Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs

Size: px
Start display at page:

Download "Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs"

Transcription

1 Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the We s University Grph of Kolenz-Lndu, Germny 52

2 Completing this unit you should Be le to red nd uild n djeny mtrix of grph Know some si mtrix vetor multiplitions to generte some sttistis out of the djeny mtrix Understnd wht is enoded in the omponents of the k-th power of the Adjeny mtrix of grph Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 53

3 A met model for grph sed models Wht does simple Wikipedi look like? modelling interpreting Grph s model modelling lulting Desriptive sttistis interpreting Vetor spe model lulting Mtrix lultions Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 54

4 Modelling grphs with liner lger Given this grph G Whih of the following is n djeny mtrix for G? A = C A B A D A Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 55

5 All four mtries represent the sme grph! Mtries re not the sme How n we mke sure to tlk out the sme thing? A = C A B A D A Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 56

6 Fix se of our vetor spe We hve out grph With set of verties We hve our Vetor spe With set of se vetors V = {,, } Without loosing generlity we n hoose unit vetors ~e A ~e 2 A ~e 3 A V = { ~e, ~e 2, ~e 3 } Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 57

7 Defining the djeny mtrix Fix se i.e. define: hoose f se : V! V With V = {,, } nd V = { ~e, ~e 2, ~e 3 } And f se must e ijetive f se ({x, y}) =f se (x)+f se (y) For exmple one hoie might e f se () = ~e f se () = ~e 2 f se () = ~e 3 ~e ~e 2 ~e 3 Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 58

8 Defining the djeny mtrix Fix se i.e. define: hoose f se : V! V With V = {,, } nd V = { ~e, ~e 2, ~e 3 } And f se must e ijetive f se ({x, y}) =f se (x)+f se (y) For exmple one hoie might e Py ttention: Nottion is somehow sloppy. Here f is not defined on sets. f se () = ~e f se () = ~e 2 f se () = ~e 3 ~e ~e 2 ~e 3 Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 59

9 Defining the djeny mtrix (II) We re looking for mtrix A : V! V suh tht A(f se ()) = f se (In()) ~e ~e 2 ~e 3 Don t pni! A just enodes the outlink of every vertex It is mde in wy tht it respets the hoie of our se Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 6

10 Exmple A(f se ()) = f se A A! A ~e = ~e 2 ~e ~e 2 ~e 3 Multiplying mtrix with the i-th se vetor from right gives the i-th olumn! Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 6

11 Exmple A(f se ()) = f se A A! A ~e = ~e A A! A ~e 2 = A A! A ~e 3 = ~e 2 ~e ~e 2 ~e 3 For eh multiplition the result is the vetors of nodes represnting in links Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 62

12 Similrly for out nodes we get Left multiply with se vetor Result is vetor representing ~e ~e 2 ~e A =! ~e t 2 A = ~e t t + ~e 3 fse() = ~e2 fse() = ~e Out() ={, } f se () = ~e 3 Multiplying mtrix with the i-th se vetor from left gives the i-th row! Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 63

13 Wht hppens if A is pplied severl times? We sw pply it one to se vetor yields ll neighours linking in or out Neighours n e seen s pths of lenght Eh omponent ounts how mny pths of length exist from to the node of the omponent ~e i t So wht does ~e i t A k represent? Wht out? A k ~e i Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 64

14 Wht hppens if A is pplied severl times? represents ~e i t A k A vetor where in eh ompnent is the numer of pths of length k from the node represented y to the node represented y tht omponent. ~e i t represents A k ~e i A vetor where in eh ompnent is the numer of pths of length k to the node represented y ~e i from the node represented y tht omponent Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 65

15 Quiz question! Who is still with me (: If A represents the djeny mtrix of the strongly onneted omponent of Simiple English Wikipedi For wht power of k will A k hve no zero entries? Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 66

16 Degree distriution multiply with ounting vetor we get ~e ~e 2 ~e A = =~e t +~e t t 2 +~e 3 In degree distriution Counting A 2A =~e +2~e 2 +~e 3 Out degree distriution Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 67

17 Thnk you for your ttention! Contt: Rene Pikhrdt Institute for We Siene nd Tehnologies Universität Kolenz-Lndu Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the We s University Grph of Kolenz-Lndu, Germny 68

18 Pitures: By User:AzToth (Imge:6n-grf.png simlr input dt) [Puli domin], vi Wikimedi Commons Puli domin By MistWiz (Own work) [Puli domin], vi Wikimedi Commons By Pluke (Own work) [CC], vi Wikimedi Commons By Lkeworks (Own work) [GFDL ( or CC BY-SA ( retiveommons.org/lienses/y-s/ )], vi Wikimedi Commons By Houl78 (Own work) [CC], vi Wikimedi Commons By MrtinThom (Own work) [GFDL ( or CC BY 3. ( retiveommons.org/lienses/y/3.)], vi Wikimedi Commons direted_network_svg.svg By Limner (Own work) [CC BY-SA 4. ( retiveommons.org/lienses/y-s/4.)], vi Wikimedi Commons By Reidpth [Puli domin], vi Wikimedi Commons vi flikr CC-BY 2. y Dnny Sullivn Grph sttistis vi puli domin puli domin (definition of world wide we) By Sestin Shelter [CC BY-SA 3. ( lienses/y-s/3.)], vi Wikimedi Commons Chris 73 / Wikimedi Commons [GFDL.3 ( or CC BY-SA 3. ( vi Wikimedi Commons By Mnipnde (Own work) [CC BY-SA 3. ( vi Wikimedi Commons vi Flikr nd Vlerie Everett CC-BY-SA y CSTAR & Oleg Alexndrov By Alemonroy (Own work) [GFDL ( or CC BY 3. ( retiveommons.org/lienses/y/3.)], vi Wikimedi Commons Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 69

Fundamentals of Engineering Analysis ENGR Matrix Multiplication, Types

Fundamentals of Engineering Analysis ENGR Matrix Multiplication, Types Fundmentls of Engineering Anlysis ENGR - Mtri Multiplition, Types Spring Slide Mtri Multiplition Define Conformle To multiply A * B, the mtries must e onformle. Given mtries: A m n nd B n p The numer of

More information

Lesson6: Modeling the Web as a graph Unit4: Topology of the Web graph

Lesson6: Modeling the Web as a graph Unit4: Topology of the Web graph Lesson6: Modeling the Web as a graph Unit4: Topology of the Web graph Rene Pickhardt Introduction to Web Science Part 2 Emerging Web Properties Rene Pickhardt Institute CC-BY-SA-3.0 for Web Science and

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Lecture 12 : Topological Spaces

Lecture 12 : Topological Spaces Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Honors Thesis: Investigating the Algebraic Properties of Cayley Digraphs

Honors Thesis: Investigating the Algebraic Properties of Cayley Digraphs Honors Thesis: Investigting the Algebri Properties of Cyley Digrphs Alexis Byers, Wittenberg University Mthemtis Deprtment April 30, 2014 This pper utilizes Grph Theory to gin insight into the lgebri struture

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v. Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

[SYLWAN., 158(6)]. ISI

[SYLWAN., 158(6)]. ISI The proposl of Improved Inext Isomorphi Grph Algorithm to Detet Design Ptterns Afnn Slem B-Brhem, M. Rizwn Jmeel Qureshi Fulty of Computing nd Informtion Tehnology, King Adulziz University, Jeddh, SAUDI

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

Tight triangulations: a link between combinatorics and topology

Tight triangulations: a link between combinatorics and topology Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Duality in linear interval equations

Duality in linear interval equations Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

Architecture and Data Flows Reference Guide

Architecture and Data Flows Reference Guide Arhiteture nd Dt Flows Referene Guide BlkBerry UEM Version 12.7 Pulished: 2017-07-12 SWD-20170627140413745 Contents Aout this guide... 5 Arhiteture: BlkBerry UEM solution... 6 BlkBerry UEM omponents...

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

5/9/17. Lesson 51 - FTC PART 2. Review FTC, PART 1. statement as the Integral Evaluation Theorem as it tells us HOW to evaluate the definite integral

5/9/17. Lesson 51 - FTC PART 2. Review FTC, PART 1. statement as the Integral Evaluation Theorem as it tells us HOW to evaluate the definite integral Lesson - FTC PART 2 Review! We hve seen definition/formul for definite integrl s n b A() = lim f ( i )Δ = f ()d = F() = F(b) F() n i=! where F () = f() (or F() is the ntiderivtive of f() b! And hve seen

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

style type="text/css".wpb_animate_when_almost_visible { opacity: 1; }/style

style type=text/css.wpb_animate_when_almost_visible { opacity: 1; }/style style type="text/css".wpb_nimte_when_lmost_vible { opcity: 1; }/style You cn chrome homepge for internet explorer quickly chrome homepge for internet explorer get chrome homepge for internet explorer every

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Compilers. Chapter 4: Syntactic Analyser. 3 er course Spring Term. Precedence grammars. Precedence grammars

Compilers. Chapter 4: Syntactic Analyser. 3 er course Spring Term. Precedence grammars. Precedence grammars Complers Chpter 4: yntt Anlyser er ourse prng erm Prt 4g: mple Preedene Grmmrs Alfonso Orteg: lfonso.orteg@um.es nrque Alfonse: enrque.lfonse@um.es Introduton A preedene grmmr ses the nlyss n the preedene

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Math 227 Problem Set V Solutions. f ds =

Math 227 Problem Set V Solutions. f ds = Mth 7 Problem Set V Solutions If is urve with prmetriztion r(t), t b, then we define the line integrl f ds b f ( r(t) ) dr dt (t) dt. Evlute the line integrl f(x,y,z)ds for () f(x,y,z) xosz, the urve with

More information

Math 35 Review Sheet, Spring 2014

Math 35 Review Sheet, Spring 2014 Mth 35 Review heet, pring 2014 For the finl exm, do ny 12 of the 15 questions in 3 hours. They re worth 8 points ech, mking 96, with 4 more points for netness! Put ll your work nd nswers in the provided

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

6.2 Volumes of Revolution: The Disk Method

6.2 Volumes of Revolution: The Disk Method mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus

More information

Orientation & Quaternions. CSE169: Computer Animation Instructor: Steve Rotenberg UCSD, Spring 2016

Orientation & Quaternions. CSE169: Computer Animation Instructor: Steve Rotenberg UCSD, Spring 2016 Orienttion & Quternions CSE69: Computer Animtion Instrutor: Steve Rotenberg UCSD, Spring 6 Orienttion Orienttion We will define orienttion to men n objet s instntneous rottionl onfigurtion Think of it

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

VSxF-2/-3/-4 SMALL LINEAR VALVES PN16 FOR MODULATING AND ON/OFF-CONTROL SPECIFICATIONS

VSxF-2/-3/-4 SMALL LINEAR VALVES PN16 FOR MODULATING AND ON/OFF-CONTROL SPECIFICATIONS VSxF2/3/4 SMLL LINER VLVES PN16 FOR MODULTING ND ON/OFFCONTROL VSxF2 VSxF3 VSxF4 GENERL These smll liner vlves re used in omintion with smll eletri liner vlve tutors nd thermoeletri tutors for the ontrol

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116 [Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:

Area & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area: Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

Inter-domain Routing

Inter-domain Routing COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit

More information

Fault tree conversion to binary decision diagrams

Fault tree conversion to binary decision diagrams Loughorough University Institutionl Repository Fult tree onversion to inry deision digrms This item ws sumitted to Loughorough University's Institutionl Repository y the/n uthor. Cittion: ANDREWS, J.D.

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

Journal of Combinatorial Theory, Series A

Journal of Combinatorial Theory, Series A Journl of Comintoril Theory, Series A 0 (0) Contents lists ville t SiVerse SieneDiret Journl of Comintoril Theory, Series A www.elsevier.om/lote/jt Spheril tiling y ongruent pentgons Hongho Go, Nn Shi,

More information

Solution of Linear Algebraic Equations using the Gauss-Jordan Method

Solution of Linear Algebraic Equations using the Gauss-Jordan Method Solution of Liner Algebric Equtions using the Guss-Jordn Method Populr pproch for solving liner equtions The Guss Jordn method depends on two properties of liner equtions: Scling one or more of ny of the

More information

Introduction. Example

Introduction. Example OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

and vertically shrinked by

and vertically shrinked by 1. A first exmple 1.1. From infinite trnsltion surfe mp to end-periodi mp. We begin with n infinite hlf-trnsltion surfe M 0 desribed s in Figure 1 nd n ffine mp f 0 defined s follows: the surfe is horizontlly

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

CS380: Computer Graphics Modeling Transformations. Sung-Eui Yoon ( 윤성의 ) Course URL:

CS380: Computer Graphics Modeling Transformations. Sung-Eui Yoon ( 윤성의 ) Course URL: CS38: Computer Grphics Modeling Trnsformtions Sung-Eui Yoon ( 윤성의 ) Course URL: http://sgl.kist.c.kr/~sungeui/cg/ Clss Ojectives (Ch. 3.5) Know the clssic dt processing steps, rendering pipeline, for rendering

More information