Variant calling using SAMtools

Size: px
Start display at page:

Download "Variant calling using SAMtools"

Transcription

1 Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel for this mode of computing. Almost everything you see here can easily be bundled up into batch scripts and run in that mode. Introduction Variant calling, at first glance, is pretty simple: Map sequence reads to an appropriate reference, emitting BAM files; Generate pileups and look for evidence of structural variation; Correct for false-positives due to the sequencing technology. Common file formats used in variant detection are: BAM files containing alignments against a reference genome Reference FASTA files containing genome sequence VCF files to represent SNPs and small indels BED files for specifying regions of the genome Setting up Go to the Terminal shell window in which you have launched an idev session: 1. Set your BASE variable a. export BASE=/scratch/01374/vaughn/tacc_ngs 2. mkdir $WORK/variants && cd $WORK/variants 3. Copy your own BWA alignment file into place: cp $WORK/bwa-align/hs37d5_allseqs_bwa.bam. 4. Load up the modules we will need for this session a. module load samtools && export PATH=$PATH:$TACC_SAMTOOLS_DIR/bcftools Now, we're ready for some variant-hunting! Alignment statistics Before diving into interpretation of bioinformatics results, it's nice to get some summary statistics. SAMtools has a tool 'flagstat' that makes it easy to do this for BAM files. Run samtools flagstat hs37d5_allseqs_bwa.bam and you should get: in total (QC-passed reads + QC-failed reads) duplicates mapped (87.81%:nan%) paired in sequencing read read properly paired (0.88%:nan%) with itself and mate mapped singletons (7.82%:nan%) with mate mapped to a different chr with mate mapped to a different chr (mapq>=5) As an aside, the reads whose mates map to alternate chromosomes may be revealing structural rearrangement. Most likely not, but among these reads is where you would look for evidence of such a thing. Basic variant calling Variant calling is basically a three-step process:

2 1. First, samtools mpileup command transposes the mapped data in a sorted BAM file fully to genome-centric coordinates. It starts at the first base on the first chromosome for which there is coverage and prints out one line per base. Each line has information on every base observed in the raw data at that base position along with a lot of auxiliary information depending on which flags are set. It calculates the Bayseian prior probability given by the data, but does not estimate a real genotype. 2. Next, bcftools with a few options added uses the prior probability distribution and the data to calculate an actual genotype for the variants detected. 3. Finally, vcfutils.pl (or equivalent) is used to filter down the list of candidates according to some set of objective criteria. Here's a basic set of commands to generate a BCF of genotypes. First, be sure the BWA file is sorted and indexed samtools sort hs37d5_allseqs_bwa.bam hs37d5_allseqs_bwa-sorted samtools index hs37d5_allseqs_bwa-sorted.bam Then, call variants and write to a VCF file samtools mpileup -uf /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/ref/hs37d5.fa \ hs37d5_allseqs_bwa-sorted.bam \ bcftools view -vcg - > hs37d5_allseqs_bwa.raw.vcf Open the 'hs37d5_allseqs_bwa.raw.vcf' file in a text editor and take a look around. Notice all the descriptive metadata in the comments (lines that start with the # character) - VCF is a very good format for bioinformatics! Question: What version of the VCF standard is this file The first line of the file is ##fileformat=vcfv4.1 and so this is a VCF 4.1 file Find the variant in chromosome 20 at position in the VCF file (It is probably the first variant record in the file). Hint If you are using 'less' to page through the VCF, you can hit the '?' key and type in and it will take you to the line where this polymorphism is found. Question: What is the reference base for this SNP and what is the polymorhism? The reference allele at this position is 'G' and the polymorphism is 'A' Question: What is the read depth supporting this polymorphism? Over in the INFO field, you will see a string DP=10. Looking up in the metadata at the top of the file, you see that DP is "Raw read depth". So, there are 10 reads supporting this polymorphism. Sounds like a potential winner! Question: What is the quality of this SNP? The QUAL field for this SNP is 39. VCF qualities are expressed on a PHRED scale, so this means there is a 1x10^-3.9^ chance that this SNP has been called in error. Pretty good, right? Inspecting base-level alignments So, you've identified a variant chr20: , it's got good quality and read support, and you want to verify it for yourself. You can use any number of BAM browsers (IGV, SeqMonk, etc) but you can also do this right from the terminal using a command bundled with samtools called 'tview'. Enter the following command

3 samtools tview hs37d5_allseqs_bwa-sorted.bam /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/ref/hs37d5.fa You should see a window that resembles the following screen shot. Browser View 1 Hit the '?' key to pull up help, then hit '?' again to dismiss help. Let's go to the SNP we examined before. Type 'n' to turn on color coding of nucleotides. Hit 'g' and you will be asked to enter a position in the genome, then enter 20: in this box and hit 'Return' and you will be transported to the location in reference genome. The base will be the left-most column in the BAM browser. Browser View 2 Filtering your VCF file The vcfutils.pl script, bundled with bcftools inside SAMTools can provide useful stats and can perform some filtering of VCFs by specific criteria. Running vcfutils.pl $TACC_SAMTOOLS_DIR/bcftools/vcfutils.pl qstats hs37d5_allseqs_bwa.raw.vcf Output

4 QUAL #non-indel #SNPs #transitions #joint ts/tv #joint/#ref #joint/#non-indel Question: How many INDELs were identifed in your VCF file? Hint The 'grep' command may help you figure this out. grep -c "INDEL" hs37d5_allseqs_bwa.raw.vcf 48 So there are 48 indels that were identifiable in this data set.

5 Why filter? With any variant caller you use, there will be an inherent trade-off between sensitivity and specificity. Typically, you would carry forward as much data as practical at each processing step, deferring final judgement until later so you have more information. For example, you might not want to exclude low coverage regions in one sample from your raw data because you may be able to infer a genotype based on family information later. This typically leads to NGS pipelines that maximize sensitivity, leading to a substantial number of false positives. Filtering after variant calling ca n be useful to eliminate false positives based on all the data available after numerous analyses. In the samtools/bcftools world, the vcfutils.pl script provides a means to filter SNPs on many criteria. Exercises Now, you will explore some filter settings for vcfutils.pl varfilter to see how many SNPs get filtered out, using the linux tool xargs to do a parameter sweep. Filtering, counting, and parameter iteration # First - create a tiny shell script to run vcfutils, accepting a single parameter: echo "#\!/bin/bash" > tiny.sh echo "echo \"Sweeping with vcfutils.pl, min read depth of: \$1\" " >> tiny.sh echo "$TACC_SAMTOOLS_DIR/bcftools/vcfutils.pl varfilter -Q 20 -d \$1 hs37d5_allseqs_bwa.raw.vcf grep -v '^#' wc -l " >> tiny.sh # Now make it executable chmod +x tiny.sh # Use xargs to do a sweep of read depths echo xargs -n 1 tiny.sh Output Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: Sweeping with vcfutils.pl, min read depth of: This may be obvious, but there are fewer SNPs returned the higher read depth you require to support them. Homework: Try to update tiny.sh so that sweeps through Quality rather than read depth Exercise questions

6 You can use bedtools and some Linux built-in commands to compare your vcf file to one generated by BioITeam staff using some other data and means (you will need module load bedtools). Your file: hs37d5_allseqs_bwa.raw.vcf BioITeam staff VCF file: /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf Hints Investigate grep -c Try intersectbed and wc *Question: How many SNPs are in your VCF file and the staff-generated VCF file? Solution grep -c -v "^#" hs37d5_allseqs_bwa.raw.vcf 1507 grep -c -v "^#" /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf Question: How many SNPs are in common between the two files? Solution intersectbed -a hs37d5_allseqs_bwa.raw.vcf -b /corral-repl/utexas/bioiteam/tacc_ngs/human_variation/all.samtools.vcf wc -l 88 Question: What are the average and maximum quality values for the SNPs that are in your VCF file? Solution grep -v '^#' hs37d5_allseqs_bwa.raw.vcf awk 'BEGIN {max=0} {sum+=$6; if ($6>max) {max=$6}} END {print "Average qual: "sum/nr "\tmax qual: " max}' Average qual: Max qual: 113 There's probably no way you knew how to do this! Please check out the power of awk before you write YAPPS (Yet Another Perl or Python Script) - it's a lifesaver, and is named after a cute bird.

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

SNP Calling. Tuesday 4/21/15

SNP Calling. Tuesday 4/21/15 SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity

More information

Practical exercises Day 2. Variant Calling

Practical exercises Day 2. Variant Calling Practical exercises Day 2 Variant Calling Samtools mpileup Variant calling with samtools mpileup + bcftools Variant calling with HaplotypeCaller (GATK Best Practices) Genotype GVCFs Hard Filtering Variant

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan

Tutorial on gene-c ancestry es-ma-on: How to use LASER. Chaolong Wang Sequence Analysis Workshop June University of Michigan Tutorial on gene-c ancestry es-ma-on: How to use LASER Chaolong Wang Sequence Analysis Workshop June 2014 @ University of Michigan LASER: Loca-ng Ancestry from SEquence Reads Main func:ons of the so

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015

freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015 freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Next-Generation Sequencing applied to adna

Next-Generation Sequencing applied to adna Next-Generation Sequencing applied to adna Hands-on session June 13, 2014 Ludovic Orlando - Lorlando@snm.ku.dk Mikkel Schubert - MSchubert@snm.ku.dk Aurélien Ginolhac - AGinolhac@snm.ku.dk Hákon Jónsson

More information

Sequence Mapping and Assembly

Sequence Mapping and Assembly Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Perl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1.

Perl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1. Perl for Biologists Session 14 June 3, 2015 Practical example Robert Bukowski Session 14: Practical example Perl for Biologists 1.2 1 Session 13 review Process is an object of UNIX (Linux) kernel identified

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

ChIP-seq Analysis Practical

ChIP-seq Analysis Practical ChIP-seq Analysis Practical Vladimir Teif (vteif@essex.ac.uk) An updated version of this document will be available at http://generegulation.info/index.php/teaching In this practical we will learn how

More information

Sentieon Documentation

Sentieon Documentation Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

Practical Linux examples: Exercises

Practical Linux examples: Exercises Practical Linux examples: Exercises 1. Login (ssh) to the machine that you are assigned for this workshop (assigned machines: https://cbsu.tc.cornell.edu/ww/machines.aspx?i=87 ). Prepare working directory,

More information

Input files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam:

Input files: Trim reads: Create bwa index: Align trimmed reads: Convert sam to bam: Sort bam: Remove duplicates: Index sorted, no-duplicates bam: Input files: 11B-872-3.Ac4578.B73xEDMX-2233_palomero-1.fq 11B-872-3.Ac4578.B73xEDMX-2233_palomero-2.fq Trim reads: java -jar trimmomatic-0.32.jar PE -threads $PBS_NUM_PPN -phred33 \ [...]-1.fq [...]-2.fq

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft,

Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, Analyzing massive genomics datasets using Databricks Frank Austin Nothaft, PhD frank.nothaft@databricks.com @fnothaft VISION Accelerate innovation by unifying data science, engineering and business PRODUCT

More information

Variant Calling and Filtering for SNPs

Variant Calling and Filtering for SNPs Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

An Introduction to Linux and Bowtie

An Introduction to Linux and Bowtie An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS

More information

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014

Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Handling important NGS data formats in UNIX Prac8cal training course NGS Workshop in Nove Hrady 2014 Vaclav Janousek, Libor Morkovsky hjp://ngs- course- nhrady.readthedocs.org (Exercises & Reference Manual)

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Finding and Exporting Data. BioMart

Finding and Exporting Data. BioMart September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.

More information

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p. Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September

MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting

More information

MPG NGS workshop I: Quality assessment of SNP calls

MPG NGS workshop I: Quality assessment of SNP calls MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013) Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

Read Mapping and Variant Calling

Read Mapping and Variant Calling Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within

More information

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja /

From fastq to vcf. NGG 2016 / Evolutionary Genomics Ari Löytynoja / From fastq to vcf Overview of resequencing analysis samples fastq fastq fastq fastq mapping bam bam bam bam variant calling samples 18917 C A 0/0 0/0 0/0 0/0 18969 G T 0/0 0/0 0/0 0/0 19022 G T 0/1 1/1

More information

3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7

3. Installation Download Cpipe and Run Install Script Create an Analysis Profile Create a Batch... 7 Cpipe User Guide 1. Introduction - What is Cpipe?... 3 2. Design Background... 3 2.1. Analysis Pipeline Implementation (Cpipe)... 4 2.2. Use of a Bioinformatics Pipeline Toolkit (Bpipe)... 4 2.3. Individual

More information

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow

Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing. Fides D Lay UCLA QCB Fellow Workshop 6: DNA Methylation Analysis using Bisulfite Sequencing Fides D Lay UCLA QCB Fellow lay.fides@gmail.com Workshop 6 Outline Day 1: Introduction to DNA methylation & WGBS Quick review of linux, Hoffman2

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

UMass High Performance Computing Center

UMass High Performance Computing Center UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every

More information

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)

HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o

More information

discosnp++ Reference-free detection of SNPs and small indels v2.2.2

discosnp++ Reference-free detection of SNPs and small indels v2.2.2 discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing A Hands-On Tutorial: RNA Sequencing Using Computing February 11th and 12th, 2016 1st session (Thursday) Preliminaries: Linux, HPC, command line interface Using HPC: modules, queuing system Presented by:

More information

Welcome to GenomeView 101!

Welcome to GenomeView 101! Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory

More information

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

Evaluate NimbleGen SeqCap RNA Target Enrichment Data

Evaluate NimbleGen SeqCap RNA Target Enrichment Data Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina

More information

Manual Reference Pages samtools (1)

Manual Reference Pages samtools (1) Manual Reference Pages samtools (1) NAME CONTENTS SYNOPSIS samtools Utilities for the Sequence Alignment/Map (SAM) format bcftools Utilities for the Binary Call Format (BCF) and VCF Synopsis Description

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

RVD2.7 command line program (CLI) instructions

RVD2.7 command line program (CLI) instructions RVD2.7 command line program (CLI) instructions Contents I. The overall Flowchart of RVD2 program... 1 II. The overall Flow chart of Test s... 2 III. RVD2 CLI syntax... 3 IV. RVD2 CLI demo... 5 I. The overall

More information

Bioinformatics Framework

Bioinformatics Framework Persona: A High-Performance Bioinformatics Framework Stuart Byma 1, Sam Whitlock 1, Laura Flueratoru 2, Ethan Tseng 3, Christos Kozyrakis 4, Edouard Bugnion 1, James Larus 1 EPFL 1, U. Polytehnica of Bucharest

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Genomics. Nolan C. Kane

Genomics. Nolan C. Kane Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment

More information

Practical Linux Examples

Practical Linux Examples Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf

More information

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010

Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1

More information

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun

Genomes On The Cloud GotCloud. University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Genomes On The Cloud GotCloud University of Michigan Center for Statistical Genetics Mary Kate Wing Goo Jun Friday, March 8, 2013 Why GotCloud? Connects sequence analysis tools together Alignment, quality

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

Mar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037

Mar. Guide.  Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated

More information

Lecture 5. Essential skills for bioinformatics: Unix/Linux

Lecture 5. Essential skills for bioinformatics: Unix/Linux Lecture 5 Essential skills for bioinformatics: Unix/Linux UNIX DATA TOOLS Text processing with awk We have illustrated two ways awk can come in handy: Filtering data using rules that can combine regular

More information

Lecture 3. Essential skills for bioinformatics: Unix/Linux

Lecture 3. Essential skills for bioinformatics: Unix/Linux Lecture 3 Essential skills for bioinformatics: Unix/Linux RETRIEVING DATA Overview Whether downloading large sequencing datasets or accessing a web application hundreds of times to download specific files,

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Tutorial: Resequencing Analysis using Tracks

Tutorial: Resequencing Analysis using Tracks : Resequencing Analysis using Tracks September 20, 2013 CLC bio Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 Fax: +45 86 20 12 22 www.clcbio.com support@clcbio.com : Resequencing

More information

Genome Browser Background and Strategy

Genome Browser Background and Strategy Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

NGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea

NGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama

More information

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab

Analysing re-sequencing samples. Anna Johansson WABI / SciLifeLab Analysing re-sequencing samples Anna Johansson Anna.johansson@scilifelab.se WABI / SciLifeLab Re-sequencing Reference genome assembly...gtgcgtagactgctagatcgaaga... Re-sequencing IND 1 GTAGACT AGATCGG GCGTAGT

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

User Guide. v Released June Advaita Corporation 2016

User Guide. v Released June Advaita Corporation 2016 User Guide v. 0.9 Released June 2016 Copyright Advaita Corporation 2016 Page 2 Table of Contents Table of Contents... 2 Background and Introduction... 4 Variant Calling Pipeline... 4 Annotation Information

More information

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf

More information