Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Size: px
Start display at page:

Download "Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline"

Transcription

1 Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1, Maeve O Huallachain 1, Mark B. Gerstein 2,3,4, Jeffrey M. Kidd 1, Carlos D. Bustamante 1 and Michael Snyder 1 1. Department of Genetics, Stanford University, Stanford, California, USA 2. Program in Computational Biology and Bioinformatics, Yale University, New Haven, Connecticut, USA, 3. Department of Molecular Biophysics and Biochemistry, Yale University, New Haven, Connecticut, USA 4. Department of Computer Science, Yale University, New Haven, Connecticut, USA # Present address: Personalis, Inc., Palo Alto, California, USA

2 Table of Contents METHODS 3 COMPUTATIONAL PIPELINE 3 SEQUENCE ALIGNMENT 3 SNP AND INDEL DETECTION 3 SV AND CNV DETECTION 3 FUNCTIONAL ANNOTATION 4 GENOME SEQUENCING 4 BENCHMARKING 4 SENSITIVITY TEST 4 TABLES 5 TABLE S1 5 TABLE S2 5 FIGURES 6 FIGURE S1 6 FIGURE S2 7 FIGURE S3 8 2

3 Methods Computational pipeline HugeSeq is implemented in the Python programming language and bash shell scripts. It was designed to run on Unix- based system and was tested on the Red Hat Enterprise Linux (RHEL) server v5.6. It uses the Modules package to provide dynamic modification (e.g. changing the path and version of Python) of a user's environment via module files. Its MapReduce approach was implemented mainly based on a custom Simple Job Management framework, SJM, which currently supports Sun Grid Engine but can be easily extended to support other batch systems such as PBS. Each step in the pipeline was implemented in a separate shell script and the job description file generated for SJM is in a human- readable format. Sequence alignment BWA version was used for sequence alignment against the human reference genome HG19. Illumina s quality score was converted into Sanger s quality score by BWA. The multithreading option was enabled with two concurrent threads for generating the SA coordinates in mapping. The original alignment output, which was in a SAM format, was converted into BAM using SAMtools version Sorting of the BAMs was done by the Picard tool ( version 1.32 and binning the BAMs by chromosome was performed using SAMtools. Picard was used to remove duplicates in alignments, whereas GATK version was used for local realignment and base quality recalibration. SNP and Indel detection The UnifiedGenotyper in GATK version was used for SNP and indel detection with call confidence set to 30.0 and emit confidence set to Dindel model was enabled in indel calling. Filter label was applied using the VariantFiltration program in GATK for allele balance (AB) greater than 0.75, quality score (QUAL) less than 50.0, depth of coverage (DP) greater than 360, strand bias (SB) greater than or mapping- quality zero reads (MQ0) greater than or equal to 4. The mpileup function in SAMtools/BCFtools version was also used for SNP and indel detection. The generated VCFs were concatenated and merged using VCFtools version and indexed using Tabix version SV and CNV detection BreakDancer version 1.1 was used for paired- end mapping. Pindel version was used for split- read analysis. Calls from BreakDancer were used in Pindel to increase sensitivity and specificity. CNVnator version was used for read- depth analysis. BreakSeq Lite version 1.0 was used for junction mapping. Only SV and CNV calls greater than or equal to 50bp were selected for final output. Outputs from different 3

4 callers were converted into GFF using custom scripts and merged using BEDtools version Functional annotation ANNOVAR version was used for functional annotation of variants. The UCSC known genes and repeat masker databases were used for gene and repeat annotations respectively. SIFT scores were based on the SIFT database. SNP annotation was based on dbsnp version 132. Genome sequencing Peripheral Blood Mononuclear Cells (PBMCs) were isolated from whole blood sample of an individual by density gradient centrifugation at 400 x g for 25 minutes using the Lymphocyte Separation Media (MP Biomedicals). 20 ml of saliva sample was also collected from the same individual and processed immediately. DNA was isolated from both blood and saliva using the AllPrep DNA/RNA/Protein Mini Kit (QIAGEN). Paired- end sequencing was performed using Illumina HiSeq 2000 with an average read length of 101bp. Benchmarking Benchmarking was performed at sequencing coverage 6X, 12X, 24X, 48X and 96X with sequenced reads randomly selected from both the blood and saliva sequencing data. The pipeline was installed and executed in a computer cluster at the Stanford Center for Genomics and Personalized Medicine. There were 48 Intel Xeon 3.00GHz CPU cores assigned for the performance test and up to 12GB of physical memory allocated for each computer job. The reads were divided into subsets each has about 6X sequencing coverage and was aligned independently. The processing time and memory usage for each job were recorded by SJM. The non- parallel processing time was estimated by the individual run time of the parallel jobs in the pipeline. Sensitivity test Illumina s HumanOmni1- Quad genotyping array with 1M markers was used on the blood sample of the sequenced individual. SNP calls were generated by the Illumina GenomeStudio version CNV calls were generated by the CNVPartition module version of GenomeStudio and by CNVision version 1.0 requiring two or more algorithms. Heterozygous SNP calls and CNV deletion calls were selected for testing the sensitivity of SNP and CNV detection of the pipeline, respectively. 4

5 Tables Table S1 Comparison of various platforms for genome data analysis. Alignment SNP Calling Indel Calling SV Calling Availability Data Size Limit License Functional Annotation HugeSeq yes yes yes yes downloadable no SOAP yes yes yes yes downloadable no GATK partial yes yes no downloadable no public; open- source public; open- source public; open- source yes no yes Galaxy yes yes yes no web- based; downloadable yes in online version public; open- source yes GenePattern no no no no web- based; downloadable yes in online version public yes GenomeQuest yes yes yes no web- based; downloadable N.A. commercial yes DNA Nexus yes yes yes no web- based N.A. commercial yes Table S2 Breakdown of SV events of the detected SVs. SV Event All Merged Concordant Deletion 24,024 19,809 1,594 Duplication 1,077 1,077 0 Insertion Inversion Total 25,698 21,381 1,639 5

6 Figures Figure S1 Variant size distribution. a) Indel size distribution of the merged call set. b) Indel size distribution of the high- confidence call set. c) SV deletion size distribution of the merged call set. d) SV deletion size distribution of the high- confidence call set. The blue line indicates the typical size of an L1 element whereas the red line indicates that of an Alu element. 6

7 Figure S2 Benchmark of the overall performance of HugeSeq. a) Run time of different processes at different sequencing coverage in a non- parallel computation mode. b) Run time of HugeSeq for different processes at different sequencing coverage. c) Comparing the overall run time of a non- parallel computation mode and HugeSeq. d) Memory usage of different processes. 7

8 Figure S3 Benchmark of the variant detection performance of HugeSeq. a) Run time of different variant detection processes at different sequencing coverage in a non- parallel computation mode. b) Run time of HugeSeq for different variant detection processes at different sequencing coverage. c) Comparing the overall run time of variant detection between a non- parallel computation mode and HugeSeq. d) Memory usage of different variant detection processes. 8

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

Practical exercises Day 2. Variant Calling

Practical exercises Day 2. Variant Calling Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

SNP Calling. Tuesday 4/21/15

SNP Calling. Tuesday 4/21/15 SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Halvade: scalable sequence analysis with MapReduce

Halvade: scalable sequence analysis with MapReduce Bioinformatics Advance Access published March 26, 2015 Halvade: scalable sequence analysis with MapReduce Dries Decap 1,5, Joke Reumers 2,5, Charlotte Herzeel 3,5, Pascal Costanza, 4,5 and Jan Fostier

More information

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

Falcon Accelerated Genomics Data Analysis Solutions. User Guide

Falcon Accelerated Genomics Data Analysis Solutions. User Guide Falcon Accelerated Genomics Data Analysis Solutions User Guide Falcon Computing Solutions, Inc. Version 1.0 3/30/2018 Table of Contents Introduction... 3 System Requirements and Installation... 4 Software

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Reads Alignment and Variant Calling

Reads Alignment and Variant Calling Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7

3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7 Cpipe User Guide 1. Introduction - What is Cpipe?... 3 2. Design Background... 3 2.1. Analysis Pipeline Implementation (Cpipe)... 4 2.2. Use of a Bioinformatics Pipeline Toolkit (Bpipe)... 4 2.3. Individual

More information

Super-Fast Genome BWA-Bam-Sort on GLAD

Super-Fast Genome BWA-Bam-Sort on GLAD 1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted

More information

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts. Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 USA SAN FRANCISCO USA ORLANDO BELGIUM - HQ LEUVEN THE NETHERLANDS EINDHOVEN

More information

Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual

Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Tumor-Specific NeoAntigen Detector (TSNAD) v2.0 User s Manual Zhan Zhou, Xingzheng Lyu and Jingcheng Wu Zhejiang University, CHINA March, 2016 USER'S MANUAL TABLE OF CONTENTS 1 GETTING STARTED... 1 1.1

More information

CORE Year 1 Whole Genome Sequencing Final Data Format Requirements

CORE Year 1 Whole Genome Sequencing Final Data Format Requirements CORE Year 1 Whole Genome Sequencing Final Data Format Requirements To all incumbent contractors of CORE year 1 WGS contracts, the following acts as the agreed to sample parameters issued by NHLBI for data

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT

More information

Kelly et al. Genome Biology (2015) 16:6 DOI /s x. * Correspondence:

Kelly et al. Genome Biology (2015) 16:6 DOI /s x. * Correspondence: Kelly et al. Genome Biology (215) 16:6 DOI 1.1186/s1359-14-577-x METHOD Open Access Churchill: an ultra-fast, deterministic, highly scalable and balanced parallelization strategy for the discovery of human

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS

More information

Local Run Manager Resequencing Analysis Module Workflow Guide

Local Run Manager Resequencing Analysis Module Workflow Guide Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

Sentieon Documentation

Sentieon Documentation Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................

More information

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab

Analysing re-sequencing samples. Malin Larsson WABI / SciLifeLab Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!

More information

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o

More information

Processing Genomics Data: High Performance Computing meets Big Data. Jan Fostier

Processing Genomics Data: High Performance Computing meets Big Data. Jan Fostier Processing Genomics Data: High Performance Computing meets Big Data Jan Fostier Traditional HPC way of doing things Communication network (Infiniband) Lots of communication c c c c c Lots of computations

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Toward High Utilization of Heterogeneous Computing Resources in SNP Detection

Toward High Utilization of Heterogeneous Computing Resources in SNP Detection Toward High Utilization of Heterogeneous Computing Resources in SNP Detection Myungeun Lim, Minho Kim, Ho-Youl Jung, Dae-Hee Kim, Jae-Hun Choi, Wan Choi, and Kyu-Chul Lee As the amount of re-sequencing

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

Tutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017

Tutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017 Identification of Variants Using GATK November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Tutorial. Identification of Variants in a Tumor Sample. Sample to Insight. November 21, 2017

Tutorial. Identification of Variants in a Tumor Sample. Sample to Insight. November 21, 2017 Identification of Variants in a Tumor Sample November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Copy Number Variations Detection - TD. Using Sequenza under Galaxy

Copy Number Variations Detection - TD. Using Sequenza under Galaxy Copy Number Variations Detection - TD Using Sequenza under Galaxy I. Data loading We will analyze the copy number variations of a human tumor (parotid gland carcinoma), limited to the chr17, from a WES

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT

More information

Click on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:

Click on + button Select your VCF data files (see #Input Formats->1 above) Remove file from files list: CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Bioinformatics Framework

Bioinformatics Framework Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Using Galaxy to provide a NGS Analysis Platform

Using Galaxy to provide a NGS Analysis Platform 11/15/11 Using Galaxy to provide a NGS Analysis Platform Friedrich Miescher Institute - part of the Novartis Research Foundation - affiliated institute of Basel University - member of Swiss Institute of

More information

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015 freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Assignment 7: Single-cell genomics. Bio /02/2018

Assignment 7: Single-cell genomics. Bio /02/2018 Assignment 7: Single-cell genomics Bio5488 03/02/2018 Assignment 7: Single-cell genomics Input Genotypes called from several exome-sequencing datasets derived from either bulk or small pools of cells (VCF

More information

Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture

Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture Da Zhang Collaborators: Hao Wang, Kaixi Hou, Jing Zhang Advisor: Wu-chun Feng Evolution of Genome Sequencing1 In 20032: 1 human genome

More information

Local Run Manager Amplicon Analysis Module Workflow Guide

Local Run Manager Amplicon Analysis Module Workflow Guide Local Run Manager Amplicon Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 9 Analysis Report

More information

Isaac Enrichment v2.0 App

Isaac Enrichment v2.0 App Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure

DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure TM DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure About DRAGEN Edico Genome s DRAGEN TM (Dynamic Read Analysis for GENomics) Bio-IT Platform provides ultra-rapid secondary analysis of

More information

Sep. Guide. Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037

Sep. Guide.  Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Sep 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Corp. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

arxiv: v2 [q-bio.gn] 13 May 2014

arxiv: v2 [q-bio.gn] 13 May 2014 BIOINFORMATICS Vol. 00 no. 00 2005 Pages 1 2 Fast and accurate alignment of long bisulfite-seq reads Brent S. Pedersen 1,, Kenneth Eyring 1, Subhajyoti De 1,2, Ivana V. Yang 1 and David A. Schwartz 1 1

More information

MiSeq Reporter TruSight Tumor 15 Workflow Guide

MiSeq Reporter TruSight Tumor 15 Workflow Guide MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Variant Calling and Filtering for SNPs

Variant Calling and Filtering for SNPs Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp

More information

Aeromancer: A Workflow Manager for Large- Scale MapReduce-Based Scientific Workflows

Aeromancer: A Workflow Manager for Large- Scale MapReduce-Based Scientific Workflows Aeromancer: A Workflow Manager for Large- Scale MapReduce-Based Scientific Workflows Presented by Sarunya Pumma Supervisors: Dr. Wu-chun Feng, Dr. Mark Gardner, and Dr. Hao Wang synergy.cs.vt.edu Outline

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

QIAseq DNA V3 Panel Analysis Plugin USER MANUAL

QIAseq DNA V3 Panel Analysis Plugin USER MANUAL QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus

More information

Axiom Analysis Suite Release Notes (For research use only. Not for use in diagnostic procedures.)

Axiom Analysis Suite Release Notes (For research use only. Not for use in diagnostic procedures.) Axiom Analysis Suite 4.0.1 Release Notes (For research use only. Not for use in diagnostic procedures.) Axiom Analysis Suite 4.0.1 includes the following changes/updates: 1. For library packages that support

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

ChIP-Seq Tutorial on Galaxy

ChIP-Seq Tutorial on Galaxy 1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

Accelrys Pipeline Pilot and HP ProLiant servers

Accelrys Pipeline Pilot and HP ProLiant servers Accelrys Pipeline Pilot and HP ProLiant servers A performance overview Technical white paper Table of contents Introduction... 2 Accelrys Pipeline Pilot benchmarks on HP ProLiant servers... 2 NGS Collection

More information

Practical Linux Examples

Practical Linux Examples Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf

More information

Tutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017

Tutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017 Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com

More information

CircosVCF workshop, TAU, 9/11/2017

CircosVCF workshop, TAU, 9/11/2017 CircosVCF exercise In this exercise, we will create and design circos plots using CircosVCF. We will use vcf files of a published case "X-linked elliptocytosis with impaired growth is related to mutated

More information

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality

More information

Mar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037

Mar. Guide.  Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated

More information

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

On enhancing variation detection through pan-genome indexing

On enhancing variation detection through pan-genome indexing Standard approach...t......t......t......acgatgctagtgcatgt......t......t......t... reference genome Variation graph reference SNP: A->T...ACGATGCTTGTGCATGT donor genome Can we boost variation detection

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

GenomeStudio Software Release Notes

GenomeStudio Software Release Notes GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation

More information

called Hadoop Distribution file System (HDFS). HDFS is designed to run on clusters of commodity hardware and is capable of handling large files. A fil

called Hadoop Distribution file System (HDFS). HDFS is designed to run on clusters of commodity hardware and is capable of handling large files. A fil Parallel Genome-Wide Analysis With Central And Graphic Processing Units Muhamad Fitra Kacamarga mkacamarga@binus.edu James W. Baurley baurley@binus.edu Bens Pardamean bpardamean@binus.edu Abstract The

More information

MiSeq Reporter Amplicon DS Workflow Guide

MiSeq Reporter Amplicon DS Workflow Guide MiSeq Reporter Amplicon DS Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 Amplicon DS Workflow Overview 4 Optional Settings for the Amplicon DS Workflow 7 Analysis

More information

Configuring the Pipeline Docker Container

Configuring the Pipeline Docker Container WES / WGS Pipeline Documentation This documentation is designed to allow you to set up and run the WES/WGS pipeline either on your own computer (instructions assume a Linux host) or on a Google Compute

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux User's Guide to DNASTAR SeqMan NGen 12.0 For Windows, Macintosh and Linux DNASTAR, Inc. 2014 Contents SeqMan NGen Overview...7 Wizard Navigation...8 Non-English Keyboards...8 Before You Begin...9 The

More information

ADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD

ADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial

More information

Genetics 211 Genomics Winter 2014 Problem Set 4

Genetics 211 Genomics Winter 2014 Problem Set 4 Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential

More information