Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs
|
|
- Collin Steven Malone
- 5 years ago
- Views:
Transcription
1 Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the We s University Grph of Kolenz-Lndu, Germny 52
2 Completing this unit you should Be le to red nd uild n djeny mtrix of grph Know some si mtrix vetor multiplitions to generte some sttistis out of the djeny mtrix Understnd wht is enoded in the omponents of the k-th power of the Adjeny mtrix of grph Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 53
3 A met model for grph sed models Wht does simple Wikipedi look like? modelling interpreting Grph s model modelling lulting Desriptive sttistis interpreting Vetor spe model lulting Mtrix lultions Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 54
4 Modelling grphs with liner lger Given this grph G Whih of the following is n djeny mtrix for G? A = C A B A D A Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 55
5 All four mtries represent the sme grph! Mtries re not the sme How n we mke sure to tlk out the sme thing? A = C A B A D A Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 56
6 Fix se of our vetor spe We hve out grph With set of verties We hve our Vetor spe With set of se vetors V = {,, } Without loosing generlity we n hoose unit vetors ~e A ~e 2 A ~e 3 A V = { ~e, ~e 2, ~e 3 } Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 57
7 Defining the djeny mtrix Fix se i.e. define: hoose f se : V! V With V = {,, } nd V = { ~e, ~e 2, ~e 3 } And f se must e ijetive f se ({x, y}) =f se (x)+f se (y) For exmple one hoie might e f se () = ~e f se () = ~e 2 f se () = ~e 3 ~e ~e 2 ~e 3 Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 58
8 Defining the djeny mtrix Fix se i.e. define: hoose f se : V! V With V = {,, } nd V = { ~e, ~e 2, ~e 3 } And f se must e ijetive f se ({x, y}) =f se (x)+f se (y) For exmple one hoie might e Py ttention: Nottion is somehow sloppy. Here f is not defined on sets. f se () = ~e f se () = ~e 2 f se () = ~e 3 ~e ~e 2 ~e 3 Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 59
9 Defining the djeny mtrix (II) We re looking for mtrix A : V! V suh tht A(f se ()) = f se (In()) ~e ~e 2 ~e 3 Don t pni! A just enodes the outlink of every vertex It is mde in wy tht it respets the hoie of our se Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 6
10 Exmple A(f se ()) = f se A A! A ~e = ~e 2 ~e ~e 2 ~e 3 Multiplying mtrix with the i-th se vetor from right gives the i-th olumn! Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 6
11 Exmple A(f se ()) = f se A A! A ~e = ~e A A! A ~e 2 = A A! A ~e 3 = ~e 2 ~e ~e 2 ~e 3 For eh multiplition the result is the vetors of nodes represnting in links Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 62
12 Similrly for out nodes we get Left multiply with se vetor Result is vetor representing ~e ~e 2 ~e A =! ~e t 2 A = ~e t t + ~e 3 fse() = ~e2 fse() = ~e Out() ={, } f se () = ~e 3 Multiplying mtrix with the i-th se vetor from left gives the i-th row! Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 63
13 Wht hppens if A is pplied severl times? We sw pply it one to se vetor yields ll neighours linking in or out Neighours n e seen s pths of lenght Eh omponent ounts how mny pths of length exist from to the node of the omponent ~e i t So wht does ~e i t A k represent? Wht out? A k ~e i Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 64
14 Wht hppens if A is pplied severl times? represents ~e i t A k A vetor where in eh ompnent is the numer of pths of length k from the node represented y to the node represented y tht omponent. ~e i t represents A k ~e i A vetor where in eh ompnent is the numer of pths of length k to the node represented y ~e i from the node represented y tht omponent Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 65
15 Quiz question! Who is still with me (: If A represents the djeny mtrix of the strongly onneted omponent of Simiple English Wikipedi For wht power of k will A k hve no zero entries? Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 66
16 Degree distriution multiply with ounting vetor we get ~e ~e 2 ~e A = =~e t +~e t t 2 +~e 3 In degree distriution Counting A 2A =~e +2~e 2 +~e 3 Out degree distriution Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 67
17 Thnk you for your ttention! Contt: Rene Pikhrdt Institute for We Siene nd Tehnologies Universität Kolenz-Lndu Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the We s University Grph of Kolenz-Lndu, Germny 68
18 Pitures: By User:AzToth (Imge:6n-grf.png simlr input dt) [Puli domin], vi Wikimedi Commons Puli domin By MistWiz (Own work) [Puli domin], vi Wikimedi Commons By Pluke (Own work) [CC], vi Wikimedi Commons By Lkeworks (Own work) [GFDL ( or CC BY-SA ( retiveommons.org/lienses/y-s/ )], vi Wikimedi Commons By Houl78 (Own work) [CC], vi Wikimedi Commons By MrtinThom (Own work) [GFDL ( or CC BY 3. ( retiveommons.org/lienses/y/3.)], vi Wikimedi Commons direted_network_svg.svg By Limner (Own work) [CC BY-SA 4. ( retiveommons.org/lienses/y-s/4.)], vi Wikimedi Commons By Reidpth [Puli domin], vi Wikimedi Commons vi flikr CC-BY 2. y Dnny Sullivn Grph sttistis vi puli domin puli domin (definition of world wide we) By Sestin Shelter [CC BY-SA 3. ( lienses/y-s/3.)], vi Wikimedi Commons Chris 73 / Wikimedi Commons [GFDL.3 ( or CC BY-SA 3. ( vi Wikimedi Commons By Mnipnde (Own work) [CC BY-SA 3. ( vi Wikimedi Commons vi Flikr nd Vlerie Everett CC-BY-SA y CSTAR & Oleg Alexndrov By Alemonroy (Own work) [GFDL ( or CC BY 3. ( retiveommons.org/lienses/y/3.)], vi Wikimedi Commons Rene Pikhrdt CC-BY-SA-3. Modeling the We s Grph 69
Fundamentals of Engineering Analysis ENGR Matrix Multiplication, Types
Fundmentls of Engineering Anlysis ENGR - Mtri Multiplition, Types Spring Slide Mtri Multiplition Define Conformle To multiply A * B, the mtries must e onformle. Given mtries: A m n nd B n p The numer of
More informationLesson6: Modeling the Web as a graph Unit4: Topology of the Web graph
Lesson6: Modeling the Web as a graph Unit4: Topology of the Web graph Rene Pickhardt Introduction to Web Science Part 2 Emerging Web Properties Rene Pickhardt Institute CC-BY-SA-3.0 for Web Science and
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationCOMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More informationIntroduction to Algebra
INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationHonors Thesis: Investigating the Algebraic Properties of Cayley Digraphs
Honors Thesis: Investigting the Algebri Properties of Cyley Digrphs Alexis Byers, Wittenberg University Mthemtis Deprtment April 30, 2014 This pper utilizes Grph Theory to gin insight into the lgebri struture
More information12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler
CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt
More informationMinimal Memory Abstractions
Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationAdjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.
Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More information[SYLWAN., 158(6)]. ISI
The proposl of Improved Inext Isomorphi Grph Algorithm to Detet Design Ptterns Afnn Slem B-Brhem, M. Rizwn Jmeel Qureshi Fulty of Computing nd Informtion Tehnology, King Adulziz University, Jeddh, SAUDI
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationDoubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral
Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More informationTight triangulations: a link between combinatorics and topology
Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited
More informationMITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...
More informationDouble Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals
Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationGreedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationFinal Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book
inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationCOSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview
COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More informationGENG2140 Modelling and Computer Analysis for Engineers
GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationArchitecture and Data Flows Reference Guide
Arhiteture nd Dt Flows Referene Guide BlkBerry UEM Version 12.7 Pulished: 2017-07-12 SWD-20170627140413745 Contents Aout this guide... 5 Arhiteture: BlkBerry UEM solution... 6 BlkBerry UEM omponents...
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More information5/9/17. Lesson 51 - FTC PART 2. Review FTC, PART 1. statement as the Integral Evaluation Theorem as it tells us HOW to evaluate the definite integral
Lesson - FTC PART 2 Review! We hve seen definition/formul for definite integrl s n b A() = lim f ( i )Δ = f ()d = F() = F(b) F() n i=! where F () = f() (or F() is the ntiderivtive of f() b! And hve seen
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationstyle type="text/css".wpb_animate_when_almost_visible { opacity: 1; }/style
style type="text/css".wpb_nimte_when_lmost_vible { opcity: 1; }/style You cn chrome homepge for internet explorer quickly chrome homepge for internet explorer get chrome homepge for internet explorer every
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationCompilers. Chapter 4: Syntactic Analyser. 3 er course Spring Term. Precedence grammars. Precedence grammars
Complers Chpter 4: yntt Anlyser er ourse prng erm Prt 4g: mple Preedene Grmmrs Alfonso Orteg: lfonso.orteg@um.es nrque Alfonse: enrque.lfonse@um.es Introduton A preedene grmmr ses the nlyss n the preedene
More informationCSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline
CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationMath 227 Problem Set V Solutions. f ds =
Mth 7 Problem Set V Solutions If is urve with prmetriztion r(t), t b, then we define the line integrl f ds b f ( r(t) ) dr dt (t) dt. Evlute the line integrl f(x,y,z)ds for () f(x,y,z) xosz, the urve with
More informationMath 35 Review Sheet, Spring 2014
Mth 35 Review heet, pring 2014 For the finl exm, do ny 12 of the 15 questions in 3 hours. They re worth 8 points ech, mking 96, with 4 more points for netness! Put ll your work nd nswers in the provided
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationGraphing Conic Sections
Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationObjective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas
Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus
More informationOrientation & Quaternions. CSE169: Computer Animation Instructor: Steve Rotenberg UCSD, Spring 2016
Orienttion & Quternions CSE69: Computer Animtion Instrutor: Steve Rotenberg UCSD, Spring 6 Orienttion Orienttion We will define orienttion to men n objet s instntneous rottionl onfigurtion Think of it
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationChapter Spline Method of Interpolation More Examples Electrical Engineering
Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationVSxF-2/-3/-4 SMALL LINEAR VALVES PN16 FOR MODULATING AND ON/OFF-CONTROL SPECIFICATIONS
VSxF2/3/4 SMLL LINER VLVES PN16 FOR MODULTING ND ON/OFFCONTROL VSxF2 VSxF3 VSxF4 GENERL These smll liner vlves re used in omintion with smll eletri liner vlve tutors nd thermoeletri tutors for the ontrol
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More information[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116
[Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationArea & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:
Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationInter-domain Routing
COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit
More informationFault tree conversion to binary decision diagrams
Loughorough University Institutionl Repository Fult tree onversion to inry deision digrms This item ws sumitted to Loughorough University's Institutionl Repository y the/n uthor. Cittion: ANDREWS, J.D.
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More informationJournal of Combinatorial Theory, Series A
Journl of Comintoril Theory, Series A 0 (0) Contents lists ville t SiVerse SieneDiret Journl of Comintoril Theory, Series A www.elsevier.om/lote/jt Spheril tiling y ongruent pentgons Hongho Go, Nn Shi,
More informationSolution of Linear Algebraic Equations using the Gauss-Jordan Method
Solution of Liner Algebric Equtions using the Guss-Jordn Method Populr pproch for solving liner equtions The Guss Jordn method depends on two properties of liner equtions: Scling one or more of ny of the
More informationIntroduction. Example
OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationand vertically shrinked by
1. A first exmple 1.1. From infinite trnsltion surfe mp to end-periodi mp. We begin with n infinite hlf-trnsltion surfe M 0 desribed s in Figure 1 nd n ffine mp f 0 defined s follows: the surfe is horizontlly
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationCOSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup
COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCS380: Computer Graphics Modeling Transformations. Sung-Eui Yoon ( 윤성의 ) Course URL:
CS38: Computer Grphics Modeling Trnsformtions Sung-Eui Yoon ( 윤성의 ) Course URL: http://sgl.kist.c.kr/~sungeui/cg/ Clss Ojectives (Ch. 3.5) Know the clssic dt processing steps, rendering pipeline, for rendering
More information