Assumptions. The Cournot Model. Assumptions. Assumptions. Assumptions. Assumptions. P An important assumption, the heart of the Cournot model. D.

Size: px
Start display at page:

Download "Assumptions. The Cournot Model. Assumptions. Assumptions. Assumptions. Assumptions. P An important assumption, the heart of the Cournot model. D."

Transcription

1 Assumptions Two firms A, nd B Mngeril Economics-Chrles W. Upton Assumptions Assumptions Two firms A, nd B The industry demnd function is P Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B P Q Q Assumptions Assumptions Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B Firm A tkes its demnd function s - B P b Q Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B Firm A tkes its demnd function s - B P An importnt ssumption, the hert of the Cournot model. b Q

2 Solving problem Solving problem MR MC Solving problem Symmetry p* Just s Firm A is choosing to mximize profits, so too is Firm B choosing B to mximize profits. MR MC * Symmetry Just s Firm A is choosing to mximize profits, so too is Firm B choosing B to mximize profits. If B chnges its output, A will rect by chnging its output. A Rection We do the mthemticl pproch first nd then the grphicl pproch.

3 A Rection The industry demnd function Q = 00 p. A Rection The industry demnd function Q = 00 p. The inverse demnd function is P = 50 (/)Q A Rection The industry demnd function Q = 00 p. The inverse demnd function is P = 50 (/)Q demnd function is then P = 50 (/)( + B ) A Rection demnd function is then P = 50 (/)( + B ) The firm s profits re p = P 5 A Rection demnd function is then P = 50 (/)( + B ) The firm s profits re π = [50 (/)( + B )] 5 A Rection p = [50 (/)( + B )] 5 3

4 A Rection A Rection π = [50 (/)( + B )] 5 π = 50 (/) (/) B 5 π = [50 (/)( + B )] 5 π = 50 (/) (/) B 5 π = (/) (/) B A Rection A Rection π = b π = dπ d = b b A Rection Symmetry dπ d = = b b = 0 = (/) B There is similr rection function for B B = (/) 4

5 Solving for Solving for = (/) B B = (/) = (/)[ (/) ] =.5 + (/4) = (/)[ (/) ] Solving for Solving for = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (4/3).5 Solving for A Grphicl Approch = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (4/3).5 = 30 B = 30 = (/) B We wnt to use the rection function to come to grphicl solution, 5

6 A Grphicl Approch A Grphicl Approch = (/) B When B produces nothing A should rect by producing the monopoly output (). = (/) B When B produces nothing A should rect by producing the monopoly output (). When B produces the output of the competitive industry (), A should rect by producing nothing. A Grphicl Approch = (/) B When B produces nothing A should rect by producing the monopoly output (). When B produces the output of the competitive industry (), A should rect by producing nothing. Similr rules pply for rections. Grphing the Rection Grphing the Rection If B produces nothing, A cts like monopoly If B produces the competitive output, A produces nothing. Grphing the Rection Rection 0 6

7 Grphing the Rection If A produces the competitive output, B produces nothing. If A produces nothing, B cts like monopoly. Rection Grphing the Rection Rection Rection Grphing the Rection If A nd B re off their rection functions, they rect nd chnge output. Here B expnds, A contrcts. Grphing the Rection Grphing the Rection If A is here, B wnts to be here Grphing the Rection If B is here, A wnts to be here 7

8 Euilibrium The Bsic Steps Rection Rection Plot the rection functions If B produces nothing, A behves like monopoly If B produces competitive output, A produces nothing Solve for their intersection End 003 Chrles W. Upton 8

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Essential Question What are some of the characteristics of the graph of a rational function?

Essential Question What are some of the characteristics of the graph of a rational function? 8. TEXAS ESSENTIAL KNOWLEDGE AND SKILLS A..A A..G A..H A..K Grphing Rtionl Functions Essentil Question Wht re some of the chrcteristics of the grph of rtionl function? The prent function for rtionl functions

More information

4.4. Vertical Differentiation Vertical Differentiation

4.4. Vertical Differentiation Vertical Differentiation Mtilde Mchdo Industril Orgniztion- Mtilde Mchdo Verticl Differentition 4.4. Verticl Differentition The Hotelling model studies situtions of horizontl differentition since for equl prices there re lwys

More information

EconS 301 Homework #8 Answer key

EconS 301 Homework #8 Answer key EconS 0 Homework #8 Answer key Exercise # Monopoly Consider a monopolist facing inverse demand function pp(qq) 5 qq, where qq denotes units of output. Assume that the total cost of this firm is TTTT(qq)

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

Ricardain Model and Comparative Advantage! Chayun Tantivasadakarn! Faculty of Economics, Thammasat University!

Ricardain Model and Comparative Advantage! Chayun Tantivasadakarn! Faculty of Economics, Thammasat University! Ricardain Model and Comparative Advantage! Chayun Tantivasadakarn! Faculty of Economics, Thammasat University! 1 Outline! Assumption Production Possibility Curves Autarky equilibrium Comparative advantage

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Chapter P: Preparation for Calculus

Chapter P: Preparation for Calculus 1. Which of the following is the correct graph of y = x x 3? E) Copyright Houghton Mifflin Company. All rights reserved. 1 . Which of the following is the correct graph of y = 3x x? E) Copyright Houghton

More information

LIMITS AND CONTINUITY

LIMITS AND CONTINUITY LIMITS AND CONTINUITY Joe McBride/Stone/Gett Imges Air resistnce prevents the velocit of skdiver from incresing indefinitel. The velocit pproches it, clled the terminl velocit. The development of clculus

More information

Many analog implementations of CPG exist, typically using operational amplifier or

Many analog implementations of CPG exist, typically using operational amplifier or FPGA Implementtion of Centrl Pttern Genertor By Jmes J Lin Introuction: Mny nlog implementtions of CPG exist, typiclly using opertionl mplifier or trnsistor level circuits. These types of circuits hve

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

Accelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes. In 1.1, we discussed using t-charts to help graph functions. e.g.

Accelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes. In 1.1, we discussed using t-charts to help graph functions. e.g. Accelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes In 1.1, we discussed using t-charts to help graph functions. e.g., Graph: y = x 3 What are some other strategies that can make graphing

More information

Linear Cournot Duopoly

Linear Cournot Duopoly Linear Cournot Duopoly Definition p = a - b q + q2 ; Q = q + q2; π = p - c q; π2 = p - c2 q2; CS = 2 b q + q2 ^2; PS = π + π2; SW = CS + PS; Calculating Equilibrium FOCs are D[π, q]; FOCDuoq = % D[π2,

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

1.1 Lines AP Calculus

1.1 Lines AP Calculus . Lines AP Clculus. LINES Notecrds from Section.: Rules for Rounding Round or Truncte ll finl nswers to 3 deciml plces. Do NOT round before ou rech our finl nswer. Much of Clculus focuses on the concept

More information

The Reciprocal Function Family. Objectives To graph reciprocal functions To graph translations of reciprocal functions

The Reciprocal Function Family. Objectives To graph reciprocal functions To graph translations of reciprocal functions - The Reciprocl Function Fmil Objectives To grph reciprocl functions To grph trnsltions of reciprocl functions Content Stndrds F.BF.3 Identif the effect on the grph of replcing f () b f() k, kf(), f(k),

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

WHAT YOU SHOULD LEARN

WHAT YOU SHOULD LEARN GRAPHS OF EQUATIONS WHAT YOU SHOULD LEARN Sketch graphs of equations. Find x- and y-intercepts of graphs of equations. Use symmetry to sketch graphs of equations. Find equations of and sketch graphs of

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Tool Vendor Perspectives SysML Thus Far

Tool Vendor Perspectives SysML Thus Far Frontiers 2008 Pnel Georgi Tec, 05-13-08 Tool Vendor Perspectives SysML Thus Fr Hns-Peter Hoffmnn, Ph.D Chief Systems Methodologist Telelogic, Systems & Softwre Modeling Business Unit Peter.Hoffmnn@telelogic.com

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Finding the axis of symmetry, vertex, and roots of a parabola

Finding the axis of symmetry, vertex, and roots of a parabola Finding the axis of symmetry, vertex, and roots of a parabola 1) Find the Axis of Symmetry of y = x 2-4x + 3 (The AOS is the vertical line that splits the parabola in 2 equal parts) Axis of Symmetry Axis

More information

arxiv: v2 [math.ho] 4 Jun 2012

arxiv: v2 [math.ho] 4 Jun 2012 Volumes of olids of Revolution. Unified pproch Jorge Mrtín-Morles nd ntonio M. Oller-Mrcén jorge@unizr.es, oller@unizr.es rxiv:5.v [mth.ho] Jun Centro Universitrio de l Defens - IUM. cdemi Generl Militr,

More information

Constrained Optimization

Constrained Optimization Constrained Optimization Dudley Cooke Trinity College Dublin Dudley Cooke (Trinity College Dublin) Constrained Optimization 1 / 46 EC2040 Topic 5 - Constrained Optimization Reading 1 Chapters 12.1-12.3

More information

Math 17 - Review. Review for Chapter 12

Math 17 - Review. Review for Chapter 12 Mth 17 - eview Ying Wu eview for hpter 12 1. Given prmetric plnr curve x = f(t), y = g(t), where t b, how to eliminte the prmeter? (Use substitutions, or use trigonometry identities, etc). How to prmeterize

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

OPUC Transmission Workshop 2 FERC Pro Forma Transmission

OPUC Transmission Workshop 2 FERC Pro Forma Transmission OPUC Transmission Workshop 2 FERC Pro Forma Transmission Eric Christensen, Cairncross & Hempelmann Karen Kruse, PacifiCorp February 28, 2019 Background of FERC Pro Forma Documents (Refresher from morning

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

Digital Design. Chapter 6: Optimizations and Tradeoffs

Digital Design. Chapter 6: Optimizations and Tradeoffs Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

PRECALCULUS I/MATH 126 (2188) SHANNON MYERS

PRECALCULUS I/MATH 126 (2188) SHANNON MYERS PRECALCULUS I/MATH 126 (2188) SHANNON MYERS π 100 POINTS POSSIBLE π YOUR WORK MUST SUPPORT YOUR ANSWER FOR FULL CREDIT TO BE AWARDED π YOU MAY USE A SCIENTIFIC AND/OR A TI-83/84/85/86 CALCULATOR π PROVIDE

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology

More information

1. Represent each of these relations on {1, 2, 3} with a matrix (with the elements of this set listed in increasing order).

1. Represent each of these relations on {1, 2, 3} with a matrix (with the elements of this set listed in increasing order). Exercises Exercises 1. Represent each of these relations on {1, 2, 3} with a matrix (with the elements of this set listed in increasing order). a) {(1, 1), (1, 2), (1, 3)} b) {(1, 2), (2, 1), (2, 2), (3,

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

This unit is built upon your knowledge and understanding of the right triangle trigonometric ratios. A memory aid that is often used was SOHCAHTOA.

This unit is built upon your knowledge and understanding of the right triangle trigonometric ratios. A memory aid that is often used was SOHCAHTOA. Angular Rotations This unit is built upon your knowledge and understanding of the right triangle trigonometric ratios. A memory aid that is often used was SOHCAHTOA. sin x = opposite hypotenuse cosx =

More information

Preserving Constraints for Aggregation Relationship Type Update in XML Document

Preserving Constraints for Aggregation Relationship Type Update in XML Document Preserving Constrints for Aggregtion Reltionship Type Updte in XML Document Eric Prdede 1, J. Wenny Rhyu 1, nd Dvid Tnir 2 1 Deprtment of Computer Science nd Computer Engineering, L Trobe University, Bundoor

More information

A Transportation Problem Analysed by a New Ranking Method

A Transportation Problem Analysed by a New Ranking Method (IJIRSE) Interntionl Journl of Innovtive Reserch in Science & Engineering ISSN (Online) 7-07 A Trnsporttion Problem Anlysed by New Rnking Method Dr. A. Shy Sudh P. Chinthiy Associte Professor PG Scholr

More information

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl

More information

Kansas City Area Teachers of Mathematics 2018 KCATM Math Competition

Kansas City Area Teachers of Mathematics 2018 KCATM Math Competition Kansas City Area Teachers of Mathematics 2018 KCATM Math Competition GEOMETRY AND MEASUREMENT TEST GRADE 6 #51-90 INSTRUCTIONS Do not open this booklet until instructed to do so. Time limit: 20 minutes

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

A. Lesson Context. B. Lesson Objectives. C. Fast Five (Skills Review Focus)

A. Lesson Context. B. Lesson Objectives. C. Fast Five (Skills Review Focus) A. Lesson Context BIG PICTURE of this UNIT: How & why do we build NEW knowledge in Mathematics? What NEW IDEAS & NEW CONCEPTS can we now explore with specific references to QUADRATIC FUNCTIONS? How can

More information

Lecture 17: Continuous Functions

Lecture 17: Continuous Functions Lecture 17: Continuous Functions 1 Continuous Functions Let (X, T X ) and (Y, T Y ) be topological spaces. Definition 1.1 (Continuous Function). A function f : X Y is said to be continuous if the inverse

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Matrices and Systems of Equations

Matrices and Systems of Equations Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.

More information

PS 6: Regularization. PART A: (Source: HTF page 95) The Ridge regression problem is:

PS 6: Regularization. PART A: (Source: HTF page 95) The Ridge regression problem is: Economics 1660: Big Data PS 6: Regularization Prof. Daniel Björkegren PART A: (Source: HTF page 95) The Ridge regression problem is: : β "#$%& = argmin (y # β 2 x #4 β 4 ) 6 6 + λ β 4 #89 Consider the

More information

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls

More information

Angle properties of lines and polygons

Angle properties of lines and polygons chievement Stndrd 91031 pply geometric resoning in solving problems Copy correctly Up to 3% of workbook Copying or scnning from ES workbooks is subject to the NZ Copyright ct which limits copying to 3%

More information

Section 9.2 Hyperbolas

Section 9.2 Hyperbolas Section 9. Hperols 597 Section 9. Hperols In the lst section, we lerned tht plnets hve pproimtel ellipticl orits round the sun. When n oject like comet is moving quickl, it is le to escpe the grvittionl

More information

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area: Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

ONU Calculus I Math 1631

ONU Calculus I Math 1631 ONU Clculus I Mth 1631 2013-2014 Syllus Mrs. Trudy Thompson tthompson@lcchs.edu Text: Clculus 8 th Edition, Anton, Bivens nd Dvis Prerequisites: C or etter in Pre-Clc nd techer s permission This course

More information

MA 124 (Calculus II) Lecture 2: January 24, 2019 Section A3. Professor Jennifer Balakrishnan,

MA 124 (Calculus II) Lecture 2: January 24, 2019 Section A3. Professor Jennifer Balakrishnan, Wht is on tody Professor Jennifer Blkrishnn, jbl@bu.edu 1 Velocity nd net chnge 1 2 Regions between curves 3 1 Velocity nd net chnge Briggs-Cochrn-Gillett 6.1 pp. 398-46 Suppose you re driving long stright

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

1-7 Inverse Relations and Functions

1-7 Inverse Relations and Functions Graph each function using a graphing calculator, and apply the horizontal line test to determine whether its inverse function exists. Write yes or no. 1. f (x) = x 2 + 6x + 9 The graph of f (x) = x 2 +

More information

Study Sheet ( )

Study Sheet ( ) Key Terms prol circle Ellipse hyperol directrix focus focl length xis of symmetry vertex Study Sheet (11.1-11.4) Conic Section A conic section is section of cone. The ellipse, prol, nd hyperol, long with

More information

Linear Programming. L.W. Dasanayake Department of Economics University of Kelaniya

Linear Programming. L.W. Dasanayake Department of Economics University of Kelaniya Linear Programming L.W. Dasanayake Department of Economics University of Kelaniya Linear programming (LP) LP is one of Management Science techniques that can be used to solve resource allocation problem

More information

UNIT 3B CREATING AND GRAPHING EQUATIONS Lesson 4: Solving Systems of Equations Instruction

UNIT 3B CREATING AND GRAPHING EQUATIONS Lesson 4: Solving Systems of Equations Instruction Prerequisite Skills This lesson requires the use of the following skills: graphing multiple equations on a graphing calculator graphing quadratic equations graphing linear equations Introduction A system

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

1.1 What is Microeconomics?

1.1 What is Microeconomics? 1.1 What is Microeconomics? Economics is the study of allocating limited resources to satisfy unlimited wants. Such a tension implies tradeoffs among competing goals. The analysis can be carried out at

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

MATH STUDENT BOOK. 12th Grade Unit 7

MATH STUDENT BOOK. 12th Grade Unit 7 MATH STUDENT BOOK 1th Grade Unit 7 Unit 7 POLAR COORDINATES MATH 107 POLAR COORDINATES INTRODUCTION 1. POLAR EQUATIONS 5 INTRODUCTION TO POLAR COORDINATES 5 POLAR EQUATIONS 1 POLAR CURVES 19 POLAR FORMS

More information

Properties. Comparing and Ordering Rational Numbers Using a Number Line

Properties. Comparing and Ordering Rational Numbers Using a Number Line Chapter 5 Summary Key Terms natural numbers (counting numbers) (5.1) whole numbers (5.1) integers (5.1) closed (5.1) rational numbers (5.1) irrational number (5.2) terminating decimal (5.2) repeating decimal

More information

arxiv: v1 [cs.cg] 1 Jun 2016

arxiv: v1 [cs.cg] 1 Jun 2016 HOW TO MORPH PLANAR GRAPH DRAWINGS Soroush Almdri, Ptrizio Angelini, Fidel Brrer-Cruz, Timothy M. Chn, Giordno D Lozzo, Giuseppe Di Bttist, Fbrizio Frti, Penny Hxell, Ann Lubiw, Murizio Ptrignni, Vincenzo

More information

GCSE 3300U30-1 MATHEMATICS UNIT 1: NON-CALCULATOR INTERMEDIATE TIER. FRIDAY, 10 NOVEMBER 2017 MORNING 1 hour 45 minutes NOV173300U30101.

GCSE 3300U30-1 MATHEMATICS UNIT 1: NON-CALCULATOR INTERMEDIATE TIER. FRIDAY, 10 NOVEMBER 2017 MORNING 1 hour 45 minutes NOV173300U30101. Surname Centre Number Candidate Number Other Names 0 GCSE 3300U30-1 A17-3300U30-1 MATHEMATICS UNIT 1: NON-CALCULATOR INTERMEDIATE TIER FRIDAY, 10 NOVEMBER 2017 MORNING 1 hour 45 minutes ADDITIONAL MATERIALS

More information

Research Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES

Research Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES Volume 2, 1977 Pges 349 353 http://topology.uburn.edu/tp/ Reserch Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES by J. A. Guthrie, H. E. Stone, nd M. L. Wge Topology Proceedings Web: http://topology.uburn.edu/tp/

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Textbook of Computable General Equilibrium Modelling

Textbook of Computable General Equilibrium Modelling Textbook of Computable General Equilibrium Modelling Programming and Simulations Nobuhiro Hosoe Kenji Gasawa and Hideo Hashimoto Contents Abbreviations Symbols in CGE Models Tables, Figures and Lists Preface

More information

2. Convex sets. x 1. x 2. affine set: contains the line through any two distinct points in the set

2. Convex sets. x 1. x 2. affine set: contains the line through any two distinct points in the set 2. Convex sets Convex Optimization Boyd & Vandenberghe affine and convex sets some important examples operations that preserve convexity generalized inequalities separating and supporting hyperplanes dual

More information

Section 18-1: Graphical Representation of Linear Equations and Functions

Section 18-1: Graphical Representation of Linear Equations and Functions Section 18-1: Graphical Representation of Linear Equations and Functions Prepare a table of solutions and locate the solutions on a coordinate system: f(x) = 2x 5 Learning Outcome 2 Write x + 3 = 5 as

More information

Application of optimal sampling lattices on CT image reconstruction and segmentation or three dimensional printing

Application of optimal sampling lattices on CT image reconstruction and segmentation or three dimensional printing Application of optimal sampling lattices on CT image reconstruction and segmentation or three dimensional printing XIQIANG ZHENG Division of Health and Natural Sciences, Voorhees College, Denmark, SC 29042

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Convex Optimization. Convex Sets. ENSAE: Optimisation 1/24

Convex Optimization. Convex Sets. ENSAE: Optimisation 1/24 Convex Optimization Convex Sets ENSAE: Optimisation 1/24 Today affine and convex sets some important examples operations that preserve convexity generalized inequalities separating and supporting hyperplanes

More information

Chapter 2 Sensitivity Analysis: Differential Calculus of Models

Chapter 2 Sensitivity Analysis: Differential Calculus of Models Chpter 2 Sensitivity Anlysis: Differentil Clculus of Models Abstrct Models in remote sensing nd in science nd engineering, in generl re, essentilly, functions of discrete model input prmeters, nd/or functionls

More information

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association 9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl

More information

What Is A Relation? Example. is a relation from A to B.

What Is A Relation? Example. is a relation from A to B. 3.3 Relations What Is A Relation? Let A and B be nonempty sets. A relation R from A to B is a subset of the Cartesian product A B. If R A B and if (a, b) R, we say that a is related to b by R and we write

More information

Math 165 Guided Activity to study ahead some concepts from sections 1.1 and 1.2 Name Section Distance and Midpoint Formula

Math 165 Guided Activity to study ahead some concepts from sections 1.1 and 1.2 Name Section Distance and Midpoint Formula Math 165 Guided Activity to study ahead some concepts from sections 1.1 and 1. Name Section 1.1 - Distance and Midpoint Formula Use the power point presentation for sections 1.1 and 1. to answer the following

More information

Course Summary Homework

Course Summary Homework Course Summary Homework (Max useful score: 100 - Available points: 210) 15-382: Collective Intelligence (Spring 2018) OUT: April 21, 2018, at 1:00am DUE: May 1, 2018 at 1pm - Available late days: 0 Instructions

More information

Toru Kikuchi Kobe University. Abstract

Toru Kikuchi Kobe University. Abstract Network externalities as a source of comparative advantage Toru Kikuchi Kobe University Abstract This note examines how the network externalities of communications activities and trading opportunities

More information