SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
|
|
- Merry Long
- 5 years ago
- Views:
Transcription
1 SAMtools SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS
2 Program: samtools (Tools for alignments in the SAM format) Version: Usage: samtools <command> [options] Command: view SAM<->BAM conversion sort sort alignment file mpileup multi-way pileup depth compute the depth faidx index/extract FASTA tview text alignment viewer index index alignment idxstats BAM index stats fixmate fix mate information flagstat simple stats calmd recalculate MD/NM tags and '=' bases merge merge sorted alignments rmdup remove PCR duplicates reheader replace BAM header cat concatenate BAMs bedcov read depth per BED region targetcut cut fosmid regions (for fosmid pool only) phase phase heterozygotes bamshuf shuffle and group alignments by name samtools view Usage: samtools view [options] <in.bam> <in.sam> [region1 [...]] Options: -b output BAM -h print header for the SAM output -H print header only (no alignments) -S input is SAM -u uncompressed BAM output (force -b) -x output FLAG in HEX (samtools-c specific) -X output FLAG in string (samtools-c specific) -c print only the count of matching records -t FILE list of reference names and lengths (force -S) [null] -T FILE reference sequence file (force -S) [null] -o FILE output file name [stdout] -R FILE list of read groups to be outputted [null] -f INT required flag, 0 for unset [0] -F INT filtering flag, 0 for unset [0] -q INT minimum mapping quality [0] -l STR only output reads in library STR [null] -r STR only output reads in read group STR [null] -? longer help
3 Q1. less ex1.sam Q2. less ex1.bam Q3. samtools Q4. samtools view samtools view Q5. samtools view ex1.bam Q6. samtools view ex1.sam bam ex1_myself.bam ex1.bam Q7. ls *Q8. samtools view -f ex1_myself.bam BAM index BAM BAM
4 Q1. samtools index samtools index Q2. ex1_myself.bam index index sort bam Q3. ex1_myself.bam sort samtools Q4. Q2 sort bam index *Q5. gn:buc > samtools view file_sorted.bam gn:buc: sam 2 Yes/No 1/ = 83 Read2 1 seq read 2 3 read Read1 2 7 Read2 : Read1 83 map
5 ref Read2 Read1 read Read1 Read *Q6.
6 flagstat, depth flagstat: Collect some statistics about alignment $ samtools flagstat NA12878.chr16p.bam in total (QC-passed reads + QC-failed reads) duplicates mapped (96.52%:nan%) paired in sequencing read read properly paired (83.33%:nan%) with itself and mate mapped singletons (4.11%:nan%) with mate mapped to a different chr with mate mapped to a different chr (mapq>=5) depth: compute the depth 1 coverage (depth) $ samtools depth NA12878.chr16p.bam head Q1. samtools flagstat depth ex1_myself.sort.bam Q2. ex1_myself.bam flagstat Q3. ex1_myself.bam depth
7 mpileup Usage: samtools mpileup [options] in1.bam [in2.bam [...]] Input options: -6 assume the quality is in the Illumina-1.3+ encoding -A count anomalous read pairs -B disable BAQ computation -b FILE list of input BAM files [null] -C INT parameter for adjusting mapq; 0 to disable [0] -d INT max per-bam depth to avoid excessive memory usage [250] -E extended BAQ for higher sensitivity but lower specificity -f FILE faidx indexed reference sequence file [null] -G FILE exclude read groups listed in FILE [null] -l FILE list of positions (chr pos) or regions (BED) [null] -M INT cap mapping quality at INT [60] -r STR region in which pileup is generated [null] -R ignore RG tags -q INT skip alignments with mapq smaller than INT [0] -Q INT skip bases with baseq/baq smaller than INT [13] Output options: -D output per-sample DP in BCF (require -g/-u) -g generate BCF output (genotype likelihoods) -O output base positions on reads (disabled by -g/-u) -s output mapping quality (disabled by -g/-u) -S output per-sample strand bias P-value in BCF (require -g/-u) -u generate uncompress BCF output SNP/INDEL genotype likelihoods options (effective with `-g' or `-u'): -e INT Phred-scaled gap extension seq error probability [20] -F FLOAT minimum fraction of gapped reads for candidates [0.002] -h INT coefficient for homopolymer errors [100] -I do not perform indel calling -L INT max per-sample depth for INDEL calling [250] -m INT minimum gapped reads for indel candidates [1] -o INT Phred-scaled gap open sequencing error probability [40] -P STR comma separated list of platforms for indels [all] Notes: Assuming diploid individuals. > samtools mpileup ex1_myself.bam gn:buc N 32 t$t$tttttttttttttttttttttttttttttt HHEHFGIDHFCH?15HHHGHIH gn:buc N 30 tttttttttttttttttttttttttttttt EHHFG@HGDHF)BHHHHHGHDHEHHHHHEG gn:buc N 30 tttttttttttttttttttttttttttttt DHGGGBH?DHF1CHHHFHGHGHFHHHHGEF gn:buc N 30 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa EHFCFBHFDHD;5FHHGHEHDF?HHHHGDF gn:buc N 30 tttttttttttttttttttttttttttttt 6HDG=BHFDCE+;BHBFH?H?FFHGHHHEB gn:buc N 30 cccccccccccccccccccccccccccccc GGFEG8HGGHH,;HHHFHGHEGEHGHHHFH gn:buc N 30 cccccccccccccccccccccacccccccc EHEEH8HHGEE0/HDHFHDHA?FHHHHHGH gn:buc N 30 c$ccccccccccccccccccccccccccccc EHGEH<HGFHHA=HHHCHDF<FFHHHHHEH gn:buc N 29 ccccccccccccccccccccccccccccc HFCH<HFFGHCEHGHGHCHAHFHHHHH@H gn:buc N 29 t$tttttttttttttttttttttttttttt HHEE5HDEEFFEHHHFHFHF?DHHHGHFH gn:buc N 28 CCccCCCcccccCCCCcCCcCccCCCcc HFH5H?EHHG;HHHEHGHFF?HHHHHBH gn:buc N 28 CCccCCCcccccCCCCcCCcCccCCCcc HEH<HEEHHAEHHHGHGHGHEHHHHHGH gn:buc N 28 AAaaAAAaaaaaAAAAaAAaAaaAAAaa HEH5G<DHHDFHGGGGGHFHCGHHHHEH gn:buc N 28 A$AaaAAAaaaaaAAAAaAAaAaaAAAaa EBH:HEEGHDBHHHHHGHFHFHHHHHGH gn:buc N 27 T$ttTTTtttttTTTTtTTtTttTTTtt <H>HEEHF4EHHHHHHFGHFHHHHHFH
8 Q1. buc.genome.fasta mpileup Q2. index samtools faidx fasta index Q1 index gn:buc A 28,$,..,,.,.,,...,..,..,., AHHBHHHHHHEHHHDHHHDFHHHHHE<C gn:buc G 27,..,,.,.,,...,..,..,., HHEGHHHHHEHHHGFHDEFHGGHHE8< gn:buc A 28,..,,.,.,,...,..,..,.,^K, HHEHHHHHH>HHHHHHGCEHHHHH@<<< gn:buc A 28,..,,.,.,,...,..,..,.,, HG6HHHHHH:HHHHHHHDFHHGHHE>C= gn:buc A 28,..,,.,.,,...,..,..,.,, HEEGHHHHH@HHHEHHHDEHHGHGE6@> gn:buc A 29,..,,.,.,,...,..,..,.,,^K. HHEHHHHHH*HHHGHHHDFHHGDGE7/>8 gn:buc A 29,..,,.,.,,...,..,..,.,,. HEEHHHHHH@HHHEHHHD?HHGEH<6??8 gn:buc A 29,..,,.,.,,...,..,..,.,,. FHEFHHHGH8HHGHGHHDDEHFDH70CA9 gn:buc G 29 ccccccccccccccccccccccccccccc HFEHHHHHHEHHHHHHHCDEHBEH@;DB; gn:buc A 29,..,,.,.,,...,..,..,.,,. mpileup -> bcftools SAMtools BCFtools variant caller mpileup BCFtools variant vcf )
9 Q1. ex1_myself.bam vcf Q2. less vcf SAMtools tview text alignment viewer viewer fixmate fix mate information merge merge sorted alignments BAM merge rmdup remove PCR duplicates PCR duplicate
10 Q1. ex1_myself.sort.bam rmdup SAMtools SAMtools NGS NGS
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationManual Reference Pages samtools (1)
Manual Reference Pages samtools (1) NAME CONTENTS SYNOPSIS samtools Utilities for the Sequence Alignment/Map (SAM) format bcftools Utilities for the Binary Call Format (BCF) and VCF Synopsis Description
More informationPractical exercises Day 2. Variant Calling
Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationCalling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationMapping and Viewing Deep Sequencing Data bowtie2, samtools, igv
Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013
More informationTutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan
Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationRead Mapping and Variant Calling
Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationThe SAM Format Specification (v1.3 draft)
The SAM Format Specification (v1.3 draft) The SAM Format Specification Working Group July 15, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationThe SAM Format Specification (v1.3-r837)
The SAM Format Specification (v1.3-r837) The SAM Format Specification Working Group November 18, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationfreebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015
freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationSequence Alignment. GS , Introduc8on to Bioinforma8cs The University of Texas GSBS program, Fall 2013
Sequence Alignment GS 011143, Introduc8on to Bioinforma8cs The University of Texas GSBS program, Fall 2013 Ken Chen, Ph.D. Department of Bioinforma8cs and Computa8onal Biology UT MD Anderson Cancer Center
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationAtlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationIntroduction to Linux & UPPMAX
Uppsala University Introduction to Linux & UPPMAX Martin Dahlö martin.dahlo@scilifelab.uu.se Marcus Holm marcus.holm@it.uu.se August 8, 2017 Contents 1 Linux Introduction........................ 1 1.1
More informationVariant Calling and Filtering for SNPs
Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationSNP Calling. Tuesday 4/21/15
SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity
More informationInput files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:
Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq
More informationv0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationFrom fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /
From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1
More informationv0.3.2 March 29, 2017
March 29, 2017 v0.3.2 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP3.1 positions.
More informationv0.3.0 May 18, 2016 SNPsplit operates in two stages:
May 18, 2016 v0.3.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationBioinformatica e analisi dei genomi
Bioinformatica e analisi dei genomi Anno 2016/2017 Pierpaolo Maisano Delser mail: maisanop@tcd.ie Background Laurea Triennale: Scienze Biologiche, Universita degli Studi di Ferrara, Dr. Silvia Fuselli;
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationQIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationMar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationPRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS
More informationNGS Analyses with Galaxy
1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationAnalysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationelprep: a high- performance tool for preparing SAM/BAM files for variant calling Charlo<e Herzeel (Imec) Pascal Costanza (Intel) July 2014
elprep: a high- performance tool for preparing SAM/BAM files for variant calling Charlo
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationCycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)
Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload
More informationIsaac Enrichment v2.0 App
Isaac Enrichment v2.0 App Introduction 3 Running Isaac Enrichment v2.0 5 Isaac Enrichment v2.0 Output 7 Isaac Enrichment v2.0 Methods 31 Technical Assistance ILLUMINA PROPRIETARY 15050960 Rev. C December
More informationThe SAM Format Specification (v1.4-r956)
The SAM Format Specification (v1.4-r956) The SAM Format Specification Working Group April 12, 2011 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited text
More informationNGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea
NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationMapping. Reference. read
Mapping Reference read Assembly vs mapping contig1 contig2 reads bly as s em ll v sa all ma pp all ing vs r efe ren ce Reference What s the problem? Reads differ from the genome due to evolution and sequencing
More informationEpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationLASER: Locating Ancestry from SEquence Reads version 2.04
LASER: Locating Ancestry from SEquence Reads version 2.04 Chaolong Wang 1 Computational and Systems Biology Genome Institute of Singapore A*STAR, Singapore 138672, Singapore Xiaowei Zhan 2 Department of
More informationmerged_bam => $merged_bam, picard_file => /path/to/lib_picard_insert_size_metrics.txt output_dir => /path/for/output/ });
=head1 Title : &optimize_refs Function: Calculate the ideal distance between the two integration (INT) references (refs) based on insert size (i_size). Returns : A list of reference positions and a # of
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationLocal Run Manager Resequencing Analysis Module Workflow Guide
Local Run Manager Resequencing Analysis Module Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Overview 3 Set Parameters 4 Analysis Methods 6 View Analysis Results 8 Analysis
More informationBioinformatics Framework
Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationAnalysing re-sequencing samples. Malin Larsson WABI / SciLifeLab
Analysing re-sequencing samples Malin Larsson Malin.larsson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga...! Re-sequencing IND 1! GTAGACT! AGATCGG!
More information2015 Workshop on Genomics. Genomics Laboratory
2015 Workshop on Genomics Genomics Laboratory Instructors: Konrad Paszkiewicz k.h.paszkiewicz@exeter.ac.uk Objectives: By the end of the lab you will be expected to: Understand how short reads are generated.
More informationAn Introduction to VariantTools
An Introduction to VariantTools Michael Lawrence, Jeremiah Degenhardt January 25, 2018 Contents 1 Introduction 2 2 Calling single-sample variants 2 2.1 Basic usage..............................................
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationSequence Alignment/Map Optional Fields Specification
Sequence Alignment/Map Optional Fields Specification The SAM/BAM Format Specification Working Group 14 Jul 2017 The master version of this document can be found at https://github.com/samtools/hts-specs.
More informationSep. Guide. Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Sep 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Corp. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
More informationRNA- SeQC Documentation
RNA- SeQC Documentation Description: Author: Calculates metrics on aligned RNA-seq data. David S. DeLuca (Broad Institute), gp-help@broadinstitute.org Summary This module calculates standard RNA-seq related
More informationExeter Sequencing Service
Exeter Sequencing Service A guide to your denovo RNA-seq results An overview Once your results are ready, you will receive an email with a password-protected link to them. Click the link to access your
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationDemultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
More informationRPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.
Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationEvaluate NimbleGen SeqCap Epi Target Enrichment Data
Sequencing Solutions Technical Note April 2014 How To Evaluate NimbleGen SeqCap Epi Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap Epi target enrichment data generated using an Illumina
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationALGORITHM USER GUIDE FOR RVD
ALGORITHM USER GUIDE FOR RVD The RVD program takes BAM files of deep sequencing reads in as input. Using a Beta-Binomial model, the algorithm estimates the error rate at each base position in the reference
More informationCORE Year 1 Whole Genome Sequencing Final Data Format Requirements
CORE Year 1 Whole Genome Sequencing Final Data Format Requirements To all incumbent contractors of CORE year 1 WGS contracts, the following acts as the agreed to sample parameters issued by NHLBI for data
More informationmerantk Version 1.1.1a
DIVISION OF BIOINFORMATICS - INNSBRUCK MEDICAL UNIVERSITY merantk Version 1.1.1a User manual Dietmar Rieder 1/12/2016 Page 1 Contents 1. Introduction... 3 1.1. Purpose of this document... 3 1.2. System
More information