigned integer, calculated by X " modulo a large prime number M.

7 Methods Generating seeds and voting Figure.3. The process of generating seeds and voting

8 Methods The final mapping block should have at least two votes If more than one block has the same most count of votes, we choose one randomly If the alignment has more than two mismatches, we do a Smith-Waterman dynamic programming between the read and the extending block If a seed votes more than 450 coordinates, we think this seed is unrepresentative and drop it

9 Evaluation FSVA BWA-MEM (Li, H. (2013). Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arxiv preprint arxiv: ) Bowtie2 (Langmead, B., & Salzberg, S. L. (2012). Fast gapped-read alignment with Bowtie 2. Nature Methods, 9(4), ) Subread (Liao, Y., Smyth, G. K., & Shi, W. (2013). The Subread aligner: fast, accurate and scalable read mapping by seed-and-vote. Nucleic acids research,41(10), e108-e108.)

10 Evaluation Simulated data Wgsim As the reads are fetched from the reference, we know the exact coordinate of each individual read. Thus, we can compare the locations predicted by each alignment tool with the real locations to evaluate the accuracy 1 million reads Base error rate: 0.4% SNP mutation rate: 0.09% Indel mutation rate: 0.01% 125bp and 150bp Single-end and pair-end

11 Evaluation Simulated data Table 1.Evaluation on simulated data Program stime(s) sconf(%) serr(%) ptime(s) pconf(%) perr(%) BWA Subread FSVA Bowtie BWA Subread FSVA Bowtie

12 Evaluation 125bp 150bp Fig.5.The variety between unmapped percent and error rate

13 Evaluation Real data Table 2.Library size of the five datasets Dataset1 Dataset2 Dataset3 Dataset4 Dataset5 Library size 201GB 290GB 298GB 284GB 342GB Table 3.Time cost on real data Tool Time1(m) Time2(m) Time3(m) Time4(m) Time5(m) BWA-MEM Subread FSVA Bowtie

14 Evaluation Real data Fig. 6.The Ti/Tv ratio of the variants called by SAMtools using the result of BWA-MEM, Subread, Bowtie2 or FSVA. Fig.7.Number of variants called by Samtools using the result of BWA-MEM, Subread, Bowtie2 and FSVA separately.

15 Evaluation Real data 89.05% is identified from the results of all the four tools and only 4814 variants are called only via FSVA. This may demonstrate the specificity of called variants based on FSVA is best when compared with the other three tools. Fig.8.A Venn Diagram of the number of variants with high quality.

16 Conclusion FSVA is suitable for long reads with a high quality (low base error rate). In this situation, FSVA can get a relatively alignment result in very short time. For some studies, the data is a tsunami and the very accuracy for an individual is not critical, FSVA will be a good choice.

17 THANK YOU

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

Kart: a divide-and-conquer algorithm for NGS read alignment

Kart: a divide-and-conquer algorithm for NGS read alignment Bioinformatics, 33(15), 2017, 2281 2287 doi: 10.1093/bioinformatics/btx189 Advance Access Publication Date: 4 April 2017 Original Paper Sequence analysis Kart: a divide-and-conquer algorithm for NGS read

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

GPU Accelerated API for Alignment of Genomics Sequencing Data

GPU Accelerated API for Alignment of Genomics Sequencing Data GPU Accelerated API for Alignment of Genomics Sequencing Data Nauman Ahmed, Hamid Mushtaq, Koen Bertels and Zaid Al-Ars Computer Engineering Laboratory, Delft University of Technology, Delft, The Netherlands

More information

Package Rsubread. July 21, 2013

Package Rsubread. July 21, 2013 Package Rsubread July 21, 2013 Type Package Title Rsubread: an R package for the alignment, summarization and analyses of next-generation sequencing data Version 1.10.5 Author Wei Shi and Yang Liao with

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

Read Mapping. Slides by Carl Kingsford

Read Mapping. Slides by Carl Kingsford Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology

More information

Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs

Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs Anas Abu-Doleh 1,2, Erik Saule 1, Kamer Kaya 1 and Ümit V. Çatalyürek 1,2 1 Department of Biomedical Informatics 2 Department of Electrical

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Scalable RNA Sequencing on Clusters of Multicore Processors

Scalable RNA Sequencing on Clusters of Multicore Processors JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA

More information

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units

GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units GPUBwa -Parallelization of Burrows Wheeler Aligner using Graphical Processing Units Abstract A very popular discipline in bioinformatics is Next-Generation Sequencing (NGS) or DNA sequencing. It specifies

More information

Alignment of Long Sequences

Alignment of Long Sequences Alignment of Long Sequences BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2009 Mark Craven craven@biostat.wisc.edu Pairwise Whole Genome Alignment: Task Definition Given a pair of genomes (or other large-scale

More information

Sequence mapping and assembly. Alistair Ward - Boston College

Sequence mapping and assembly. Alistair Ward - Boston College Sequence mapping and assembly Alistair Ward - Boston College Sequenced a genome? Fragmented a genome -> DNA library PCR amplification Sequence reads (ends of DNA fragment for mate pairs) We no longer have

More information

arxiv: v2 [q-bio.gn] 13 May 2014

arxiv: v2 [q-bio.gn] 13 May 2014 BIOINFORMATICS Vol. 00 no. 00 2005 Pages 1 2 Fast and accurate alignment of long bisulfite-seq reads Brent S. Pedersen 1,, Kenneth Eyring 1, Subhajyoti De 1,2, Ivana V. Yang 1 and David A. Schwartz 1 1

More information

Finding the appropriate method, with a special focus on: Mapping and alignment. Philip Clausen

Finding the appropriate method, with a special focus on: Mapping and alignment. Philip Clausen Finding the appropriate method, with a special focus on: Mapping and alignment Philip Clausen Background Most people choose their methods based on popularity and history, not by reasoning and research.

More information

Genome 373: Mapping Short Sequence Reads I. Doug Fowler

Genome 373: Mapping Short Sequence Reads I. Doug Fowler Genome 373: Mapping Short Sequence Reads I Doug Fowler Two different strategies for parallel amplification BRIDGE PCR EMULSION PCR Two different strategies for parallel amplification BRIDGE PCR EMULSION

More information

A Nearest Neighbors Algorithm for Strings. R. Lederman Technical Report YALEU/DCS/TR-1453 April 5, 2012

A Nearest Neighbors Algorithm for Strings. R. Lederman Technical Report YALEU/DCS/TR-1453 April 5, 2012 A randomized algorithm is presented for fast nearest neighbors search in libraries of strings. The algorithm is discussed in the context of one of the practical applications: aligning DNA reads to a reference

More information

Subread/Rsubread Users Guide

Subread/Rsubread Users Guide Subread/Rsubread Users Guide Rsubread v1.32.3/subread v1.6.3 25 February 2019 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James

More information

Subread/Rsubread Users Guide

Subread/Rsubread Users Guide Subread/Rsubread Users Guide Rsubread v1.32.0/subread v1.6.3 19 October 2018 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne

More information

Implementing Modern Short Read DNA Alignment Algorithms in CUDA. Jonathan Cohen Senior Manager, CUDA Libraries and Algorithms

Implementing Modern Short Read DNA Alignment Algorithms in CUDA. Jonathan Cohen Senior Manager, CUDA Libraries and Algorithms Implementing Modern Short Read DNA Alignment Algorithms in CUDA Jonathan Cohen Senior Manager, CUDA Libraries and Algorithms Next-Gen DNA Sequencing In 4 slides DNA Sample Replication C A T G Sensing Circuitry

More information

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.

More information

An FPGA-Based Systolic Array to Accelerate the BWA-MEM Genomic Mapping Algorithm

An FPGA-Based Systolic Array to Accelerate the BWA-MEM Genomic Mapping Algorithm An FPGA-Based Systolic Array to Accelerate the BWA-MEM Genomic Mapping Algorithm Ernst Joachim Houtgast, Vlad-Mihai Sima, Koen Bertels and Zaid Al-Ars Faculty of EEMCS, Delft University of Technology,

More information

Bioinformatics. Anatomy of a Hash-based Long Read Sequence Mapping Algorithm for Next Generation DNA Sequencing

Bioinformatics. Anatomy of a Hash-based Long Read Sequence Mapping Algorithm for Next Generation DNA Sequencing Bioinformatics Anatomy of a Hash-based Long Read Sequence Mapping Algorithm for Next Generation DNA Sequencing Journal: Bioinformatics Manuscript ID: BIOINF-0-0 Category: Original Paper Date Submitted

More information

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems. Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

Resolving Load Balancing Issues in BWA on NUMA Multicore Architectures

Resolving Load Balancing Issues in BWA on NUMA Multicore Architectures Resolving Load Balancing Issues in BWA on NUMA Multicore Architectures Charlotte Herzeel 1,4, Thomas J. Ashby 1,4 Pascal Costanza 3,4, and Wolfgang De Meuter 2 1 imec, Kapeldreef 75, B-3001 Leuven, Belgium,

More information

BFAST: An Alignment Tool for Large Scale Genome Resequencing

BFAST: An Alignment Tool for Large Scale Genome Resequencing : An Alignment Tool for Large Scale Genome Resequencing Nils Homer 1,2, Barry Merriman 2 *, Stanley F. Nelson 2 1 Department of Computer Science, University of California Los Angeles, Los Angeles, California,

More information

AMAS: optimizing the partition and filtration of adaptive seeds to speed up read mapping

AMAS: optimizing the partition and filtration of adaptive seeds to speed up read mapping AMAS: optimizing the partition and filtration of adaptive seeds to speed up read mapping Ngoc Hieu Tran 1, * Email: nhtran@ntu.edu.sg Xin Chen 1 Email: chenxin@ntu.edu.sg 1 School of Physical and Mathematical

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

Subread/Rsubread Users Guide

Subread/Rsubread Users Guide Subread/Rsubread Users Guide Subread v1.4.6-p3/rsubread v1.18.0 15 May 2015 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne

More information

Accelrys Pipeline Pilot and HP ProLiant servers

Accelrys Pipeline Pilot and HP ProLiant servers Accelrys Pipeline Pilot and HP ProLiant servers A performance overview Technical white paper Table of contents Introduction... 2 Accelrys Pipeline Pilot benchmarks on HP ProLiant servers... 2 NGS Collection

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Reads Alignment and Variant Calling

Reads Alignment and Variant Calling Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department

More information

Highly Scalable and Accurate Seeds for Subsequence Alignment

Highly Scalable and Accurate Seeds for Subsequence Alignment Highly Scalable and Accurate Seeds for Subsequence Alignment Abhijit Pol Tamer Kahveci Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL, USA, 32611

More information

Heterogeneous Hardware/Software Acceleration of the BWA-MEM DNA Alignment Algorithm

Heterogeneous Hardware/Software Acceleration of the BWA-MEM DNA Alignment Algorithm Heterogeneous Hardware/Software Acceleration of the BWA-MEM DNA Alignment Algorithm Nauman Ahmed, Vlad-Mihai Sima, Ernst Houtgast, Koen Bertels and Zaid Al-Ars Computer Engineering Lab, Delft University

More information

A Comparison of Seed-and-Extend Techniques in Modern DNA Read Alignment Algorithms

A Comparison of Seed-and-Extend Techniques in Modern DNA Read Alignment Algorithms Delft University of Technology A Comparison of Seed-and-Extend Techniques in Modern DNA Read Alignment Algorithms Ahmed, Nauman; Bertels, Koen; Al-Ars, Zaid DOI 10.1109/BIBM.2016.7822731 Publication date

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Quiz section 10. June 1, 2018

Quiz section 10. June 1, 2018 Quiz section 10 June 1, 2018 Logistics Bring: 1 page cheat-sheet, simple calculator Any last logistics questions about the final? Logistics Bring: 1 page cheat-sheet, simple calculator Any last logistics

More information

Burrows-Wheeler Short Read Aligner on AWS EC2 F1 Instances

Burrows-Wheeler Short Read Aligner on AWS EC2 F1 Instances University of Virginia High-Performance Low-Power Lab Prof. Dr. Mircea Stan Burrows-Wheeler Short Read Aligner on AWS EC2 F1 Instances Smith-Waterman Extension on FPGA(s) Sergiu Mosanu, Kevin Skadron and

More information

MacVector for Mac OS X. The online updater for this release is MB in size

MacVector for Mac OS X. The online updater for this release is MB in size MacVector 17.0.3 for Mac OS X The online updater for this release is 143.5 MB in size You must be running MacVector 15.5.4 or later for this updater to work! System Requirements MacVector 17.0 is supported

More information

Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment

Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment Darwin: A Hardware-acceleration Framework for Genomic Sequence Alignment Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering and Computer Science) Prof. Gill Bejerano

More information

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion

More information

Sequence Alignment Through the Looking Glass

Sequence Alignment Through the Looking Glass 218 IEEE International Parallel and Distributed Processing Symposium Workshops Sequence Alignment Through the Looking Glass Raja Appuswamy Data Science Department EURECOM France raja.appuswamy@eurecom.fr

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

Package Rsubread. February 4, 2018

Package Rsubread. February 4, 2018 Version 1.29.0 Date 2017-10-25 Title Subread sequence alignment for R Package Rsubread February 4, 2018 Author Wei Shi and Yang Liao with contributions from Gordon Smyth, Jenny Dai and Timothy Triche,

More information

Distributed gene clinical decision support system based on cloud computing

Distributed gene clinical decision support system based on cloud computing Xu et al. BMC Medical Genomics 2018, 11(Suppl 5):100 https://doi.org/10.1186/s12920-018-0415-1 RESEARCH Open Access Distributed gene clinical decision support system based on cloud computing Bo Xu, Changlong

More information

Subread/Rsubread Users Guide

Subread/Rsubread Users Guide Subread/Rsubread Users Guide Subread v1.3.5-p5/rsubread v1.11.10 1 August 2013 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research Melbourne, Australia

More information

UNIVERSITY OF OSLO. Department of informatics. Parallel alignment of short sequence reads on graphics processors. Master thesis. Bjørnar Andreas Ruud

UNIVERSITY OF OSLO. Department of informatics. Parallel alignment of short sequence reads on graphics processors. Master thesis. Bjørnar Andreas Ruud UNIVERSITY OF OSLO Department of informatics Parallel alignment of short sequence reads on graphics processors Master thesis Bjørnar Andreas Ruud April 29, 2011 2 Table of Contents 1 Abstract... 7 2 Acknowledgements...

More information

Package Rsubread. June 29, 2018

Package Rsubread. June 29, 2018 Version 1.30.4 Date 2018-06-22 Package Rsubread June 29, 2018 Title Subread sequence alignment and counting for R Author Wei Shi and Yang Liao with contributions from Gordon K Smyth, Jenny Dai and Timothy

More information

Building approximate overlap graphs for DNA assembly using random-permutations-based search.

Building approximate overlap graphs for DNA assembly using random-permutations-based search. An algorithm is presented for fast construction of graphs of reads, where an edge between two reads indicates an approximate overlap between the reads. Since the algorithm finds approximate overlaps directly,

More information

SMALT Manual. December 9, 2010 Version 0.4.2

SMALT Manual. December 9, 2010 Version 0.4.2 SMALT Manual December 9, 2010 Version 0.4.2 Abstract SMALT is a pairwise sequence alignment program for the efficient mapping of DNA sequencing reads onto genomic reference sequences. It uses a combination

More information

IMOS: improved Meta-aligner and Minimap2 On Spark

IMOS: improved Meta-aligner and Minimap2 On Spark Hadadian Nejad Yousefi et al. BMC Bioinformatics (2019) 20:51 https://doi.org/10.1186/s12859-018-2592-5 SOFTWARE Open Access IMOS: improved Meta-aligner and Minimap2 On Spark Mostafa Hadadian Nejad Yousefi,

More information

Bioinformatics Framework

Bioinformatics Framework Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest

More information

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 USA SAN FRANCISCO USA ORLANDO BELGIUM - HQ LEUVEN THE NETHERLANDS EINDHOVEN

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

Package Rbowtie. January 21, 2019

Package Rbowtie. January 21, 2019 Type Package Title R bowtie wrapper Version 1.23.1 Date 2019-01-17 Package Rbowtie January 21, 2019 Author Florian Hahne, Anita Lerch, Michael B Stadler Maintainer Michael Stadler

More information

Comparison between conventional read mapping methods and compressively-accelerated read mapping framework (CORA).

Comparison between conventional read mapping methods and compressively-accelerated read mapping framework (CORA). Supplementary Figure 1 Comparison between conventional read mapping methods and compressively-accelerated read mapping framework (CORA). Comparison between conventional read mapping methods and compressively-accelerated

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018)

Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Tutorial: How to use the Wheat TILLING database

Tutorial: How to use the Wheat TILLING database Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.

More information

CloudBurst: Highly Sensitive Read Mapping with MapReduce

CloudBurst: Highly Sensitive Read Mapping with MapReduce Bioinformatics Advance Access published April 8, 2009 Sequence Analysis CloudBurst: Highly Sensitive Read Mapping with MapReduce Michael C. Schatz* Center for Bioinformatics and Computational Biology,

More information

Package Rsubread. December 11, 2018

Package Rsubread. December 11, 2018 Version 1.33.5 Date 2018-12-05 Package Rsubread December 11, 2018 Title Subread sequence alignment and counting for R Author Wei Shi and Yang Liao with contributions from Gordon K Smyth, Jenny Dai and

More information

Genetically Improved BarraCUDA

Genetically Improved BarraCUDA Genetically Improved BarraCUDA CREST Annual Research Review: Recent Results and Research Trends 15-16 th June 2015 W. B. Langdon Department of Computer Science 15.6.2015 Genetically Improved BarraCUDA

More information

Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University

Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )

More information

Supplementary Note 1: Detailed methods for vg implementation

Supplementary Note 1: Detailed methods for vg implementation Supplementary Note 1: Detailed methods for vg implementation GCSA2 index generation We generate the GCSA2 index for a vg graph by transforming the graph into an effective De Bruijn graph with k = 256,

More information

all M 2M_gt_15 2M_8_15 2M_1_7 gt_2m TopHat2

all M 2M_gt_15 2M_8_15 2M_1_7 gt_2m TopHat2 Pairs processed per second 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 72,318 418 1,666 49,495 21,123 69,984 35,694 1,9 71,538 3,5 17,381 61,223 69,39 55 19,579 44,79 65,126 96 5,115 33,6 61,787

More information

Multithreaded FPGA Acceleration of DNA Sequence Mapping

Multithreaded FPGA Acceleration of DNA Sequence Mapping Multithreaded FPGA Acceleration of DNA Sequence Mapping Edward B. Fernandez, Walid A. Najjar, Stefano Lonardi University of California Riverside Riverside, USA {efernand,najjar,lonardi}@cs.ucr.edu Jason

More information

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database.

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database. BLAST Basic Local Alignment Search Tool Used to quickly compare a protein or DNA sequence to a database. There is no such thing as a free lunch BLAST is fast and highly sensitive compared to competitors.

More information

Resequencing and Mapping. Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria

Resequencing and Mapping. Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria Resequencing and Mapping Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria The Principle of Mapping reads good, ood_, d_mo, morn, orni, ning, ing_, g_be, beau, auti, utif,

More information

Super-Fast Genome BWA-Bam-Sort on GLAD

Super-Fast Genome BWA-Bam-Sort on GLAD 1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted

More information

SEASHORE / SARUMAN. Short Read Matching using GPU Programming. Tobias Jakobi

SEASHORE / SARUMAN. Short Read Matching using GPU Programming. Tobias Jakobi SEASHORE SARUMAN Summary 1 / 24 SEASHORE / SARUMAN Short Read Matching using GPU Programming Tobias Jakobi Center for Biotechnology (CeBiTec) Bioinformatics Resource Facility (BRF) Bielefeld University

More information

Long Read RNA-seq Mapper

Long Read RNA-seq Mapper UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...

More information

Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs

Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs Masher: Mapping Long(er) Reads with Hash-based Genome Indexing on GPUs Anas Abu-Doleh Erik Saule Kamer Kaya Ümit V. Çatalyürek Dept. of Biomedical Informatics Dept. of Electrical and Computer Engineering

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

discosnp++ Reference-free detection of SNPs and small indels v2.2.2

discosnp++ Reference-free detection of SNPs and small indels v2.2.2 discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...

More information

INTRODUCING NVBIO: HIGH PERFORMANCE PRIMITIVES FOR COMPUTATIONAL GENOMICS. Jonathan Cohen, NVIDIA Nuno Subtil, NVIDIA Jacopo Pantaleoni, NVIDIA

INTRODUCING NVBIO: HIGH PERFORMANCE PRIMITIVES FOR COMPUTATIONAL GENOMICS. Jonathan Cohen, NVIDIA Nuno Subtil, NVIDIA Jacopo Pantaleoni, NVIDIA INTRODUCING NVBIO: HIGH PERFORMANCE PRIMITIVES FOR COMPUTATIONAL GENOMICS Jonathan Cohen, NVIDIA Nuno Subtil, NVIDIA Jacopo Pantaleoni, NVIDIA SEQUENCING AND MOORE S LAW Slide courtesy Illumina DRAM I/F

More information

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading: 24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid

More information

High-performance short sequence alignment with GPU acceleration

High-performance short sequence alignment with GPU acceleration Distrib Parallel Databases (2012) 30:385 399 DOI 10.1007/s10619-012-7099-x High-performance short sequence alignment with GPU acceleration Mian Lu Yuwei Tan Ge Bai Qiong Luo Published online: 10 August

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Gap Filling as Exact Path Length Problem

Gap Filling as Exact Path Length Problem Gap Filling as Exact Path Length Problem RECOMB 2015 Leena Salmela 1 Kristoffer Sahlin 2 Veli Mäkinen 1 Alexandru I. Tomescu 1 1 University of Helsinki 2 KTH Royal Institute of Technology April 12th, 2015

More information

Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz

Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low

More information

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing

Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation

More information

Read Mapping and Assembly

Read Mapping and Assembly Statistical Bioinformatics: Read Mapping and Assembly Stefan Seemann seemann@rth.dk University of Copenhagen April 9th 2019 Why sequencing? Why sequencing? Which organism does the sample comes from? Assembling

More information

Darwin-WGA. A Co-processor Provides Increased Sensitivity in Whole Genome Alignments with High Speedup

Darwin-WGA. A Co-processor Provides Increased Sensitivity in Whole Genome Alignments with High Speedup Darwin-WGA A Co-processor Provides Increased Sensitivity in Whole Genome Alignments with High Speedup Yatish Turakhia*, Sneha D. Goenka*, Prof. Gill Bejerano, Prof. William J. Dally * Equal contribution

More information