Recognition of Tokens

Size: px
Start display at page:

Download "Recognition of Tokens"

Transcription

1 42 Recognton o Tokens The queston s how to recognze the tokens? Exmple: ssume the ollowng grmmr rgment to generte specc lnguge: stmt expr expr then stmt expr then stmt else stmt term relop term term term d num where the termnls, then, else, relop, d, nd num generte sets o strngs gven y the ollowng regulr dentons: then then else else relop < <= = <> > >= d letter(letter dgt)* num dgts optonl-rcton optonl-exponent Where letter nd dgts re s dened prevously. For ths lnguge rgment the lexcl nlyzer wll recognze the keywords, then, else, s well s the lexemes denoted y relop, d, nd num. To smply mtters, we ssume keywords re reserved; tht s, they cnnot e used s denters. The num represents the unsgned nteger nd rel numers o Pscl. In ddton, we ssume lexemes re seprted y whte spce, consstng o nonnull sequences o lnks, ts, nd newlnes. The lexcl nlyzer wll strp out whte spce. It wll do so y comprng strng gnst the regulr denton ws, elow. delm lnk t newlne ws delm + I mtch or ws s ound, the lexcl nlyzer does not return token to the prser.

2 42 Trnston Dgrms (TD) As n ntermedte step n the constructon o lexcl nlyzer, we rst produce lowchrt, clled Trnston dgrm. Trnston dgrms depct the ctons tht tke plce when lexcl nlyzer s clled y the prser to get the next token. The TD uses to keep trck o normton out chrcters tht re seen s the orwrd ponter scns the nput. t dose tht y movng rom poston to poston n the dgrm s chrcters re red. Components o Trnston Dgrm 1. One stte s leled the Strt Stte; strt t s the ntl stte o the trnston dgrm where control resdes when we egn to recognze token. 2. Postons n trnston dgrm re drwn s crcles nd re clled sttes. 3. The sttes re connected y Arrows, clled edges. Lels on edges re ndctng the nput chrcters. 4. The Acceptng sttes n whch the tokens hs een ound. 5. Retrct one chrcter use * to ndcte sttes on whch ths nput retrcton.

3 42 Exmple: A Trnston Dgrm or the token relton opertors "relop" s shown n Fgure elow: strt < 0 1 = 2 Return (relop,le) > 3 Return (relop,ne) Other 4 * Return (relop,lt) = > 5 6 Return (relop,eq) = 7 Return (relop,ge) Other 8 * Return (relop,gt) Trnston Dgrm or relton opertors Exmple: A Trnston Dgrm or the denters nd keywords: Letter or dgt strt 9 letter other * Trnston Dgrm or denters nd keywords

4 42 Exmple: A Trnston Dgrm or Unsgned Numers n Pscl: dgt dgt dgt strt 12 dgt dgt 15 E 16 +or- 17 dgt 18 other * 19 E dgt dgt dgt strt 20 dgt dgt 23 other 24 dgt strt 25 dgt 26 other 27 * num dgt + (. dgt + )(E(+ - )dgt + ) Trnston Dgrm or unsgned numers n Pscl Tretment o Whte Spce (WS): delm strt 28 delm 29 other * 30 Trnston Dgrm or Whte Spce Nothng s returned when the cceptng stte s reched; we merely go ck to the strt stte o the rst trnston dgrm to look or nother pttern.

5 42 Fnte Automt (FA) It generlzed trnston dgrm TD, constructed to comple regulr expresson RE nto recognzer. Recognzer or Lnguge: s progrm tht tkes strng X s n nput nd nswers "Yes" X s sentence o the lnguge nd "No" otherwse. FA Nondetermnstc Fnte Automt (NFA) Determnstc Fnte Automt (DFA) Note: Both NFA nd DFA re cple o recognzng wht regulr expresson cn denote. Nondetermnstc Fnte Automt (NFA) NFA: mens tht more thn one trnston out o stte my e possle on sme nput symol. 1 2 Also trnston on nput ( -Trnston) s possle

6 42 A nondetermnstc nte utomton NFA s mthemtcl model conssts o 1) A set o sttes S; 2) A set o nput symol,, clled the nput symols lphet. 3) A set o trnston to move the symol to the sets o sttes. 4) A stte S0 clled the ntl or the strt stte. 5) A set o sttes F clled the cceptng or nl stte. Exmple: The NFA tht recognzes the lnguge ( ) * s shown elow: strt Exmple: The NFA tht recognzes the lnguge * * s shown elow:

7 03 Determnstc Fnte Automt (DFA) A determnstc nte utomton (DFA, or short) s specl cse o non-determnstc nte utomton (NFA) n whch 1. No stte hs n -trnston,.e., trnston on nput, nd 2. For ech stte S nd nput symol, there s t most one edge leled levng S. A determnstc nte utomton DFA hs t most one trnston rom ech stte on ny nput. Exmple: The ollowng gure shows DFA tht recognzes the lnguge ( )*. strt The Trnston Tle s: Stte

8 03 Converson o n NFA nto DFA It s hrd or computer progrm to smulte n NFA ecuse the trnston uncton s multvlued. The lgorthm tht clled the suset constructon wll convert n NFA or ny lnguge nto DFA tht recognzes the sme lnguges. Algorthm: (Suset constructon): constructng DFA rom NFA. Input: NFA N. Output: DFA D cceptng the sme lnguge. Method: ths lgorthm constructs trnston tle Dtrn or D. Ech DFA stte s set o NFA sttes nd we construct Dtrn so tht D wll smulte "n prllel" ll possle moves N cn mke on gven nput strng. It use the opertons n elow to keep trck o sets o NFA sttes (s represents n NFA stte nd T set o NFA sttes). Opertons -closure(s) -closure(t) Move(T, ) Descrpton Set o NFA sttes rechle rom NFA stte s on - trnstons lone. Set o NFA sttes rechle rom some NFA stte s n T on -trnstons lone. Set o NFA sttes to whch there s trnston on nput symol rom some NFA stte s n T. 1) -closure (s0) s the strt stte o D. 2) A stte o D s cceptng t contns t lest one cceptng stte n N.

9 04 Algorthm: (Suset constructon): Intlly, -closure(s0) s the only stte n Dsttes nd t s unmrked; whle there s n unmrked stte T n Dsttes do egn mrk T; For ech nput symol do egn U: = ( -closure (move (T, )) ; U s not n Dsttes then dd U s n unmrked stte to Dsttes; Dtrn [T, ]: = U End End We construct Dsttes, the set o sttes o D, nd Dtrn, the trnston tle or D, n the ollowng mnner. Ech stte o D corresponds to set o NFA sttes tht N could e n ter redng some sequence o nput symols ncludng ll possle -trnstons eore or ter symols re red. Algorthm: Computton o -closure Push ll sttes n T onto slck; Intlze -closure (T) to T; Whle slck s not empty do egn Pop t, the top clement, o o stck; For ech stte u wth n edge rom t to u leled do I u s not n -closure (T) do egn Add u to -closure (T); Push u onto stck End End A smple lgorthm to compute -closure (T) uses stck to hold sttes whose edges hve not een checked or -leled trnstons.

10 00 Exmple: The gure elow shows NFA N cceptng the lnguge ( )* Sol: pply the Algorthm o Suset constructon s ollow: 1) Fnd the strt stte o the equvlent DFA s -closure (0), whch s consst o strt stte o NFA nd the ll sttes rechle rom stte 0 v pth n whch every edge s leled. A= {0, 1, 2, 4, 7} 2) Compute move (A, ), the set o sttes o NFA hvng trnstons on rom memers o A. Among the sttes 0, 1, 2, 4 nd 7, only 2 nd 7 hve such trnstons, to 3 nd 8, so move (A, )={3, 8} Compute the -closure (move (A, )) = -closure ({3, 8}), -closure ({3, 8}) = {1, 2, 3, 4, 6, 7, 8} Let us cll ths set B. strt A B

11 02 3) Compute move (A, ), the set o sttes o NFA hvng trnstons on rom memers o A. Among the sttes 0, 1, 2, 4 nd 7, only 4 hve such trnstons, to 5 so move (A, )={5} Compute the -closure (move (A, )) = -closure ({5}), -closure ({5}) = {1, 2, 4, 5, 6, 7} Let us cll ths set C. So the DFA hs trnston on rom A to C. strt A C 4) We pply the steps 2 nd 3 on the B nd C, ths process contnues or every new stte o the DFA untl ll sets tht re sttes o the DFA re mrked. The ve derent sets o sttes we ctully construct re: A = {0, 1, 2, 4, 7} B = {1, 2, 3, 4, 6, 7, 8} C = {1, 2, 4, 5, 6, 7} D = {1, 2, 4, 5, 6, 7, 9} E = {1, 2, 4, 5, 6, 7, 10} Stte A s the strt stte, nd stte E s the only cceptng stte. The complete trnston tle Dtrn s shown n elow: STATE INPUT SYMBOL A B C B C B B D C D B E E B C Trnston tle Dtrn or DFA

12 02 Also, trnston grph or the resultng DFA s shown n elow. It should e noted tht the DFA lso ccepts ( )*. C strt A B D E From Regulr Expresson to n NFA Now gve n lgorthm to construct n NFA rom regulr expresson. The lgorthm s syntx-drected n tht t uses the syntctc structure o the regulr expresson to gude the constructon process. Algorthm: (Thompson's constructon): Input: regulr expresson R over lphet. Output: NFA N cceptng L(R). 1- For, construct the NFA strt Here s strt stte nd cceptng stte. Clerly ths NFA recognzes { }.

13 02 2- For n, construct the NFA strt Agn s strt stte nd cceptng stte. Ths mchne recognzes {}. 3- For the regulr expresson construct the ollowng composte NFA N( ). 4- For the regulr expresson construct the ollowng composte NFA N(). strt 5- For the regulr expresson * construct the ollowng composte NFA N(*). strt

14 02 Exmple: let us use lgorthm Thompson's constructon to construct the ollowng regulr expressons: 1) RE = ()* 2) RE= ( )* 3) RE= ( )*

15 02 4) RE= * ( ) strt Lexcl Errors Wht user omts the spce n For? No lexcl error, sngle token IDENT ( For ) s produced nsted o sequence For, IDENT ( ). Typclly ew lexcl error types 1) the llegl chrs, or exmple: Wrt@ln (x); 2) untermnted comments, or exmple: {Mn progrm 3) Ill-ormed constnts How s Scnner Progrmmed? 1) Descre tokens wth regulr expressons. 2) Drw trnston dgrms. 3) Code the dgrm s tle/progrm.

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Lexical Analysis and Lexical Analyzer Generators

Lexical Analysis and Lexical Analyzer Generators 1 Lexicl Anlysis nd Lexicl Anlyzer Genertors Chpter 3 COP5621 Compiler Construction Copyright Roert vn Engelen, Florid Stte University, 2007-2009 2 The Reson Why Lexicl Anlysis is Seprte Phse Simplifies

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Principles of Programming Languages

Principles of Programming Languages Principles of Progrmming Lnguges h"p://www.di.unipi.it/~ndre/did2c/plp- 14/ Prof. Andre Corrdini Deprtment of Computer Science, Pis Lesson 5! Gener;on of Lexicl Anlyzers Creting Lexicl Anlyzer with Lex

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program:

Example: Source Code. Lexical Analysis. The Lexical Structure. Tokens. What do we really care here? A Sample Toy Program: Lexicl Anlysis Red source progrm nd produce list of tokens ( liner nlysis) source progrm The lexicl structure is specified using regulr expressions Other secondry tsks: (1) get rid of white spces (e.g.,

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

CMPT 379 Compilers. Lexical Analysis

CMPT 379 Compilers. Lexical Analysis CMPT 379 Compilers Anoop Srkr http://www.cs.sfu.c/~noop 9//7 Lexicl Anlysis Also clled scnning, tke input progrm string nd convert into tokens Exmple: T_DOUBLE ( doule ) T_IDENT ( f ) T_OP ( = ) doule

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

Midterm I Solutions CS164, Spring 2006

Midterm I Solutions CS164, Spring 2006 Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing

10/12/17. Motivating Example. Lexical and Syntax Analysis (2) Recursive-Descent Parsing. Recursive-Descent Parsing. Recursive-Descent Parsing Motivting Exmple Lexicl nd yntx Anlysis (2) In Text: Chpter 4 Consider the grmmr -> cad A -> b Input string: w = cd How to build prse tree top-down? 2 Initilly crete tree contining single node (the strt

More information

Scanner Termination. Multi Character Lookahead

Scanner Termination. Multi Character Lookahead If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte

More information

such that is accepted of states in , where Finite Automata Lecture 2-1: Regular Languages be an FA. A string is the transition function,

such that is accepted of states in , where Finite Automata Lecture 2-1: Regular Languages be an FA. A string is the transition function, * Lecture - Regular Languages S Lecture - Fnte Automata where A fnte automaton s a -tuple s a fnte set called the states s a fnte set called the alphabet s the transton functon s the ntal state s the set

More information

Compiler Construction D7011E

Compiler Construction D7011E Compiler Construction D7011E Lecture 3: Lexer genertors Viktor Leijon Slides lrgely y John Nordlnder with mteril generously provided y Mrk P. Jones. 1 Recp: Hndwritten Lexers: Don t require sophisticted

More information

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table

LR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Compilation

Compilation Compiltion 0368-3133 Lecture 2: Lexicl Anlysis Nom Rinetzky 1 2 Lexicl Anlysis Modern Compiler Design: Chpter 2.1 3 Conceptul Structure of Compiler Compiler Source text txt Frontend Semntic Representtion

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1

Deterministic. Finite Automata. And Regular Languages. Fall 2018 Costas Busch - RPI 1 Deterministic Finite Automt And Regulr Lnguges Fll 2018 Costs Busch - RPI 1 Deterministic Finite Automton (DFA) Input Tpe String Finite Automton Output Accept or Reject Fll 2018 Costs Busch - RPI 2 Trnsition

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night

Should be done. Do Soon. Structure of a Typical Compiler. Plan for Today. Lab hours and Office hours. Quiz 1 is due tonight, was posted Tuesday night Should e done L hours nd Office hours Sign up for the miling list t, strting to send importnt info to list http://groups.google.com/group/cs453-spring-2011 Red Ch 1 nd skim Ch 2 through 2.6, red 3.3 nd

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms

More information

Compilers. Chapter 4: Syntactic Analyser. 3 er course Spring Term. Precedence grammars. Precedence grammars

Compilers. Chapter 4: Syntactic Analyser. 3 er course Spring Term. Precedence grammars. Precedence grammars Complers Chpter 4: yntt Anlyser er ourse prng erm Prt 4g: mple Preedene Grmmrs Alfonso Orteg: lfonso.orteg@um.es nrque Alfonse: enrque.lfonse@um.es Introduton A preedene grmmr ses the nlyss n the preedene

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University Fll 2014-2015 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University Agend Understnd role of lexicl nlysis in compiler Lexicl nlysis theory Implementing professionl scnner vi

More information

Regular Expressions and Automata using Miranda

Regular Expressions and Automata using Miranda Regulr Expressions nd Automt using Mirnd Simon Thompson Computing Lortory Univerisity of Kent t Cnterury My 1995 Contents 1 Introduction ::::::::::::::::::::::::::::::::: 1 2 Regulr Expressions :::::::::::::::::::::::::::::

More information

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata

acronyms possibly used in this test: CFG :acontext free grammar CFSM :acharacteristic finite state machine DFA :adeterministic finite automata EE573 Fll 2002, Exm open book, if question seems mbiguous, sk me to clrify the question. If my nswer doesn t stisfy you, plese stte your ssumptions. cronyms possibly used in this test: CFG :context free

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to

Here is an example where angles with a common arm and vertex overlap. Name all the obtuse angles adjacent to djcent tht do not overlp shre n rm from the sme vertex point re clled djcent ngles. me the djcent cute ngles in this digrm rm is shred y + + me vertex point for + + + is djcent to + djcent simply mens

More information

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing

Some Thoughts on Grad School. Undergraduate Compilers Review and Intro to MJC. Structure of a Typical Compiler. Lexing and Parsing Undergrdute Compilers Review nd Intro to MJC Announcements Miling list is in full swing Tody Some thoughts on grd school Finish prsing Semntic nlysis Visitor pttern for bstrct syntx trees Some Thoughts

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class

LEX5: Regexps to NFA. Lexical Analysis. CMPT 379: Compilers Instructor: Anoop Sarkar. anoopsarkar.github.io/compilers-class LEX5: Regexps to NFA Lexicl Anlysis CMPT 379: Compilers Instructor: Anoop Srkr noopsrkr.github.io/compilers-clss Building Lexicl Anlyzer Token POern POern Regulr Expression Regulr Expression NFA NFA DFA

More information

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2.

stack of states and grammar symbols Stack-Bottom marker C. Kessler, IDA, Linköpings universitet. 1. <list> -> <list>, <element> 2. TDDB9 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing Updted/New slide mteril 007: Pushdown Automton for LR-Prsing Finite-stte pushdown utomton contins lterntingly sttes nd symols in NUΣ

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Lexical Analysis. Role, Specification & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-state DFA - RE to DFA

Lexical Analysis. Role, Specification & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-state DFA - RE to DFA Lexicl Anlysis Role, Specifiction & Recognition Tool: LEX Construction: - RE to NFA to DFA to min-stte DFA - RE to DFA Conducting Lexicl Anlysis Techniques for specifying nd implementing lexicl nlyzers

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

1.4 Circuit Theorems

1.4 Circuit Theorems . Crcut Theorems. v,? (C)V, 5 6 (D) V, 6 5. A smple equvlent crcut of the termnl 6 v, network shown n fg. P.. s Fg. P... (A)V, (B)V, v (C)V,5 (D)V,5 Fg. P....,? 5 V, v (A) (B) Fg. P... (A)A, 0 (B) 0 A,

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

World Journal of Engineering Research and Technology WJERT

World Journal of Engineering Research and Technology WJERT wjert 207 Vol. 3 Issue 5 284-293. Orgnl Artcle IN 2454-695X World Journl of ngneerng Reserch nd Technology hndrmouleeswrn et l. World Journl of ngneerng Reserch nd Technology WJRT www.wjert.org JIF Impct

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

COMPUTATIONAL INTELLIGENCE

COMPUTATIONAL INTELLIGENCE COMPUTATIONAL INTELLIGENCE LABORATORY CLASSES Immentton smplstc verson of the network for some nference resons Adrn Horzyk IMPLEMENTATION OF THE SIMPLISTIC OR AANG Imment the smplstc verson of n structure

More information

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids

Chapter44. Polygons and solids. Contents: A Polygons B Triangles C Quadrilaterals D Solids E Constructing solids Chpter44 Polygons nd solids Contents: A Polygons B Tringles C Qudrilterls D Solids E Constructing solids 74 POLYGONS AND SOLIDS (Chpter 4) Opening prolem Things to think out: c Wht different shpes cn you

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information