Variant calling using SAMtools
|
|
- Jessie Goodman
- 5 years ago
- Views:
Transcription
1 Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel for this mode of computing. Almost everything you see here can easily be bundled up into batch scripts and run in that mode. Introduction Variant calling, at first glance, is pretty simple: Map sequence reads to an appropriate reference, emitting BAM files; Generate pileups and look for evidence of structural variation; Correct for false-positives due to the sequencing technology. Common file formats used in variant detection are: BAM files containing alignments against a reference genome Reference FASTA files containing genome sequence VCF files to represent SNPs and small indels BED files for specifying regions of the genome Setting up Go to the Terminal shell window in which you have launched an idev session: 1. Set your BASE variable a. export BASE=/scratch/01374/vaughn/tacc_ngs 2. mkdir $WORK/variants && cd $WORK/variants 3. Copy your own BWA alignment file into place: cp $WORK/bwa-align/hs37d5_allseqs_bwa.bam. 4. Load up the modules we will need for this session a. module load samtools && export PATH=$PATH:$TACC_SAMTOOLS_DIR/bcftools Now, we're ready for some variant-hunting! Alignment statistics Before diving into interpretation of bioinformatics results, it's nice to get some summary statistics. SAMtools has a tool 'flagstat' that makes it easy to do this for BAM files. Run samtools flagstat hs37d5_allseqs_bwa.bam and you should get: in total (QC-passed reads + QC-failed reads) duplicates mapped (87.81%:nan%) paired in sequencing read read properly paired (0.88%:nan%) with itself and mate mapped singletons (7.82%:nan%) with mate mapped to a different chr with mate mapped to a different chr (mapq>=5) As an aside, the reads whose mates map to alternate chromosomes may be revealing structural rearrangement. Most likely not, but among these reads is where you would look for evidence of such a thing. Basic variant calling Variant calling is basically a three-step process:
2 1. First, samtools mpileup command transposes the mapped data in a sorted BAM file fully to genome-centric coordinates. It starts at the first base on the first chromosome for which there is coverage and prints out one line per base. Each line has information on every base observed in the raw data at that base position along with a lot of auxiliary information depending on which flags are set. It calculates the Bayseian prior probability given by the data, but does not estimate a real genotype. 2. Next, bcftools with a few options added uses the prior probability distribution and the data to calculate an actual genotype for the variants detected. 3. Finally, vcfutils.pl (or equivalent) is used to filter down the list of candidates according to some set of objective criteria. Here's a basic set of commands to generate a BCF of genotypes. First, be sure the BWA file is sorted and indexed samtools sort hs37d5_allseqs_bwa.bam hs37d5_allseqs_bwa-sorted samtools index hs37d5_allseqs_bwa-sorted.bam Then, call variants and write to a VCF file samtools mpileup -uf /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/ref/hs37d5.fa \ hs37d5_allseqs_bwa-sorted.bam \ bcftools view -vcg - > hs37d5_allseqs_bwa.raw.vcf Open the 'hs37d5_allseqs_bwa.raw.vcf' file in a text editor and take a look around. Notice all the descriptive metadata in the comments (lines that start with the # character) - VCF is a very good format for bioinformatics! Question: What version of the VCF standard is this file The first line of the file is ##fileformat=vcfv4.1 and so this is a VCF 4.1 file Find the variant in chromosome 20 at position in the VCF file (It is probably the first variant record in the file). Hint If you are using 'less' to page through the VCF, you can hit the '?' key and type in and it will take you to the line where this polymorphism is found. Question: What is the reference base for this SNP and what is the polymorhism? The reference allele at this position is 'G' and the polymorphism is 'A' Question: What is the read depth supporting this polymorphism? Over in the INFO field, you will see a string DP=10. Looking up in the metadata at the top of the file, you see that DP is "Raw read depth". So, there are 10 reads supporting this polymorphism. Sounds like a potential winner! Question: What is the quality of this SNP? The QUAL field for this SNP is 39. VCF qualities are expressed on a PHRED scale, so this means there is a 1x10^-3.9^ chance that this SNP has been called in error. Pretty good, right? Inspecting base-level alignments So, you've identified a variant chr20: , it's got good quality and read support, and you want to verify it for yourself. You can use any number of BAM browsers (IGV, SeqMonk, etc) but you can also do this right from the terminal using a command bundled with samtools called 'tview'. Enter the following command
3 samtools tview hs37d5_allseqs_bwa-sorted.bam /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/ref/hs37d5.fa You should see a window that resembles the following screen shot. Browser View 1 Hit the '?' key to pull up help, then hit '?' again to dismiss help. Let's go to the SNP we examined before. Type 'n' to turn on color coding of nucleotides. Hit 'g' and you will be asked to enter a position in the genome, then enter 20: in this box and hit 'Return' and you will be transported to the location in reference genome. The base will be the left-most column in the BAM browser. Browser View 2 Filtering your VCF file The vcfutils.pl script, bundled with bcftools inside SAMTools can provide useful stats and can perform some filtering of VCFs by specific criteria. Running vcfutils.pl $TACC_SAMTOOLS_DIR/bcftools/vcfutils.pl qstats hs37d5_allseqs_bwa.raw.vcf Output
4 QUAL #non-indel #SNPs #transitions #joint ts/tv #joint/#ref #joint/#non-indel Question: How many INDELs were identifed in your VCF file? Hint The 'grep' command may help you figure this out. grep -c "INDEL" hs37d5_allseqs_bwa.raw.vcf 48 So there are 48 indels that were identifiable in this data set.
5 Why filter? With any variant caller you use, there will be an inherent trade-off between sensitivity and specificity. Typically, you would carry forward as much data as practical at each processing step, deferring final judgement until later so you have more information. For example, you might not want to exclude low coverage regions in one sample from your raw data because you may be able to infer a genotype based on family information later. This typically leads to NGS pipelines that maximize sensitivity, leading to a substantial number of false positives. Filtering after variant calling ca n be useful to eliminate false positives based on all the data available after numerous analyses. In the samtools/bcftools world, the vcfutils.pl script provides a means to filter SNPs on many criteria. Exercises Now, you will explore some filter settings for vcfutils.pl varfilter to see how many SNPs get filtered out, using the linux tool xargs to do a parameter sweep. Filtering, counting, and parameter iteration # First - create a tiny shell script to run vcfutils, accepting a single parameter: echo "#\!/bin/bash" > tiny.sh echo "echo \"Sweeping with vcfutils.pl, min read depth of: \$1\" " >> tiny.sh echo "$TACC_SAMTOOLS_DIR/bcftools/vcfutils.pl varfilter -Q 20 -d \$1 hs37d5_allseqs_bwa.raw.vcf grep -v '^#' wc -l " >> tiny.sh # Now make it executable chmod +x tiny.sh # Use xargs to do a sweep of read depths echo xargs -n 1 tiny.sh Output Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: This may be obvious, but there are fewer SNPs returned the higher read depth you require to support them. Homework: Try to update tiny.sh so that sweeps through Quality rather than read depth Exercise questions
6 You can use bedtools and some Linux built-in commands to compare your vcf file to one generated by BioITeam staff using some other data and means (you will need module load bedtools). Your file: hs37d5_allseqs_bwa.raw.vcf BioITeam staff VCF file: /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf Hints Investigate grep -c Try intersectbed and wc *Question: How many SNPs are in your VCF file and the staff-generated VCF file? Solution grep -c -v "^#" hs37d5_allseqs_bwa.raw.vcf 1507 grep -c -v "^#" /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf Question: How many SNPs are in common between the two files? Solution intersectbed -a hs37d5_allseqs_bwa.raw.vcf -b /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf wc -l 88 Question: What are the average and maximum quality values for the SNPs that are in your VCF file? Solution grep -v '^#' hs37d5_allseqs_bwa.raw.vcf awk 'BEGIN {max=0} {sum+=$6; if ($6>max) {max=$6}} END {print "Average qual: "sum/nr "\tmax qual: " max}' Average qual: Max qual: 113 There's probably no way you knew how to do this! Please check out the power of awk before you write YAPPS (Yet Another Perl or Python Script) - it's a lifesaver, and is named after a cute bird.
Calling variants in diploid or multiploid genomes
Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationRNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013
RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationSNP Calling. Tuesday 4/21/15
SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity
More informationPractical exercises Day 2. Variant Calling
Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationTutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan
Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so
More informationRead mapping with BWA and BOWTIE
Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationfreebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015
freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationNext-Generation Sequencing applied to adna
Next-Generation Sequencing applied to adna Hands-on session June 13, 2014 Ludovic Orlando - Lorlando@snm.ku.dk Mikkel Schubert - MSchubert@snm.ku.dk Aurélien Ginolhac - AGinolhac@snm.ku.dk Hákon Jónsson
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationPerl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1.
Perl for Biologists Session 14 June 3, 2015 Practical example Robert Bukowski Session 14: Practical example Perl for Biologists 1.2 1 Session 13 review Process is an object of UNIX (Linux) kernel identified
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationChIP-seq Analysis Practical
ChIP-seq Analysis Practical Vladimir Teif (vteif@essex.ac.uk) An updated version of this document will be available at http://generegulation.info/index.php/teaching In this practical we will learn how
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationWM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder
WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationPractical Linux examples: Exercises
Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,
More informationInput files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:
Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationDindel User Guide, version 1.0
Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel
More informationAnalyzing massive genomics datasets using Databricks Frank Austin Nothaft,
Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT
More informationVariant Calling and Filtering for SNPs
Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationPRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP
PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationHandling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014
Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationFinding and Exporting Data. BioMart
September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.
More informationMerge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.
Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationMPG NGS workshop I: Quality assessment of SNP calls
MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*
More informationNA12878 Platinum Genome GENALICE MAP Analysis Report
NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationREPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.
REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationreplace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationRead Mapping and Variant Calling
Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within
More informationFrom fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /
From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1
More information3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7
Cpipe User Guide 1. Introduction - What is Cpipe?... 3 2. Design Background... 3 2.1. Analysis Pipeline Implementation (Cpipe)... 4 2.2. Use of a Bioinformatics Pipeline Toolkit (Bpipe)... 4 2.3. Individual
More informationWorkshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow
Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationUMass High Performance Computing Center
UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationdiscosnp++ Reference-free detection of SNPs and small indels v2.2.2
discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationA Hands-On Tutorial: RNA Sequencing Using High-Performance Computing
A Hands-On Tutorial: RNA Sequencing Using Computing February 11th and 12th, 2016 1st session (Thursday) Preliminaries: Linux, HPC, command line interface Using HPC: modules, queuing system Presented by:
More informationWelcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
More informationMapping and Viewing Deep Sequencing Data bowtie2, samtools, igv
Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationManual Reference Pages samtools (1)
Manual Reference Pages samtools (1) NAME CONTENTS SYNOPSIS samtools Utilities for the Sequence Alignment/Map (SAM) format bcftools Utilities for the Binary Call Format (BCF) and VCF Synopsis Description
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationRVD2.7 command line program (CLI) instructions
RVD2.7 command line program (CLI) instructions Contents I. The overall Flowchart of RVD2 program... 1 II. The overall Flow chart of Test s... 2 III. RVD2 CLI syntax... 3 IV. RVD2 CLI demo... 5 I. The overall
More informationBioinformatics Framework
Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationGenomics. Nolan C. Kane
Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment
More informationPractical Linux Examples
Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf
More informationAtlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
More informationGenomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun
Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationIntro to NGS Tutorial
Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................
More informationMar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
More informationLecture 5. Essential skills for bioinformatics: Unix/Linux
Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular
More informationLecture 3. Essential skills for bioinformatics: Unix/Linux
Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,
More informationChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationTutorial: Resequencing Analysis using Tracks
: Resequencing Analysis using Tracks September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : Resequencing
More informationGenome Browser Background and Strategy
Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava
More informationHelpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
More informationNGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea
NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama
More informationAnalysing re-sequencing samples. Anna Johansson WABI / SciLifeLab
Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationUser Guide. v Released June Advaita Corporation 2016
User Guide v. 0.9 Released June 2016 Copyright Advaita Corporation 2016 Page 2 Table of Contents Table of Contents... 2 Background and Introduction... 4 Variant Calling Pipeline... 4 Annotation Information
More informationExercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files
Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf
More information