AgroMarker Finder manual (1.1)
|
|
- Camron Miller
- 5 years ago
- Views:
Transcription
1 AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is a GUI software for analyzing NGS data, such as RAD-seq and whole genome sequencing. It integrates sophisticated tools with self-developed algorithms that can help users finish data analysis with simple operation. It consists of five independent modules: Filter and Mapping, Bam Convert, SNP InDel Detection and Annotation, Somatic Detection and Variant Location. Depending upon different demands, both integrated functions and a separate feature are available, making the analysis procedure more efficient and flexible. Based on this software, large volumes of polymorphism data have been discovered and analyzed, which will be meaningful for further application, such as genetic mapping, genetic map construction, evolutionary studies and marker-assisted selection. Procedures for data analysis based on AMF are as follows:
2 2. Installation AMF should be built on Linux systems. It is written in Java. To run AMF, users should configure the environment and softwares first. Here are the softwares required: 1. JDK 1.7: html 2. BWA: 3. Bowtie 2: (optional) 4. SAMtools: 5. GATK: 6. Picard: Things to note: BWA, Bowtie 2 (if needed) and SAMtools must be installed on the Linux system path,such as /bin. And you must point out the path of GATK and Picard in SoftwareInfo file. 3. How to run? java jar AMF.jar 4. How to use? 4.1 Filter and Mapping Click button Open to load in the single-end fastq format files to a window on the left or paired-end fastq format files to two windows respectively. For paired-end file, the order of one side in the left-hand window must correspond to another side in the right-hand window. Filtering step and mapping step are independent Filter First, check box FilterReads and choose different parameters. Then, click button SaveTo to select the output file path. Finally, click button Run to start. TrimEndQuality: Raw sequence reads were continuously trimmed from both 3 end and 5 end based on Q value you set. Low quality bases with one base interval could also be recognized and removed. Reads Quality: There are four different standards. In strict standard, low quality reads showing 7 percent bases with Q<10 or 7 percent with Q<13 or 15 percent with Q<20, were discarded. In moderate standard, low quality reads showing 10 percent bases with Q<10 or 14 percent with Q<13 or 20 percent with Q<20, were discarded. In relax standard, low-quality reads showing 15 percent bases with Q < 10 or 20 percent bases with Q < 13, were discarded. If you don t want to filter the reads, you can choose NotFilter. Retain Bp: Only filtered reads up to this length will be retained.
3 LeftAdaptor: Remove the left adaptor sequence of each reads based on the sequence input. RightAdaptor: Remove the right adaptor sequence of each reads based on the sequence input. LowerCase Adaptor: Remove adaptor sequence in lowercase letters. QC Before Filter: Perform FastQC analysis for raw data. QC After Filter: Perform FastQC analysis after filtering. JustQC: Run FastQC analysis only Mapping First, check box Mapping and choose different parameters. Then, click button SaveTo to select the output file path. Finally, click Run to start. Mismatch: Number of mismatch is allowed within all hints. GapLength: Length of gap is allowed within all hints. Species: Species selected for mapping. Rice (Oryza sativa L.) genome information is already provided in AMF. Other species could be added manually: Download FASTA format genome sequence data and GTF file (part of GFF files are also compatible); Create a new folder in the species folder included in the genome folder and arrange the download files according to the existing cases; Fill in SpeciesFile file accordance with the format of the existing cases. NCBI Taxonomy number is suggested for the first column of SpeciesFile (not necessary). Thread: Set the number of threads. Library: Select SingleEnd,PairedEnd, MatePair or MatePairLong based on different sequencing methods. Other parameters of BWA (Burrows-Wheeler Alignment tool) are set by default. You can refer to BWA manual for detailed explanation.
4 4.2 Bam Convert First, click button Open Sam/Bam File to load in Sam or Bam format files. Then, select the needed items. Finally, click ConvertSam to start. If the input file is in Sam format, it will be directly converted to Bam format first. MergeByPrefix: Merge sam or bam files with the same prefix. FilterMultipleMappedReads: Remove multiple mapped reads. If the value of NH or IH flag >1, these reads will be considered as multiple mapped reads. If the bwa-aln tag is XT:R, these reads will be regarded as multiple mapped reads. VCF To Help Recalibrate: Check box Recalibrate Need DBsnpVcf, then input the VCF format file to recalibrate false positive SNPs. Detailed description of each boxes could refer to SAMtools manual or GATK manual. Note: To perform FilterMultipleMappedReads function, user must use the BWA or Bowtie 2 in AMF.
5 4.3 SNP InDel Detection and Annotation Snp/InDel Calling First, click button AddFile to load in pileup format files. Then, set filtering parameter. Finally, click button Run to start. By default, software identifies mutant site with parameters covered by at least 3 reads containing more than 2 mutant reads (different with reference genome), and mutant ratio should exceed 20%. Hetero SNP Reads Prop Level: Input parameter to further filter mutant sites. For example, if you set 0.3. It means more than 30% mutant ratio is necessary to determine the mutant site. Things to note: If the number input is greater than default, the default value will be ignored. Result format: 1. chromosome 2. genome coordinate 3. reference allele 4. alternate allele 5. number of reads showing reference genotype 6. number of reads showing mutant genotype
6 Each columns are split by Tab separator Snp/InDel annotation First, click button AddSnpFile to load in SNP information files in TXT format which should containin four columns respectively recording chromosomes, coordinates, reference alleles and alternate alleles information. Then, select parameters. Finally, click Run button to start. Note: The first line is the default title bar. Col ChrID: Input column number records chromosome. Col SNP Start Site: Input column number records coordinate of alternate allele. Col RefNr: Input column number records reference allele. Col ThisNr: Input column number records alternate allele. Result format: 1. chromosome 2. genome coordinate 3. reference allele 4. alternate allele 5. number of reads showing reference genotype 6. number of reads showing mutant genotype
7 7. Loc number of the gene containing the mutation 8. The location of the mutation on the gene 9. The proportion of the distance of mutation site to the start site of the gene and the length of the gene 10. Normal codon 11. Normal amino acid 12. Mutant codon 13. Mutant amino acid 14. Where does the change of amino acid occur 15. Distance to splice site 16. Changes of physical and chemical properties 4.4 Somatic Detection First, click button OpenSNP to load in SNP format files of two samples generated by Snp/InDel Calling function and click OpenPileUp to load in pileup format files of two samples. Orders need to be kept in same. Then, select parameters and click button SaveTo to select the output file path. Finally, click Run button to start. Species: Select species information. HeteroSNPPropLevel: Input parameter to determine mutant sites as mentioned above. Compare: For control group, sites covered by at least 10 reads, including less than 2 mutant reads (bases different with control group) and less than 4% SNP ratio are kept. For treat group, mutant sites should be covered by at least 3 reads containing
8 more than 2 mutant reads (bases different with reference genome), and mutant ratio should exceed 20%. AMF will record polymorphisms by comparing mutant sites kept in Treat group to Conrol group. Result format: 1. chromosome 2. genome coordinate 3. reference allele 4. alternate allele 5. total number of reads covers this position of sample A 6. number of reads shows mutant genotype of sample A 7. total number of reads covers this position of sample B 9. number of reads shows mutant genotype of sample B 4.5 Variant Location First, click button OpenFile to load in file split by Tab separator recording chromosome and coordinate information. Then, select parameters and click button Run. Finally, click button Save to select the output file path. Note: The first line is the default title bar. PeakRange: Locate the region of mutations. To locate SNPs, you should not check this box. ChrIDColumn: Input column number recording chromosome information.
9 PeakMiddleColumn: Input column number recording the coordinate of the middle site of mutation. PeakEnd Column: Input column number recording the coordinate of the last site of mutation. TSS: Transcription start site (TSS). TTS: Transcription terminate site (TTS). Up: Upstream region from TSS or TTS. - (Minus) must add before the number. Down: Downstream region from TSS or TTS. 5. Java program for calculating of restriction enzyme sites (TaqαI). public class restrictionsite { static long readbpnum = 0; static Set<Long> setpositions = new LinkedHashSet<Long>(); static Pattern pattern = Pattern.compile("TCGA AGCT", Pattern.CASE_INSENSITIVE); public static void main(string[] args) throws IOException { FileReader freader = new FileReader( "/Desktop/Tigr7/chrAll.txt"); BufferedReader breader = new BufferedReader(fReader); FileWriter fwriter = new FileWriter(
10 "/Desktop/ricedigestionnum.txt"); BufferedWriter bwriter = new BufferedWriter(fWriter); String readstring = ""; List<String> lscombineseq = new LinkedList<String>(); String chrid = ""; int posnum = 0; while ((readstring = breader.readline())!= null) { if (readstring.contains(">")) { if (!chrid.equals("")) { for (Long pos : setpositions) { bwriter.write(chrid + "\t" + pos + "\t" + (pos + 3) + "\n"); posnum += setpositions.size(); setpositions.clear(); chrid = readstring.replace(">", ""); readbpnum = 0; lscombineseq.clear(); continue; lscombineseq.add(readstring); if (lscombineseq.size() == 1) { continue; String linkstring = lscombineseq.get(0) + lscombineseq.get(1); List<Long> lspos = Statistic(linkString, readbpnum); lscombineseq.remove(0); readbpnum += 0.5 * linkstring.length(); setpositions.addall(lspos); for (Long pos : setpositions) { bwriter.write(chrid + "\t" + pos + "\t" + (pos + 3) + "\n"); posnum += setpositions.size(); System.out.println(posnum); breader.close(); bwriter.close(); freader.close(); fwriter.close(); public static ArrayList<Long> Statistic(String linkstring, long readbpnumbefore) {
11 ArrayList<Long> posllist = new ArrayList<Long>(); Matcher mat = pattern.matcher(linkstring); while (mat.find()) { posllist.add(readbpnumbefore + mat.start() + 1); return posllist;
Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationFalcon Accelerated Genomics Data Analysis Solutions. User Guide
Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software
More informationTumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual
Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationData Walkthrough: Background
Data Walkthrough: Background File Types FASTA Files FASTA files are text-based representations of genetic information. They can contain nucleotide or amino acid sequences. For this activity, students will
More informationReads Alignment and Variant Calling
Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department
More informationTutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017
Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationSNP Calling. Tuesday 4/21/15
SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationDemultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationBaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationLab 5: Java IO 12:00 PM, Feb 21, 2018
CS18 Integrated Introduction to Computer Science Fisler, Nelson Contents Lab 5: Java IO 12:00 PM, Feb 21, 2018 1 The Java IO Library 1 2 Program Arguments 2 3 Readers, Writers, and Buffers 2 3.1 Buffering
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationAnalysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationGenomics. Nolan C. Kane
Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment
More informationNGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea
NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama
More informationIntro to NGS Tutorial
Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................
More informationRNA- SeQC Documentation
RNA- SeQC Documentation Description: Author: Calculates metrics on aligned RNA-seq data. David S. DeLuca (Broad Institute), gp-help@broadinstitute.org Summary This module calculates standard RNA-seq related
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationQIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
More informationPractical exercises Day 2. Variant Calling
Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant
More informationWeb page:
mirdeep* manual 2013-01-10 Jiyuan An, John Lai, Melanie Lehman, Colleen Nelson: Australian Prostate Cancer Research Center (APCRC-Q) and Institute of Health and Biomedical Innovation (IHBI), Queensland
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationm6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationCalling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationMPG NGS workshop I: Quality assessment of SNP calls
MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationv0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationRPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.
Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationNGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationRead mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationIntroduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
More informationAnalysing re-sequencing samples. Malin Larsson WABI / SciLifeLab
Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!
More informationAnalyzing massive genomics datasets using Databricks Frank Austin Nothaft,
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT
More informationResequencing and Mapping. Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria
Resequencing and Mapping Andreas Gisel Inernational Institute of Tropical Agriculture (IITA) Ibadan, Nigeria The Principle of Mapping reads good, ood_, d_mo, morn, orni, ning, ing_, g_be, beau, auti, utif,
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationMinimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis
More informationInput files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:
Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq
More informationClick on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:
CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationRead Mapping and Variant Calling
Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within
More informationAccurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing
Proposal for diploma thesis Accurate Long-Read Alignment using Similarity Based Multiple Pattern Alignment and Prefix Tree Indexing Astrid Rheinländer 01-09-2010 Supervisor: Prof. Dr. Ulf Leser Motivation
More informationAtlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationTutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz
Tutorial: Using BWA aligner to identify low-coverage genomes in metagenome sample Umer Zeeshan Ijaz We will use NexteraXT_even_1ng_HISEQ_AGGCAGAA-CTCTCTAT dataset to identify the list of genomes with low
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More information