CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION

Size: px
Start display at page:

Download "CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION"

Transcription

1 CIS 1068 Progrm Design nd Astrction Spring2015 Midterm Exm 1 Nme SOLUTION Pge Points Score Totl P ge

2 1. Progrm Trces (41 points, 50 minutes) Answer the questions elow out ech snippet of code. For the ske of revity, I hve left off the lines "pulic clss <ClssNme> {" nd "pulic sttic void min(string [] rgs) {" from most of these questions. Pretend they re there.. (4 points) Numer Clcultion: wht re the vlues of w, x, y, nd z fter these lines execute? int w; int x = 3, y = 8; int z = y % x; y += 1 + z; w x y z? (3 points) Vlue of oolen vrile nd precedence order: wht re the vlues of,, nd c fter these lines execute? oolen ; oolen = 2 < 5 / 2 && true; oolen c = (! && 1 > 6 % 2); c. (3 points) Type Comptiility: wht re the vlues of,, nd c fter these lines execute? int = / 2; doule = / 2; doule c = / 2.0;? 3 flse true d. (1 point) String: wht does this code disply on the screen? c c int = 0; oolen = flse; String s = ""; System.out.println( + s + ); 0flse e. (4 points) Arry: wht re the vlues of,, c, nd d fter these lines execute? int [ ] ; int [ ] = null; int [ ] c = new int[4]; int [ ] d = {2, 3, 4; c[2] = 1; d[0] = d[1] d.length; c d? null P ge

3 f. (8 points) For ech column, show wht the code displys on the screen. Code Output: int x = 2; int y = 3; int z = 4; z=5 if(x + y > z) z ++; System.out.println("z=" + z); int x = 1; int y = 2; oolen = true; true oolen c = flse; if( && x >= y) { System.out.println(x); else if (c x < y) { System.out.println(); else System.out.println(c); int [] x = {1, 2, 3; int [] y = {1, 3, 5, 7; if(x.length>y.length) { x[y.length-1] = y[y.length-1]; 17 else if (x[2] > y[2]) { y[3] = x[2]; else { y[1] = x[1] + x[2]; System.out.println(y[1]+y[2]+y[3]); oolen = true; int i = 1; 2 while () { true = i ++ <2; 3 System.out.println(i); flse System.out.println(); 3 P ge

4 g. (18 points) Wht re the vlues of,, nd c t the end of the code in ech column? Code Vlue of,, nd c int [] = {3, -2, 4, 5; int = 0, c = 0; for( =0; <.length; ++) { c = c + []; 4 for( =0; <.length; ++) { [] = c / (+1); c 10 int [] = {1, -2, 4, 3; int = [0]; int c = 0; for( c=0; c <.length; c++) { if ([c] > ) { = [c]; [c] = ; c 4 4 String = "You-see-you- drive-you."; String u = "you"; String v = "they"; int =.indexof(u); String c = ""; -1 "." while(>=0) { String word =.sustring(0,); c = c + word + v; =.sustring(+u.length()); =.indexof(u); c = c + ; c "You-see-they-drive-they." 4 P ge

5 2. Fill the lnks (8 points, 10 minutes) For the requirement specified in the elow, complete the corresponding loop progrm so tht the computer cn print out the expected result.. Write progrm to print out the result of int totl = 1 ; int i = 2; while (i<100){ totl=totl+i; i++; System.out.print(totl);. Write progrm to print out the result of int totl = 0 ; int i = 1; while (i <= 4096 ){ totl=totl+i; i *= 2; System.out.print(totl); c. Write progrm to print out the result of int totl = 1 ; int i = 1; while (i<3000){ i *= 2; totl=totl+ i ; System.out.print(totl); d. Write progrm tht reds in n integer n from the keyord, nd displys whether n is "perfect numer" or not.a numer is "perfect" if it is equl to the sum of ll of its fctors (not including itself s fctor, ut including 1 s fctor). 6 is the first perfect numer, ecuse its fctors re 1, 2, nd 3, nd = 6. int n = keyord.nextint(); int totl = 1; for( int fctor = 2 ; fctor < n ; fctor++ ) if (n%fctor ==0) totl += fctor; System.out.println(n == totl); 5 P ge

6 3. Writing short progrms (39 points, 40 minutes) For ech prolem elow, write some Jv code to solve it. You do not need to define clss or the min method, or import ny clsses. For this question, you should ssume tht ll necessry clsses (e.g., Scnner, Arrys) hve een imported. Furthermore, ssume tht the following line precedes every question elow, for you to use if you wnt: Scnner keyord = new Scnner(System.in);. (7 points) Write code tht reds in word W nd numer N from the user (i.e., vi keyord). Your code should disply W on N lines. For exmple, if the user enters "hello" for W nd 3 for N, your code should disply: String W = keyord.nextline(); int N = keyord.nextint(); for(int i = 0; i< N; i++) System.out.println(W);. (7 points) Write code tht reds in n integer N vi the keyord, nd displys ll the products of 7, from 1 x 7 up to N x 7. For instnce, if the user enters 4, the progrm should disply: int N = keyord.nextint(); for( int i = 1; i<=n; i++) System.out.println(i+ x7= +i*7); c. (11 points) Write code tht reds in string, nd displys the result of true or flse whether this word (in string) is dollr word. A dollr word is one whose totl vlue is exctly 100 when ech of its chrcter is ssigned vlue ccording to its position in the lphet: =1, =2,, z=26. Some exmples of dollr word re: contented, cookout, mittens, nd shdowing. String = keyord.nextline(); int totl=0; =.tolowercse(); for (int i = 0; i<.length(); i++) totl +=.chrat(i)- +1; System.out.println(totl==100); c. (14 points) Write code tht reds in numer C nd numer R from the user (i.e., keyord), nd displys figure with R rows nd 2xC columns of "$" nd chrcters. For instnce, if the user enters 5 for C nd 4 for R, your progrm should disply the following shpe of "$"s: int C = keyord.nextint(); int R = keyord.nextint(); for( int i = 0; i < R; i++){ int j; for(j = 0; j < C-i; j++) 6 P ge

7 System.out.print( $ ); for(j = 0; j < 2*i; j++) System.out.print( ); for(j = 0; j < C-i; j++) System.out.print( $ ); System.out.println(); 4. Chllenge: Writing full Jv progrm (12 points, 20 minutes) Write complete Jv progrm clled SecondMAX.jv tht reds in numer of ints from the keyord, nd store them in n rry. After tht, find the second minimum vlue in this rry, nd disply it on the screen. The numer of ins, i.e., the length of the rry, must e entered y the user, efore the rry element input strts. import jv.util.scnner; pulic clss SecondMx{ pulic sttic void min(string [] rgs){ Scnner k = new Scnner (System.in); int size = k.nextint(); int [] rr = new int[size]; int iggest, iggest2nd; for (int i = 0; i<size; i++) rr [i] = k.nextint(); if (rr[0]<rr[1]){ iggest = rr[1]; iggest2nd = rr[0]; else{ iggest = rr[0]; iggest2nd = rr[1]; for (int i =2; i<size; i++){ if(rr[i]>iggest){ iggest2nd = iggest; iggest = rr[i]; else if (rr[i]>iggest2nd) { iggest2nd = rr[i]; System.out.println(iggest2nd); 7 P ge

CIS 1068 Program Design and Abstraction Spring2016 Midterm Exam 1. Name SOLUTION

CIS 1068 Program Design and Abstraction Spring2016 Midterm Exam 1. Name SOLUTION CIS 1068 Program Design and Abstraction Spring2016 Midterm Exam 1 Name SOLUTION Page Points Score 2 15 3 8 4 18 5 10 6 7 7 7 8 14 9 11 10 10 Total 100 1 P age 1. Program Traces (41 points, 50 minutes)

More information

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays

Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example:

box Boxes and Arrows 3 true 7.59 'X' An object is drawn as a box that contains its data members, for example: Boxes nd Arrows There re two kinds of vriles in Jv: those tht store primitive vlues nd those tht store references. Primitive vlues re vlues of type long, int, short, chr, yte, oolen, doule, nd flot. References

More information

Lexical analysis, scanners. Construction of a scanner

Lexical analysis, scanners. Construction of a scanner Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

CSCE 531, Spring 2017, Midterm Exam Answer Key

CSCE 531, Spring 2017, Midterm Exam Answer Key CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

Reference types and their characteristics Class Definition Constructors and Object Creation Special objects: Strings and Arrays

Reference types and their characteristics Class Definition Constructors and Object Creation Special objects: Strings and Arrays Objects nd Clsses Reference types nd their chrcteristics Clss Definition Constructors nd Object Cretion Specil objects: Strings nd Arrys OOAD 1999/2000 Cludi Niederée, Jochim W. Schmidt Softwre Systems

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam. 15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010

Discussion 1 Recap. COP4600 Discussion 2 OS concepts, System call, and Assignment 1. Questions. Questions. Outline. Outline 10/24/2010 COP4600 Discussion 2 OS concepts, System cll, nd Assignment 1 TA: Hufeng Jin hj0@cise.ufl.edu Discussion 1 Recp Introduction to C C Bsic Types (chr, int, long, flot, doule, ) C Preprocessors (#include,

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam. 15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge

More information

Functor (1A) Young Won Lim 8/2/17

Functor (1A) Young Won Lim 8/2/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;

More information

Functor (1A) Young Won Lim 10/5/17

Functor (1A) Young Won Lim 10/5/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

License Manager Installation and Setup

License Manager Installation and Setup The Network License (concurrent-user) version of e-dpp hs hrdwre key plugged to the computer running the License Mnger softwre. In the e-dpp terminology, this computer is clled the License Mnger Server.

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Pointers and Arrays. More Pointer Examples. Pointers CS 217

Pointers and Arrays. More Pointer Examples. Pointers CS 217 Pointers nd Arrs CS 21 1 2 Pointers More Pointer Emples Wht is pointer A vrile whose vlue is the ddress of nother vrile p is pointer to vrile v Opertions &: ddress of (reference) *: indirection (dereference)

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *

Languages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) * Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte

More information

Summer Review Packet For Algebra 2 CP/Honors

Summer Review Packet For Algebra 2 CP/Honors Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review

More information

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay

Lexical Analysis. Amitabha Sanyal. (www.cse.iitb.ac.in/ as) Department of Computer Science and Engineering, Indian Institute of Technology, Bombay Lexicl Anlysis Amith Snyl (www.cse.iit.c.in/ s) Deprtment of Computer Science nd Engineering, Indin Institute of Technology, Bomy Septemer 27 College of Engineering, Pune Lexicl Anlysis: 2/6 Recp The input

More information

Example: 2:1 Multiplexer

Example: 2:1 Multiplexer Exmple: 2:1 Multiplexer Exmple #1 reg ; lwys @( or or s) egin if (s == 1') egin = ; else egin = ; 1 s B. Bs 114 Exmple: 2:1 Multiplexer Exmple #2 Normlly lwys include egin nd sttements even though they

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Simplifying Algebra. Simplifying Algebra. Curriculum Ready.

Simplifying Algebra. Simplifying Algebra. Curriculum Ready. Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or

Operator Precedence. Java CUP. E E + T T T * P P P id id id. Does a+b*c mean (a+b)*c or Opertor Precedence Most progrmming lnguges hve opertor precedence rules tht stte the order in which opertors re pplied (in the sence of explicit prentheses). Thus in C nd Jv nd CSX, +*c mens compute *c,

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

Data sharing in OpenMP

Data sharing in OpenMP Dt shring in OpenMP Polo Burgio polo.burgio@unimore.it Outline Expressing prllelism Understnding prllel threds Memory Dt mngement Dt cluses Synchroniztion Brriers, locks, criticl sections Work prtitioning

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011

CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011 CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications

Java CUP. Java CUP Specifications. User Code Additions. Package and Import Specifications Jv CUP Jv CUP is prser-genertion tool, similr to Ycc. CUP uilds Jv prser for LALR(1) grmmrs from production rules nd ssocited Jv code frgments. When prticulr production is recognized, its ssocited code

More information

Virtual Machine (Part I)

Virtual Machine (Part I) Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

INDIAN COMMUNITY SCHOOL INFORMATICS PRACTICES 2012

INDIAN COMMUNITY SCHOOL INFORMATICS PRACTICES 2012 INDIAN COMMUNITY SCHOOL INFORMATICS PRACTICES 0. Write corresponding C ++ expression for the following mthemticl expression: i) (-b) + (c-d) ii) e x x. Write C++ expression for the following: ) All possible

More information

Introduction to Computer Science, Shimon Schocken, IDC Herzliya. Lecture Writing Classes

Introduction to Computer Science, Shimon Schocken, IDC Herzliya. Lecture Writing Classes Introduction to Computer Science, Shimon Schocken, IDC Herzliy Lecture 5.1-5.2 Writing Clsses Writing Clsses, Shimon Schocken IDC Herzliy, www.ro2cs.com slide 1 Clsses Two viewpos on es: Client view: how

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev

Fall Compiler Principles Lecture 1: Lexical Analysis. Roman Manevich Ben-Gurion University of the Negev Fll 2016-2017 Compiler Principles Lecture 1: Lexicl Anlysis Romn Mnevich Ben-Gurion University of the Negev Agend Understnd role of lexicl nlysis in compiler Regulr lnguges reminder Lexicl nlysis lgorithms

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

Exam #1 for Computer Simulation Spring 2005

Exam #1 for Computer Simulation Spring 2005 Exm # for Computer Simultion Spring 005 >>> SOLUTION

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

CS 430 Spring Mike Lam, Professor. Parsing

CS 430 Spring Mike Lam, Professor. Parsing CS 430 Spring 2015 Mike Lm, Professor Prsing Syntx Anlysis We cn now formlly descrie lnguge's syntx Using regulr expressions nd BNF grmmrs How does tht help us? Syntx Anlysis We cn now formlly descrie

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

Symbol Table management

Symbol Table management TDDD Compilers nd interpreters TDDB44 Compiler Construction Symol Tles Symol Tles in the Compiler Symol Tle mngement source progrm Leicl nlysis Syntctic nlysis Semntic nlysis nd Intermedite code gen Code

More information

Position Heaps: A Simple and Dynamic Text Indexing Data Structure

Position Heaps: A Simple and Dynamic Text Indexing Data Structure Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Start Here. Remove all tape and lift display. Locate components

Start Here. Remove all tape and lift display. Locate components HP Photosmrt 2600/2700 series ll-in-one User Guide Strt Here 1 USB cle users: Do not connect the USB cle until this guide instructs you to or the softwre my not instll properly. Use this guide to set up

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Fall 2018 Midterm 2 November 15, 2018

Fall 2018 Midterm 2 November 15, 2018 Nme: 15-112 Fll 2018 Midterm 2 November 15, 2018 Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

View, evaluate, and publish assignments using the Assignment dropbox.

View, evaluate, and publish assignments using the Assignment dropbox. Blckord Lerning System CE 6 Mnging Assignments Competencies After reding this document, you will e le to: Crete ssignments using the Assignment tool. View, evlute, nd pulish ssignments using the Assignment

More information

CSC141, Computer Science I, Instructor: Dr. Zhen Jiang, Test 2

CSC141, Computer Science I, Instructor: Dr. Zhen Jiang, Test 2 CSC141, Computer Science I, Instructor: Dr. Zhen Jiang, Test 2 Name(print) Student Number Page Points Score 2 8 3 8 4 8 5 6 6 8 7 8 8 10 9 6 10 6 11 11 12 21 Total 100 1 Part 1 (56 pts): Select the correct

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08

CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08 CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Basics of Logic Design Arithmetic Logic Unit (ALU)

Basics of Logic Design Arithmetic Logic Unit (ALU) Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information