Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv

Size: px
Start display at page:

Download "Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv"

Transcription

1 Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013

2 What Is in Our Data Set? Illumina TruSight Autism Rapid Capture solution capture of exons from 101 genes MiSeq 150 base, paired end reads cd ~/autism $ sample2_r1.fastq head $ sample2_r2.fastq head $ fastqc sample2_r1.fastq $ wc -l sample2_r2.fastq 216,362 reads How do we know if both reads the same? Sample million read pairs Sample million read pairs illumina.com/clinical/translational_genomics/product/trusight_autism.ilmn 2

3 The Mapping Problem? GOALS Find match quickly Find true match Avoid missing a match COMPLICATIONS Large genome, many reads Paralogs, pseudo-genes, repeats Sequencing errors, polymorphisms 3

4 $ bowtie2 Indices Address the Computational Complexity of Mapping Reads No index, query, or output file specified! Bowtie 2 version by Ben Langmead (langmea@cs.jhu.edu, Usage: bowtie2 [options]* -x <bt2-idx> {-1 <m1> -2 <m2> -U <r>} [-S <sam>] <bt2-idx> Index filename prefix (minus trailing.x.bt2). NOTE: Bowtie 1 and Bowtie 2 indexes are not compatible. Which genome? Langmead, B, et al., 2009 Genome Biology; Langmead and Salzberg, 2012 Nature Methods 4

5 Build a Custom Reference Database $ cd ~/genomes $ head autism101.fa $ tail autism101.fa How do we verify that we have the correct number of genes? $ grep ">" autism101.fa more $ grep ">" autism101.fa wc $ bowtie2-build autism101.fa AUTISM101 $ ls 5

6 Map Reads to Reference with Bowtie2 $ cd ~/autism $ bowtie2 -x ~/genomes/autism101-1 sample2_r1.fastq -2 sample2_r2.fastq -S sample2.sam reads; of these: (100.00%) were paired; of these: (29.99%) aligned concordantly 0 times (68.63%) aligned concordantly exactly 1 time 2999 (1.39%) aligned concordantly >1 times pairs aligned concordantly 0 times; of these: (20.56%) aligned discordantly 1 time pairs aligned 0 times concordantly or discordantly; of these: mates make up the pairs; of these: (94.07%) aligned 0 times 5008 (4.86%) aligned exactly 1 time 1103 (1.07%) aligned >1 times 77.59% overall alignment rate 6

7 SAM Stores Alignments and Reads $ wc -l sample2.sam $ less -S VN:1.0 SN:NEGR1 SN:NTNG1 ID:bowtie2 PN:bowtie2 VN:2.1.0 M RAI M = AAGGT... AS:i:-9 XN:i:0 XM:i... M RAI M = NTTTC... AS:i:-19 XN:i:0 XM:i... M SHANK M = GGGAA... AS:i:0 XN:i:0 XM:i... M SHANK M = NGGAA... AS:i:-1 XN:i:0 XM:i... M EHMT M = ACTCA... AS:i:0 XN:i:0 XM:i... M EHMT M = NCTCA... AS:i:-1 XN:i:0 XM:i... samtools.sourceforge.net/sam1.pdf 7

8 A Utility That explains SAM flags in plain English picard.sourceforge.net/explain-flags.html 8

9 Bowtie2 Manual Details Fields bowtie-bio.sourceforge.net/bowtie2/manual.shtml 9

10 Manipulate SAM/BAM Files with SAMtools $ samtools Program: samtools (Tools for alignments in the SAM format) Version: cd Usage: samtools <command> [options] Command: view sort mpileup depth faidx tview index SAM<->BAM conversion sort alignment file multi-way pileup compute the depth index/extract FASTA text alignment viewer index alignment Li, et al., 2009 Bioinformatics 10

11 Determine Why Reads Unmapped $ samtools view -Sf 12 sample2.sam less -S M * 0 0 * * 0 0 AGACAGTGTTTCACCATGCTGGCCAGACTGGTCTCGAACTCCTGATCTCAGGCAGTC M * 0 0 * * 0 0 NCGGTAGCTCAAGCCTGTAATCCCAACACTTTGGGAGGCCGAGGCGGGGGGGGCGCC M * 0 0 * * 0 0 CCACAAAGATGTTCATCATGAAGAAAGCTACAATGATGATGTAGATGATGAAGAAGA M * 0 0 * * 0 0 GGGAAGGCAGCGGGCTGGGCCGTGTGGGCTGGGGGGCTTGGCAGGTCCTCACTTGGT M * 0 0 * * 0 0 GTCTCCTTCCATGCTAGAAGGAGACTTCCAGGCTGGAGGAAGAGGAGGCTTCCTCCC 11

12 Quickly Extract Sorted, Indexed BAMs $ samtools view -bs sample2.sam > sample2.bam $ samtools sort sample2.bam sample2_sorted $ samtools index sample2_sorted.bam $ samtools view sample2_sorted.bam PTEN: less -S M PTEN M4D36M = CCACCATCCAGCAGC M PTEN M4D49M = GCTGCTGCCGCAGCC M PTEN M = CCGCAGCAGCCATTA M PTEN M = GCCATTACCCGGCTG M PTEN M4D62M = GCCATTACCCGGCTG M PTEN M4D62M = GCCATTACCCGGGTG M PTEN M4D62M = GCCATTACCCGGCTG M PTEN M = TTACCCGGCTGCGGT M PTEN M = TTACCCGGCTGCGGT M PTEN M4D76M = GCGGTCCAGAGCCAA 12

13 High-Performance Genomics Data Visualization and Exploration $ scp workshop@ :autism/sample2_sorted.bam*. $ scp workshop@ :genomes/autism101.fa. Robinson, et al., 2011 Nature Biotechnology 13

Quantitative Biology Bootcamp Intro to RNA-seq

Quantitative Biology Bootcamp Intro to RNA-seq Quantitative Biology Bootcamp Intro to RNA-seq Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology 2 September 2014 RNA-seq Analysis Pipeline Quality

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1

PG2014. Open Your Favorite Note Taking Program. Connect to Your Personal Bioinformatics Server. Open a Web Browser. View Reads Mapping to AZU1 Open Your Favorite Note Taking Program TextEdit.app WordPad Connect to Your Personal Bioinformatics Server Start VirtualBox Start PG2014 Minimize window Connect via SSH using Terminal.app or PuTTY View

More information

SAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call

SAMtools.   SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19

More information

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

RCAC. Job files Example: Running seqyclean (a module)

RCAC. Job files Example: Running seqyclean (a module) RCAC Job files Why? When you log into an RCAC server you are using a special server designed for multiple users. This is called a frontend node ( or sometimes a head node). There are (I think) three front

More information

TP RNA-seq : Differential expression analysis

TP RNA-seq : Differential expression analysis TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

More information

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012

SAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012 SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................

More information

Perl for Biologists. Session 8. April 30, Practical examples. (/home/jarekp/perl_08) Jon Zhang

Perl for Biologists. Session 8. April 30, Practical examples. (/home/jarekp/perl_08) Jon Zhang Perl for Biologists Session 8 April 30, 2014 Practical examples (/home/jarekp/perl_08) Jon Zhang Session 8: Examples CBSU Perl for Biologists 1.1 1 Review of Session 7 Regular expression: a specific pattern

More information

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)

Introduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013) Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

An Introduction to Linux and Bowtie

An Introduction to Linux and Bowtie An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Lecture 12. Short read aligners

Lecture 12. Short read aligners Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.

Merge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p. Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010

Next generation sequencing: assembly by mapping reads. Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Next generation sequencing: assembly by mapping reads Laurent Falquet, Vital-IT Helsinki, June 3, 2010 Overview What is assembly by mapping? Methods BWT File formats Tools Issues Visualization Discussion

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Reads Alignment and Variant Calling

Reads Alignment and Variant Calling Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Read Mapping and Variant Calling

Read Mapping and Variant Calling Read Mapping and Variant Calling Whole Genome Resequencing Sequencing mul:ple individuals from the same species Reference genome is already available Discover varia:ons in the genomes between and within

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder

WM2 Bioinformatics. ExomeSeq data analysis part 1. Dietmar Rieder WM2 Bioinformatics ExomeSeq data analysis part 1 Dietmar Rieder RAW data Use putty to logon to cluster.i med.ac.at In your home directory make directory to store raw data $ mkdir 00_RAW Copy raw fastq

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016

SAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP) Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Bioinformatics in next generation sequencing projects

Bioinformatics in next generation sequencing projects Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James

More information

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems. Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

NGS Analyses with Galaxy

NGS Analyses with Galaxy 1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism

More information

Handling sam and vcf data, quality control

Handling sam and vcf data, quality control Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

Aligners. J Fass 21 June 2017

Aligners. J Fass 21 June 2017 Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21

More information

Quantitative Biology Bootcamp Intro to Unix: Command Line Interface

Quantitative Biology Bootcamp Intro to Unix: Command Line Interface Quantitative Biology Bootcamp Intro to Unix: Command Line Interface Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology 2 September 2014 Running

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

Read Mapping. Slides by Carl Kingsford

Read Mapping. Slides by Carl Kingsford Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology

More information

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there:

Our data for today is a small subset of Saimaa ringed seal RNA sequencing data (RNA_seq_reads.fasta). Let s first see how many reads are there: Practical Course in Genome Bioinformatics 19.2.2016 (CORRECTED 22.2.2016) Exercises - Day 5 http://ekhidna.biocenter.helsinki.fi/downloads/teaching/spring2016/ Answer the 5 questions (Q1-Q5) according

More information

Genome Assembly: Preliminary Results

Genome Assembly: Preliminary Results Genome Assembly: Preliminary Results February 3, 2014 Devin Cline Krutika Gaonkar Smitha Janardan Karthikeyan Murugesan Emily Norris Ying Sha Eshaw Vidyaprakash Xingyu Yang Topics 1. Pipeline Review 2.

More information

Practical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State

Practical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential

More information

Evaluate NimbleGen SeqCap RNA Target Enrichment Data

Evaluate NimbleGen SeqCap RNA Target Enrichment Data Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Mapping reads to a reference genome

Mapping reads to a reference genome Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on

More information

Beyond the Genome: Cloud-scale computing demo

Beyond the Genome: Cloud-scale computing demo Beyond the Genome: Cloud-scale computing demo Michael Schatz, Ben Langmead, & James Taylor Sept. 19, 2011 Beyond the Genome Beyond the Genome Challenge http://schatzlab.cshl.edu/data/btg11.tgz http://aws.amazon.com/awscredits

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

RNASeq2017 Course Salerno, September 27-29, 2017

RNASeq2017 Course Salerno, September 27-29, 2017 RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials

More information

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity

More information

Connect to login8.stampede.tacc.utexas.edu. Sample Datasets

Connect to login8.stampede.tacc.utexas.edu. Sample Datasets Alignment Overview Connect to login8.stampede.tacc.utexas.edu Sample Datasets Reference Genomes Exercise #1: BWA global alignment Yeast ChIP-seq Overview ChIP-seq alignment workflow with BWA Introducing

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

Dindel User Guide, version 1.0

Dindel User Guide, version 1.0 Dindel User Guide, version 1.0 Kees Albers University of Cambridge, Wellcome Trust Sanger Institute caa@sanger.ac.uk October 26, 2010 Contents 1 Introduction 2 2 Requirements 2 3 Optional input 3 4 Dindel

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

The SAM Format Specification (v1.3-r837)

The SAM Format Specification (v1.3-r837) The SAM Format Specification (v1.3-r837) The SAM Format Specification Working Group November 18, 2010 1 The SAM Format Specification SAM stands for Sequence Alignment/Map format. It is a TAB-delimited

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads

More information

Part 1: How to use IGV to visualize variants

Part 1: How to use IGV to visualize variants Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

arxiv: v2 [q-bio.gn] 13 May 2014

arxiv: v2 [q-bio.gn] 13 May 2014 BIOINFORMATICS Vol. 00 no. 00 2005 Pages 1 2 Fast and accurate alignment of long bisulfite-seq reads Brent S. Pedersen 1,, Kenneth Eyring 1, Subhajyoti De 1,2, Ivana V. Yang 1 and David A. Schwartz 1 1

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

NGS FASTQ file format

NGS FASTQ file format NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see

More information

Introduction to Linux & UPPMAX

Introduction to Linux & UPPMAX Uppsala University Introduction to Linux & UPPMAX Martin Dahlö martin.dahlo@scilifelab.uu.se Marcus Holm marcus.holm@it.uu.se August 8, 2017 Contents 1 Linux Introduction........................ 1 1.1

More information

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide. BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

m6aviewer Version Documentation

m6aviewer Version Documentation m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Benchmarking of RNA-seq aligners

Benchmarking of RNA-seq aligners Lecture 17 RNA-seq Alignment STAR Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Based on this analysis the most reliable

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

How to map millions of short DNA reads produced by Next-Gen Sequencing instruments onto a reference genome

How to map millions of short DNA reads produced by Next-Gen Sequencing instruments onto a reference genome How to map millions of short DNA reads produced by Next-Gen Sequencing instruments onto a reference genome Stratos Efstathiadis stratos@nyu.edu Slides are from Cole Trapneli, Steven Salzberg, Ben Langmead,

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

Bioinformatics for High-throughput Sequencing

Bioinformatics for High-throughput Sequencing Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput

More information

DNA / RNA sequencing

DNA / RNA sequencing Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using

More information

Read Naming Format Specification

Read Naming Format Specification Read Naming Format Specification Karel Břinda Valentina Boeva Gregory Kucherov Version 0.1.3 (4 August 2015) Abstract This document provides a standard for naming simulated Next-Generation Sequencing (Ngs)

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

Aligners. J Fass 23 August 2017

Aligners. J Fass 23 August 2017 Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23

More information

A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing

A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing Song Liu 1,2, Yi Wang 3, Fei Wang 1,2 * 1 Shanghai Key Lab of Intelligent Information Processing, Shanghai, China. 2 School

More information

UMass High Performance Computing Center

UMass High Performance Computing Center UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every

More information