Assumptions. The Cournot Model. Assumptions. Assumptions. Assumptions. Assumptions. P An important assumption, the heart of the Cournot model. D.
|
|
- Aubrey Page
- 6 years ago
- Views:
Transcription
1 Assumptions Two firms A, nd B Mngeril Economics-Chrles W. Upton Assumptions Assumptions Two firms A, nd B The industry demnd function is P Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B P Q Q Assumptions Assumptions Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B Firm A tkes its demnd function s - B P b Q Two firms A, nd B The industry demnd function is Firm A produces ; firm B produces B Firm A tkes its demnd function s - B P An importnt ssumption, the hert of the Cournot model. b Q
2 Solving problem Solving problem MR MC Solving problem Symmetry p* Just s Firm A is choosing to mximize profits, so too is Firm B choosing B to mximize profits. MR MC * Symmetry Just s Firm A is choosing to mximize profits, so too is Firm B choosing B to mximize profits. If B chnges its output, A will rect by chnging its output. A Rection We do the mthemticl pproch first nd then the grphicl pproch.
3 A Rection The industry demnd function Q = 00 p. A Rection The industry demnd function Q = 00 p. The inverse demnd function is P = 50 (/)Q A Rection The industry demnd function Q = 00 p. The inverse demnd function is P = 50 (/)Q demnd function is then P = 50 (/)( + B ) A Rection demnd function is then P = 50 (/)( + B ) The firm s profits re p = P 5 A Rection demnd function is then P = 50 (/)( + B ) The firm s profits re π = [50 (/)( + B )] 5 A Rection p = [50 (/)( + B )] 5 3
4 A Rection A Rection π = [50 (/)( + B )] 5 π = 50 (/) (/) B 5 π = [50 (/)( + B )] 5 π = 50 (/) (/) B 5 π = (/) (/) B A Rection A Rection π = b π = dπ d = b b A Rection Symmetry dπ d = = b b = 0 = (/) B There is similr rection function for B B = (/) 4
5 Solving for Solving for = (/) B B = (/) = (/)[ (/) ] =.5 + (/4) = (/)[ (/) ] Solving for Solving for = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (4/3).5 Solving for A Grphicl Approch = (/)[ (/) ] =.5 + (/4) (3/4) =.5 = (4/3).5 = 30 B = 30 = (/) B We wnt to use the rection function to come to grphicl solution, 5
6 A Grphicl Approch A Grphicl Approch = (/) B When B produces nothing A should rect by producing the monopoly output (). = (/) B When B produces nothing A should rect by producing the monopoly output (). When B produces the output of the competitive industry (), A should rect by producing nothing. A Grphicl Approch = (/) B When B produces nothing A should rect by producing the monopoly output (). When B produces the output of the competitive industry (), A should rect by producing nothing. Similr rules pply for rections. Grphing the Rection Grphing the Rection If B produces nothing, A cts like monopoly If B produces the competitive output, A produces nothing. Grphing the Rection Rection 0 6
7 Grphing the Rection If A produces the competitive output, B produces nothing. If A produces nothing, B cts like monopoly. Rection Grphing the Rection Rection Rection Grphing the Rection If A nd B re off their rection functions, they rect nd chnge output. Here B expnds, A contrcts. Grphing the Rection Grphing the Rection If A is here, B wnts to be here Grphing the Rection If B is here, A wnts to be here 7
8 Euilibrium The Bsic Steps Rection Rection Plot the rection functions If B produces nothing, A behves like monopoly If B produces competitive output, A produces nothing Solve for their intersection End 003 Chrles W. Upton 8
4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationEssential Question What are some of the characteristics of the graph of a rational function?
8. TEXAS ESSENTIAL KNOWLEDGE AND SKILLS A..A A..G A..H A..K Grphing Rtionl Functions Essentil Question Wht re some of the chrcteristics of the grph of rtionl function? The prent function for rtionl functions
More information4.4. Vertical Differentiation Vertical Differentiation
Mtilde Mchdo Industril Orgniztion- Mtilde Mchdo Verticl Differentition 4.4. Verticl Differentition The Hotelling model studies situtions of horizontl differentition since for equl prices there re lwys
More informationEconS 301 Homework #8 Answer key
EconS 0 Homework #8 Answer key Exercise # Monopoly Consider a monopolist facing inverse demand function pp(qq) 5 qq, where qq denotes units of output. Assume that the total cost of this firm is TTTT(qq)
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationRicardain Model and Comparative Advantage! Chayun Tantivasadakarn! Faculty of Economics, Thammasat University!
Ricardain Model and Comparative Advantage! Chayun Tantivasadakarn! Faculty of Economics, Thammasat University! 1 Outline! Assumption Production Possibility Curves Autarky equilibrium Comparative advantage
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationChapter P: Preparation for Calculus
1. Which of the following is the correct graph of y = x x 3? E) Copyright Houghton Mifflin Company. All rights reserved. 1 . Which of the following is the correct graph of y = 3x x? E) Copyright Houghton
More informationLIMITS AND CONTINUITY
LIMITS AND CONTINUITY Joe McBride/Stone/Gett Imges Air resistnce prevents the velocit of skdiver from incresing indefinitel. The velocit pproches it, clled the terminl velocit. The development of clculus
More informationMany analog implementations of CPG exist, typically using operational amplifier or
FPGA Implementtion of Centrl Pttern Genertor By Jmes J Lin Introuction: Mny nlog implementtions of CPG exist, typiclly using opertionl mplifier or trnsistor level circuits. These types of circuits hve
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More information8.2 Areas in the Plane
39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to
More informationAccelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes. In 1.1, we discussed using t-charts to help graph functions. e.g.
Accelerated Precalculus 1.2 (Intercepts and Symmetry) Day 1 Notes In 1.1, we discussed using t-charts to help graph functions. e.g., Graph: y = x 3 What are some other strategies that can make graphing
More informationLinear Cournot Duopoly
Linear Cournot Duopoly Definition p = a - b q + q2 ; Q = q + q2; π = p - c q; π2 = p - c2 q2; CS = 2 b q + q2 ^2; PS = π + π2; SW = CS + PS; Calculating Equilibrium FOCs are D[π, q]; FOCDuoq = % D[π2,
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More information1.1 Lines AP Calculus
. Lines AP Clculus. LINES Notecrds from Section.: Rules for Rounding Round or Truncte ll finl nswers to 3 deciml plces. Do NOT round before ou rech our finl nswer. Much of Clculus focuses on the concept
More informationThe Reciprocal Function Family. Objectives To graph reciprocal functions To graph translations of reciprocal functions
- The Reciprocl Function Fmil Objectives To grph reciprocl functions To grph trnsltions of reciprocl functions Content Stndrds F.BF.3 Identif the effect on the grph of replcing f () b f() k, kf(), f(k),
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationWHAT YOU SHOULD LEARN
GRAPHS OF EQUATIONS WHAT YOU SHOULD LEARN Sketch graphs of equations. Find x- and y-intercepts of graphs of equations. Use symmetry to sketch graphs of equations. Find equations of and sketch graphs of
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationTool Vendor Perspectives SysML Thus Far
Frontiers 2008 Pnel Georgi Tec, 05-13-08 Tool Vendor Perspectives SysML Thus Fr Hns-Peter Hoffmnn, Ph.D Chief Systems Methodologist Telelogic, Systems & Softwre Modeling Business Unit Peter.Hoffmnn@telelogic.com
More informationLily Yen and Mogens Hansen
SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationFinding the axis of symmetry, vertex, and roots of a parabola
Finding the axis of symmetry, vertex, and roots of a parabola 1) Find the Axis of Symmetry of y = x 2-4x + 3 (The AOS is the vertical line that splits the parabola in 2 equal parts) Axis of Symmetry Axis
More informationarxiv: v2 [math.ho] 4 Jun 2012
Volumes of olids of Revolution. Unified pproch Jorge Mrtín-Morles nd ntonio M. Oller-Mrcén jorge@unizr.es, oller@unizr.es rxiv:5.v [mth.ho] Jun Centro Universitrio de l Defens - IUM. cdemi Generl Militr,
More informationConstrained Optimization
Constrained Optimization Dudley Cooke Trinity College Dublin Dudley Cooke (Trinity College Dublin) Constrained Optimization 1 / 46 EC2040 Topic 5 - Constrained Optimization Reading 1 Chapters 12.1-12.3
More informationMath 17 - Review. Review for Chapter 12
Mth 17 - eview Ying Wu eview for hpter 12 1. Given prmetric plnr curve x = f(t), y = g(t), where t b, how to eliminte the prmeter? (Use substitutions, or use trigonometry identities, etc). How to prmeterize
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationOPUC Transmission Workshop 2 FERC Pro Forma Transmission
OPUC Transmission Workshop 2 FERC Pro Forma Transmission Eric Christensen, Cairncross & Hempelmann Karen Kruse, PacifiCorp February 28, 2019 Background of FERC Pro Forma Documents (Refresher from morning
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationPRECALCULUS I/MATH 126 (2188) SHANNON MYERS
PRECALCULUS I/MATH 126 (2188) SHANNON MYERS π 100 POINTS POSSIBLE π YOUR WORK MUST SUPPORT YOUR ANSWER FOR FULL CREDIT TO BE AWARDED π YOU MAY USE A SCIENTIFIC AND/OR A TI-83/84/85/86 CALCULATOR π PROVIDE
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More information1. Represent each of these relations on {1, 2, 3} with a matrix (with the elements of this set listed in increasing order).
Exercises Exercises 1. Represent each of these relations on {1, 2, 3} with a matrix (with the elements of this set listed in increasing order). a) {(1, 1), (1, 2), (1, 3)} b) {(1, 2), (2, 1), (2, 2), (3,
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationThis unit is built upon your knowledge and understanding of the right triangle trigonometric ratios. A memory aid that is often used was SOHCAHTOA.
Angular Rotations This unit is built upon your knowledge and understanding of the right triangle trigonometric ratios. A memory aid that is often used was SOHCAHTOA. sin x = opposite hypotenuse cosx =
More informationPreserving Constraints for Aggregation Relationship Type Update in XML Document
Preserving Constrints for Aggregtion Reltionship Type Updte in XML Document Eric Prdede 1, J. Wenny Rhyu 1, nd Dvid Tnir 2 1 Deprtment of Computer Science nd Computer Engineering, L Trobe University, Bundoor
More informationA Transportation Problem Analysed by a New Ranking Method
(IJIRSE) Interntionl Journl of Innovtive Reserch in Science & Engineering ISSN (Online) 7-07 A Trnsporttion Problem Anlysed by New Rnking Method Dr. A. Shy Sudh P. Chinthiy Associte Professor PG Scholr
More informationA Heuristic Approach for Discovering Reference Models by Mining Process Model Variants
A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl
More informationKansas City Area Teachers of Mathematics 2018 KCATM Math Competition
Kansas City Area Teachers of Mathematics 2018 KCATM Math Competition GEOMETRY AND MEASUREMENT TEST GRADE 6 #51-90 INSTRUCTIONS Do not open this booklet until instructed to do so. Time limit: 20 minutes
More informationCS 268: IP Multicast Routing
Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationA. Lesson Context. B. Lesson Objectives. C. Fast Five (Skills Review Focus)
A. Lesson Context BIG PICTURE of this UNIT: How & why do we build NEW knowledge in Mathematics? What NEW IDEAS & NEW CONCEPTS can we now explore with specific references to QUADRATIC FUNCTIONS? How can
More informationLecture 17: Continuous Functions
Lecture 17: Continuous Functions 1 Continuous Functions Let (X, T X ) and (Y, T Y ) be topological spaces. Definition 1.1 (Continuous Function). A function f : X Y is said to be continuous if the inverse
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More informationMatrices and Systems of Equations
Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.
More informationPS 6: Regularization. PART A: (Source: HTF page 95) The Ridge regression problem is:
Economics 1660: Big Data PS 6: Regularization Prof. Daniel Björkegren PART A: (Source: HTF page 95) The Ridge regression problem is: : β "#$%& = argmin (y # β 2 x #4 β 4 ) 6 6 + λ β 4 #89 Consider the
More informationDouble Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals
Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls
More informationAngle properties of lines and polygons
chievement Stndrd 91031 pply geometric resoning in solving problems Copy correctly Up to 3% of workbook Copying or scnning from ES workbooks is subject to the NZ Copyright ct which limits copying to 3%
More informationSection 9.2 Hyperbolas
Section 9. Hperols 597 Section 9. Hperols In the lst section, we lerned tht plnets hve pproimtel ellipticl orits round the sun. When n oject like comet is moving quickl, it is le to escpe the grvittionl
More informationArea & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:
Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationSubtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
More informationONU Calculus I Math 1631
ONU Clculus I Mth 1631 2013-2014 Syllus Mrs. Trudy Thompson tthompson@lcchs.edu Text: Clculus 8 th Edition, Anton, Bivens nd Dvis Prerequisites: C or etter in Pre-Clc nd techer s permission This course
More informationMA 124 (Calculus II) Lecture 2: January 24, 2019 Section A3. Professor Jennifer Balakrishnan,
Wht is on tody Professor Jennifer Blkrishnn, jbl@bu.edu 1 Velocity nd net chnge 1 2 Regions between curves 3 1 Velocity nd net chnge Briggs-Cochrn-Gillett 6.1 pp. 398-46 Suppose you re driving long stright
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More information1-7 Inverse Relations and Functions
Graph each function using a graphing calculator, and apply the horizontal line test to determine whether its inverse function exists. Write yes or no. 1. f (x) = x 2 + 6x + 9 The graph of f (x) = x 2 +
More informationStudy Sheet ( )
Key Terms prol circle Ellipse hyperol directrix focus focl length xis of symmetry vertex Study Sheet (11.1-11.4) Conic Section A conic section is section of cone. The ellipse, prol, nd hyperol, long with
More informationLinear Programming. L.W. Dasanayake Department of Economics University of Kelaniya
Linear Programming L.W. Dasanayake Department of Economics University of Kelaniya Linear programming (LP) LP is one of Management Science techniques that can be used to solve resource allocation problem
More informationUNIT 3B CREATING AND GRAPHING EQUATIONS Lesson 4: Solving Systems of Equations Instruction
Prerequisite Skills This lesson requires the use of the following skills: graphing multiple equations on a graphing calculator graphing quadratic equations graphing linear equations Introduction A system
More informationLecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure
Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound
More information1.1 What is Microeconomics?
1.1 What is Microeconomics? Economics is the study of allocating limited resources to satisfy unlimited wants. Such a tension implies tradeoffs among competing goals. The analysis can be carried out at
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationMATH STUDENT BOOK. 12th Grade Unit 7
MATH STUDENT BOOK 1th Grade Unit 7 Unit 7 POLAR COORDINATES MATH 107 POLAR COORDINATES INTRODUCTION 1. POLAR EQUATIONS 5 INTRODUCTION TO POLAR COORDINATES 5 POLAR EQUATIONS 1 POLAR CURVES 19 POLAR FORMS
More informationProperties. Comparing and Ordering Rational Numbers Using a Number Line
Chapter 5 Summary Key Terms natural numbers (counting numbers) (5.1) whole numbers (5.1) integers (5.1) closed (5.1) rational numbers (5.1) irrational number (5.2) terminating decimal (5.2) repeating decimal
More informationarxiv: v1 [cs.cg] 1 Jun 2016
HOW TO MORPH PLANAR GRAPH DRAWINGS Soroush Almdri, Ptrizio Angelini, Fidel Brrer-Cruz, Timothy M. Chn, Giordno D Lozzo, Giuseppe Di Bttist, Fbrizio Frti, Penny Hxell, Ann Lubiw, Murizio Ptrignni, Vincenzo
More informationGCSE 3300U30-1 MATHEMATICS UNIT 1: NON-CALCULATOR INTERMEDIATE TIER. FRIDAY, 10 NOVEMBER 2017 MORNING 1 hour 45 minutes NOV173300U30101.
Surname Centre Number Candidate Number Other Names 0 GCSE 3300U30-1 A17-3300U30-1 MATHEMATICS UNIT 1: NON-CALCULATOR INTERMEDIATE TIER FRIDAY, 10 NOVEMBER 2017 MORNING 1 hour 45 minutes ADDITIONAL MATERIALS
More informationResearch Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES
Volume 2, 1977 Pges 349 353 http://topology.uburn.edu/tp/ Reserch Announcement: MAXIMAL CONNECTED HAUSDORFF TOPOLOGIES by J. A. Guthrie, H. E. Stone, nd M. L. Wge Topology Proceedings Web: http://topology.uburn.edu/tp/
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationTextbook of Computable General Equilibrium Modelling
Textbook of Computable General Equilibrium Modelling Programming and Simulations Nobuhiro Hosoe Kenji Gasawa and Hideo Hashimoto Contents Abbreviations Symbols in CGE Models Tables, Figures and Lists Preface
More information2. Convex sets. x 1. x 2. affine set: contains the line through any two distinct points in the set
2. Convex sets Convex Optimization Boyd & Vandenberghe affine and convex sets some important examples operations that preserve convexity generalized inequalities separating and supporting hyperplanes dual
More informationSection 18-1: Graphical Representation of Linear Equations and Functions
Section 18-1: Graphical Representation of Linear Equations and Functions Prepare a table of solutions and locate the solutions on a coordinate system: f(x) = 2x 5 Learning Outcome 2 Write x + 3 = 5 as
More informationApplication of optimal sampling lattices on CT image reconstruction and segmentation or three dimensional printing
Application of optimal sampling lattices on CT image reconstruction and segmentation or three dimensional printing XIQIANG ZHENG Division of Health and Natural Sciences, Voorhees College, Denmark, SC 29042
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationConvex Optimization. Convex Sets. ENSAE: Optimisation 1/24
Convex Optimization Convex Sets ENSAE: Optimisation 1/24 Today affine and convex sets some important examples operations that preserve convexity generalized inequalities separating and supporting hyperplanes
More informationChapter 2 Sensitivity Analysis: Differential Calculus of Models
Chpter 2 Sensitivity Anlysis: Differentil Clculus of Models Abstrct Models in remote sensing nd in science nd engineering, in generl re, essentilly, functions of discrete model input prmeters, nd/or functionls
More information9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association
9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl
More informationWhat Is A Relation? Example. is a relation from A to B.
3.3 Relations What Is A Relation? Let A and B be nonempty sets. A relation R from A to B is a subset of the Cartesian product A B. If R A B and if (a, b) R, we say that a is related to b by R and we write
More informationMath 165 Guided Activity to study ahead some concepts from sections 1.1 and 1.2 Name Section Distance and Midpoint Formula
Math 165 Guided Activity to study ahead some concepts from sections 1.1 and 1. Name Section 1.1 - Distance and Midpoint Formula Use the power point presentation for sections 1.1 and 1. to answer the following
More informationCourse Summary Homework
Course Summary Homework (Max useful score: 100 - Available points: 210) 15-382: Collective Intelligence (Spring 2018) OUT: April 21, 2018, at 1:00am DUE: May 1, 2018 at 1pm - Available late days: 0 Instructions
More informationToru Kikuchi Kobe University. Abstract
Network externalities as a source of comparative advantage Toru Kikuchi Kobe University Abstract This note examines how the network externalities of communications activities and trading opportunities
More information