KisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013
|
|
- Nathaniel Bishop
- 5 years ago
- Views:
Transcription
1 Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data 29th may 2013
2 Next Generation Sequencing A sequencing experiment now produces millions of short reads ( 100 nt) in a single run for a reasonable cost ( 10 3 euros) For model species, the first step is usually to map the reads to the reference genome/transcriptome For non model species, the first step is usually to assemble the reads and reconstruct the genome/transcriptome Downstream analysis includes the analysis of polymorphism (SNPs, rearrangements, splicing) Our main idea is to extract polymorphism directly from the reads, and not assemble the genome/transcriptome
3 De-Bruijn Graph The software The Model Algorithm outline De Bruijn graphs (DBG) are used as a first step in many short reads assemblers. Node = k-mer Edge = overlap of k-1 bases Example CACTCAA, k = 3
4 De-Bruijn Graph The software The Model Algorithm outline More complicated example Reference : CACTCAACTG (unknown) read1 CACTCA read2 CAACTG
5 De-Bruijn Graph The software The Model Algorithm outline Even more complicated example Reference : CACTCAACTGACT (unknown) read1 CACTCA read2 CAACTG read3 CTGACT
6 Compressed De Bruijn Graph The Model Algorithm outline Even more complicated example Reference : CACTCAACTGACT (unknown) read1 CACTCA read2 CAACTG read3 CTGACT
7 De-Bruijn Graph The software The Model Algorithm outline An assembly is a walk in the de Bruijn graph, which contains all reads as subwalks This problem is known to be NP-complete In practice, heuristics are used which consist in simplifying the graph to make it linear However, the structures that are removed may correspond to relevant biological structures (SNPs, alternative splicing).
8 Specificities of RNA-seq data The Model Algorithm outline Dynamic range of gene expression Few genes are highly expressed Many are poorly expressed Alternative splicing A gene may give rise to several transcripts
9 The Model Algorithm outline Example of DBG built from RNA-seq data
10 Polymorphism in RNA-seq data The Model Algorithm outline
11 Polymorphism in RNA-seq data The Model Algorithm outline If the purpose is to identify polymorphism, then assemblers are not well suited The variable parts are precisely the ones that will be removed 3 types of polymorphisms are expected in RNA-seq : At the genomic level SNP Approximate tandem repeats At the transcriptomic level Alternative splicing
12 SNPs The software The Model Algorithm outline SNPs correspond to recognizable patterns in the de Bruijn graph Issue : how to discriminate SNPs from sequencing errors? Idea : require a minimum coverage for each path
13 Approximate Tandem Repeats The Model Algorithm outline
14 Alternative splicing events The Model Algorithm outline Exon skipping Intron retention Alternative 5 or 3 splice site
15 Alternative splicing events The Model Algorithm outline Not covered by this pattern : Alternative transcription start and end Mutually exclusive exons
16 The software The Model Algorithm outline!"#$%$&'(")*+$(",*&"-*(.)*&-/01)"!"#$%$&'(")*+$(",*&"-*(.)*&-/01)" A general model for 0%"234 polymorphism in DBG!"#$%$&'(")*+$(",*&"-*(.)*&-/01)" 0%"234 0%" "8"9"-':/1"*,"($%#:/"9;<= 567"8"9"-':/1"*,"($%#:/"9;<= SNP : 2 paths of length 2k 1 567"8"9"-':/1"*,"($%#:/"9;<= >6?"8"="-':/"*,"($%#:/"':")*1:"9;<9@" :/$":A*"-':/1"'(0#% >6?"8"="-':/"*,"($%#:/"':")*1:"9;<9@" :/$":A*"-':/1"'(0#% Repeats : 1 path of length at >6?"8"="-':/"*,"($%#:/"':")*1:"9;<9@"!5"$B$%:"8"="-':/"*,"($%#:/"':")*1:"9;<9" :/$":A*"-':/1"'(0#% most 2k 2, the two paths align!!5"$b$%:"8"="-':/"*,"($%#:/"':")*1:"9;<9"!!5"$b$%:"8"="-':/"*,"($%#:/"':")*1:"9;<9"!!! AS : 1 path of length at most 2k 2!
17 Algorithm outline The software The Model Algorithm outline 1 De Bruijn graph construction ; 2 BiConnected Components decomposition (BCC) ; 3 Four nodes compression (SNPs and sequencing errors) ; 4 Enumeration of all bubbles with a shorter path length at most 2k 2 ; 5 Quantification and classification.
18 on simulated data Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping We simulated the sequencing of one drosophila gene with two alternative transcripts (using FluxSimulator) For different values of the coverage, we test if our method recovers the AS event recovers the AS event when the coverage is above 8X Trinity recovers the AS event when the coverage is above 18X Note : Trinity s purpose is more general as it reconstructs full-length transcripts, but for this task, it is less sensitive
19 Impact of k The software Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping At 8X, kmin=17, kmax=29
20 on real data The software Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping In order to assess if our predicted AS events are true positives, we need to test our method in the case where a reference genome is available. Data : Human Body Map 2.0 data (ERP00546) 2 tissues (out of 16) : brain and liver 75 bp reads, 32M and 39M
21 BCCs repartition The software Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
22 Confirming AS events Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping We align the two paths of the bubble to the reference genome using blat If the two paths align with the same initial and final coordinates, then it is a true positive Otherwise, it is a false positive Next, we check if the alignment coordinates correspond to an annotated AS event If the coordinates match, then it is a known event Otherwise it is a novel AS event
23 Confirming AS events Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
24 Annotated exon skipping Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
25 Annotated intron retention Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
26 Novel alternative 5 splice site Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
27 Novel complex event Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
28 Novel AS events are less expressed Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
29 Novel AS events are shorter Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping 1 short AS events tend to be under-annotated (Ex : NAGNAG) 2 we also detect genomic indels that are within genes, which we mistake for AS events
30 Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping Comparison with Trinity on real data Memory usage is better (5Gb / 100M reads) is faster, which is expected because it solves a simpler task finds 4099 events, while Trinity finds 1123, out which 570 are common 50% of the events found only by Trinity are false positives The rest is hidden in very large BCCs, and we can recover part of it using larger values of k
31 Unresolved BCC The software Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping
32 Unresolved BCC The software Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping This is not an elephant, this is a gene family :)
33 Assembly Vs Mapping Simulated Data Real Data Comparison with Trinity Unresolved BCCs Assembly Vs Mapping For model species, the pipeline is usually TopHat + Cufflinks Even in this case, (or other assembly-based approaches) may be useful. Example of event missed by Cufflinks, but which is annotated
34 (on going) With Didier Auboeuf (CRCL) Validation by RT-PCR Almost all novel events are validated Novel events found both by and Cufflinks are almost all validated Novel events found by alone are validated only if : The minor isoform has a relative abundance of at least 15 % The splicing event is simple, not complex
35 in practice Input : fasta/q files Output : 5 files (SNPs, AS events, Repeats, Indels <3nt, others) Format :
36 After the counts Testing if a variant is specific to a condition : M Reduced : Y v,c = µ + β variant v M Full : Y (v, c) = µ + β variant v + β cond c + β cond c + β variant cond v,c µ : local mean expression of the gene that contains the variant βv variant βc cond : contribution of variant v : contribution of condition c Counts are modelled using a negative binomial We compute the likelihood of both models and test with a χ 2
37 2IGV Combining output with the context given by a full length transcriptome assembler ( Trinity, Oases, etc.) Visualisation in a genome browser (IGV) The colour of an alignment depends on the log10( RPKM ) ( Read Per Kilobase per Millions mapped reads)
38 2IGV
39 Conclusion The software detects various polymorphisms (SNPs, AS, repeats ) in RNA-seq data It provides quantification for such events. is more sensitive than Trinity for finding AS events is relevant for studies without model species It brings information even when there is a model species and can be used in addition to classical pipeline
40 People and download Download : DBG construction People Rennes : Rayan Chikhi, Pavlos Antoniou, Guillaume Rizk, Raluca Uricaru, Pierre Peterlongo Lyon : Gustavo Sacomoto, Alice Julien-Laferrière, David Parsons, Janice Kielbassa, Lilia Brinza, Marie-France Sagot, Vincent Miele, Vincent Lacroix
41 Thank you! Questions?
42 Further analysis on short events
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationde Bruijn graphs for sequencing data
de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:
More informationAligners. J Fass 21 June 2017
Aligners J Fass 21 June 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-06-21
More informationDifferential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads
More informationGSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
More informationRNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
More informationAlgorithms for biological graphs: analysis and enumeration
Algorithms for biological graphs: analysis and enumeration Andrea Marino Dipartimento di Informatica, Università di Milano, Milano, Italy The aim of enumeration is to list all the feasible solutions of
More informationExercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
More informationversion /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary
Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started
More informationTutorial: RNA-Seq analysis part I: Getting started
: RNA-Seq analysis part I: Getting started August 9, 2012 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com : RNA-Seq analysis
More informationRNA-seq. Read mapping and Quantification. Genomics: Lecture #12. Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin
(1) Read and Quantification Institut für Medizinische Genetik und Humangenetik Charité Universitätsmedizin Berlin Genomics: Lecture #12 Today (1) Gene Expression Previous gold standard: Basic protocol
More informationServices Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.
Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationLong Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
More informationA review of RNA-Seq normalization methods
A review of RNA-Seq normalization methods This post covers the units used in RNA-Seq that are, unfortunately, often misused and misunderstood I ll try to clear up a bit of the confusion here The first
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationSingle/paired-end RNAseq analysis with Galaxy
October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end
More informationSequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
More informationPart 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
More informationCLC Server. End User USER MANUAL
CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationDavid Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
More informationShort Read Sequencing Analysis Workshop
Short Read Sequencing Analysis Workshop Day 8: Introduc/on to RNA-seq Analysis In-class slides Day 7 Homework 1.) 14 GABPA ChIP-seq peaks 2.) Error: Dataset too large (> 100000). Rerun with larger maxsize
More informationMapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis
More informationGoal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
More informationShotgun sequencing. Coverage is simply the average number of reads that overlap each true base in genome.
Shotgun sequencing Genome (unknown) Reads (randomly chosen; have errors) Coverage is simply the average number of reads that overlap each true base in genome. Here, the coverage is ~10 just draw a line
More informationTECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq
TECH NOTE Improving the Sensitivity of Ultra Low Input mrna Seq SMART Seq v4 Ultra Low Input RNA Kit for Sequencing Powered by SMART and LNA technologies: Locked nucleic acid technology significantly improves
More informationmrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation
mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationOur typical RNA quantification pipeline
RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More information11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub
trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity
More informationRead Mapping and Assembly
Statistical Bioinformatics: Read Mapping and Assembly Stefan Seemann seemann@rth.dk University of Copenhagen April 9th 2019 Why sequencing? Why sequencing? Which organism does the sample comes from? Assembling
More informationNGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
More informationTutorial: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and Expression measures
: RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and February 24, 2014 Sample to Insight : RNA-Seq Analysis Part II (Tracks): Non-Specific Matches, Mapping Modes and : RNA-Seq Analysis
More informationWilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
More informationData Processing and Analysis in Systems Medicine. Milena Kraus Data Management for Digital Health Summer 2017
Milena Kraus Digital Health Summer Agenda Real-world Use Cases Oncology Nephrology Heart Insufficiency Additional Topics Data Management & Foundations Biology Recap Data Sources Data Formats Business Processes
More informationUsing the UCSC genome browser
Using the UCSC genome browser Credits Terry Braun Mary Mangan, Ph.D. www.openhelix.com UCSC Genome Browser Credits Development team: http://genome.ucsc.edu/staff.html n Led by David Haussler and Jim Kent
More informationTutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationData: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:
A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat
More informationReview of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014
Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day four Quantifying expression Intro to R Differential expression
More informationHow to use earray to create custom content for the SureSelect Target Enrichment platform. Page 1
How to use earray to create custom content for the SureSelect Target Enrichment platform Page 1 Getting Started Access earray Access earray at: https://earray.chem.agilent.com/earray/ Log in to earray,
More informationm6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
More informationK-mer clustering algorithm using a MapReduce framework: application to the parallelization of the Inchworm module of Trinity
Kim et al. BMC Bioinformatics (2017) 18:467 DOI 10.1186/s12859-017-1881-8 METHODOLOGY ARTICLE Open Access K-mer clustering algorithm using a MapReduce framework: application to the parallelization of the
More informationToday's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Genome browser introduction Popular
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationTutorial MAJIQ/Voila (v1.1.x)
Tutorial MAJIQ/Voila (v1.1.x) Introduction What are MAJIQ and Voila? What is MAJIQ? What MAJIQ is not What is Voila? How to cite us? Quick start Pre MAJIQ MAJIQ Builder Outlier detection PSI Analysis Delta
More informationAligners. J Fass 23 August 2017
Aligners J Fass 23 August 2017 Definitions Assembly: I ve found the shredded remains of an important document; put it back together! UC Davis Genome Center Bioinformatics Core J Fass Aligners 2017-08-23
More informationde novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
More informationTaller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics
Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationTopHat, Cufflinks, Cuffdiff
TopHat, Cufflinks, Cuffdiff Andreas Gisel Institute for Biomedical Technologies - CNR, Bari TopHat TopHat TopHat TopHat is a program that aligns RNA-Seq reads to a genome in order to identify exon-exon
More informationAligning reads: tools and theory
Aligning reads: tools and theory Genome Sequence read :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-14pos :LM-Mel-42neg :LM-Mel-14neg :LM-Mel-42neg :LM-Mel-14neg chrx: 152139280 152139290 152139300
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationSequence Alignment. GBIO0002 Archana Bhardwaj University of Liege
Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationT-IDBA: A de novo Iterative de Bruijn Graph Assembler for Transcriptome
T-IDBA: A de novo Iterative de Bruin Graph Assembler for Transcriptome Yu Peng, Henry C.M. Leung, S.M. Yiu, Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road,
More informationall M 2M_gt_15 2M_8_15 2M_1_7 gt_2m TopHat2
Pairs processed per second 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 72,318 418 1,666 49,495 21,123 69,984 35,694 1,9 71,538 3,5 17,381 61,223 69,39 55 19,579 44,79 65,126 96 5,115 33,6 61,787
More informationGene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017
1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior
More informationIntroduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG
More informationUsing Galaxy: RNA-seq
Using Galaxy: RNA-seq Stanford University September 23, 2014 Jennifer Hillman-Jackson Galaxy Team Penn State University http://galaxyproject.org/ The Agenda Introduction RNA-seq Example - Data Prep: QC
More informationIntegrated Genome browser (IGB) installation
Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory
More informationBuilding approximate overlap graphs for DNA assembly using random-permutations-based search.
An algorithm is presented for fast construction of graphs of reads, where an edge between two reads indicates an approximate overlap between the reads. Since the algorithm finds approximate overlaps directly,
More informationRNA Sequencing with TopHat and Cufflinks
RNA Sequencing with TopHat and Cufflinks Introduction 3 Run TopHat App 4 TopHat App Output 5 Run Cufflinks 18 Cufflinks App Output 20 RNAseq Methods 27 Technical Assistance ILLUMINA PROPRIETARY 15050962
More informationWilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
More informationdiscosnp++ Reference-free detection of SNPs and small indels v2.2.2
discosnp++ Reference-free detection of SNPs and small indels v2.2.2 User's guide November 2015 contact: pierre.peterlongo@inria.fr Table of contents GNU AFFERO GENERAL PUBLIC LICENSE... 1 Publication...
More informationManual of SOAPdenovo-Trans-v1.03. Yinlong Xie, Gengxiong Wu, Jingbo Tang,
Manual of SOAPdenovo-Trans-v1.03 Yinlong Xie, 2013-07-19 Gengxiong Wu, 2013-07-19 Jingbo Tang, 2013-07-19 ********** Introduction SOAPdenovo-Trans is a de novo transcriptome assembler basing on the SOAPdenovo
More informationEvaluate NimbleGen SeqCap RNA Target Enrichment Data
Roche Sequencing Technical Note November 2014 How To Evaluate NimbleGen SeqCap RNA Target Enrichment Data 1. OVERVIEW Analysis of NimbleGen SeqCap RNA target enrichment data generated using an Illumina
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationOmega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
More informationExercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads
Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationAnaquin - Vignette Ted Wong January 05, 2019
Anaquin - Vignette Ted Wong (t.wong@garvan.org.au) January 5, 219 Citation [1] Representing genetic variation with synthetic DNA standards. Nature Methods, 217 [2] Spliced synthetic genes as internal controls
More informationCirc-Seq User Guide. A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data
Circ-Seq User Guide A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data 02/03/2016 Table of Contents Introduction... 2 Local Installation to your system...
More informationIDBA A Practical Iterative de Bruijn Graph De Novo Assembler
IDBA A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry C.M. Leung, S.M. Yiu, and Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationTiling Assembly for Annotation-independent Novel Gene Discovery
Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the
More informationIDBA - A Practical Iterative de Bruijn Graph De Novo Assembler
IDBA - A Practical Iterative de Bruijn Graph De Novo Assembler Yu Peng, Henry Leung, S.M. Yiu, Francis Y.L. Chin Department of Computer Science, The University of Hong Kong Pokfulam Road, Hong Kong {ypeng,
More informationv0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationAs of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be
48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and
More informationGenome Environment Browser (GEB) user guide
Genome Environment Browser (GEB) user guide GEB is a Java application developed to provide a dynamic graphical interface to visualise the distribution of genome features and chromosome-wide experimental
More informationShort Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
More informationGenomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
More informationRead Mapping. Slides by Carl Kingsford
Read Mapping Slides by Carl Kingsford Bowtie Ultrafast and memory-efficient alignment of short DNA sequences to the human genome Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Genome Biology
More informationYou can also compare expression between two genes by introducing both gene names in the boxes and pressing the
This tutorial is based on the Wheat Expression Browser. However, the principles are the same for any transcriptome study which is powered by the expvip graphical interface. Home Page The home page allows
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationGenome Assembly and De Novo RNAseq
Genome Assembly and De Novo RNAseq BMI 7830 Kun Huang Department of Biomedical Informatics The Ohio State University Outline Problem formulation Hamiltonian path formulation Euler path and de Bruijin graph
More informationPerformance of Trinity RNA-seq de novo assembly on an IBM POWER8 processor-based system
Performance of Trinity RNA-seq de novo assembly on an IBM POWER8 processor-based system Ruzhu Chen and Mark Nellen IBM Systems and Technology Group ISV Enablement August 2014 Copyright IBM Corporation,
More informationRsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationIntroduction to Cancer Genomics
Introduction to Cancer Genomics Gene expression data analysis part I David Gfeller Computational Cancer Biology Ludwig Center for Cancer research david.gfeller@unil.ch 1 Overview 1. Basic understanding
More informationReference guided RNA-seq data analysis using BioHPC Lab computers
Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are
More information