Today's outline. Resources. Genome browser components. Genome browsers: Discovering biology through genomics. Genome browser tutorial materials
|
|
|
- Claire Hicks
- 5 years ago
- Views:
Transcription
1 Today's outline Genome browsers: Discovering biology through genomics BaRC Hot Topics April 2013 George Bell, Ph.D. Genome browser introduction Popular types of genome browsers UCSC Genome Browser Integrative Genomics Viewer (IGV) Ensembl Gbrowse (SGD, FlyBase, WormBase, TAIR, ZFIN, HapMap, Planarian at Whitehead ) Browser file formats for custom data tracks Throughout the talk: Mining the genome 2 Resources Genome browser components Genome browser tutorial materials Browser file formats: Previous Hot Topics ( OpenHelix training materials (some free) BaRC scientists 3 Genome sequence (partially or fully assembled) Graphics + data browsing/searching system Collection of data (qualitative and quantitative) linked to genome coordinates genome features linked to genome coordinates System to view custom data Algorithm to align sequences to genome 4
2 Practical hints UCSC Genome Browser Take careful notes of genome assembly for All coordinates All custom browser files Genome is updated infrequently Data in genome browser can be updated as often as daily Data displayed in genome browser is often generated by others Try out different genome browsers 5 6 UCSC: Demo and exercise 1 Does the RefSeq gene catalog contain the correct isoforms of your favorite human gene? Provide evidence from primary sequence Examples: WASH2P, BMP4 UCSC: Demo and exercise 2 Get the promoter of your favorite gene (defined as 2kb upstream to 2kb downstream of the transcription start site) Examples: BMP4, SERPIND1 According to ENCODE, do any transcription factors bind this promoter? 7 8
3 Integrative Genomics Viewer (IGV) IGV: Demo and exercise 3 Using the Illumina Body Map RNA-Seq data on IGV, Is GATA4 really expressed at a higher level in heart than in skeletal muscle? Why isn't this comparison of mapped reads quantitative? 9 10 IGV: Demo and exercise 4 Using the Illumina Body Map RNA-Seq data on IGV, Does the heart subject have any variants in GATA4? Where? Center the variant(s) in the display, zoom in all the way, and save that view as a session. Ensembl: more than a browser An automated genome annotation pipeline Includes thorough h homology analysis via Compara Hosts hand-curated gene annotation projects (Vega; Havana) All data can be downloaded in a variety of ways BioMart is a powerful web interface to the Ensembl databases Beyond IGV: Is this variant a known SNP? 11 12
4 Ensembl gene pages Ensembl: Demo and exercise 5 Go to the Ensembl page for mouse Uox (urate oxidase) Download Uox homologs (in fasta format) from as many species as possible Is this gene missing in any primates? Ensembl: Demo and exercise 6 Gbrowse (many MODs) Use BioMart to get a list of all human genes on chromosome 1 and corresponding mouse homologs 15 16
5 GBrowse: Demo and exercise 7 Go to TAIR (The Arabidopsis Information Resource) Find Gbrowse (under Tools) Find gene AT2G19420 What non-coding ggene overlaps it? Download a GFF file of these genes and view it in Excel. 17 Viewing custom data About any data can be viewed in a genome browser as long as it is Linked to genome coordinates Organized in a standard format that is qualitative (ex: bed, bam), or quantitative (ex: wig, bedgraph) Different formats using different counting schemes (starting at 0 or 1) so off-by-one bugs are easy to make BAM files need to be sorted and indexed first 18 Demo and exercise 8 Go to UCSC ( - WI only) or IGV Locate track files in \\BaRC_Public\Hot_Topics\Genome_browsers_Apr_201 3 Add the 4 tracks to the browser (mm9) TargetScanMouse6_mm9.chr3.bed TargetScanMouse6_mm9.chr3.bedgraph CGH.mm9.chr3-4.wig track type=bam name="heart BAM" bigdataurl= browsers_apr_2013/heartcellrnaseq.bam Look at some chr3 genes (ex: Pfn2, Serp1, Ssr3, Hdgf) Optimize the display modes of your custom tracks 19 Other notable browsers JBrowse Golden Helix GenomeBrowse WashU Epigenome Browser UCSC Cancer Genome Browser 1000 Genomes Browser 20
6 Summary Browser locations Genome browser introduction Popular types of genome browsers UCSC Genome Browser Integrative Genomics Viewer (IGV) Ensembl Gbrowse (SGD, FlyBase, WormBase, TAIR, ZFIN, Planarian at Whitehead ) Browser file formats for custom data tracks UCSC Genome Browser: (inside Whitehead network) IGV: Ensembl: Gbrowse:
Genomic Analysis with Genome Browsers.
Genomic Analysis with Genome Browsers http://barc.wi.mit.edu/hot_topics/ 1 Outline Genome browsers overview UCSC Genome Browser Navigating: View your list of regions in the browser Available tracks (eg.
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
Integrative Genomics Viewer. Prat Thiru
Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV
A short Introduction to UCSC Genome Browser
A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using
Genome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
Part 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
Genome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
RNA-Seq Analysis With the Tuxedo Suite
June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.
Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research
Genomic Computing, DEIB, 4-7 March 2013 Advanced genome browsers: Integrated Genome Browser and others Heiko Muller Computational Research IIT@SEMM heiko.muller@iit.it List of Genome Browsers Alamut Annmap
Getting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
Analysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
Background and Strategy. Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan
Background and Strategy Smitha, Adrian, Devin, Jeff, Ali, Sanjeev, Karthikeyan What is a genome browser? A web/desktop based graphical tool for rapid and reliable display of any requested portion of the
Analyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
NGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
From genomic regions to biology
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
The UCSC Gene Sorter, Table Browser & Custom Tracks
The UCSC Gene Sorter, Table Browser & Custom Tracks Advanced searching and discovery using the UCSC Table Browser and Custom Tracks Osvaldo Graña Bioinformatics Unit, CNIO 1 Table Browser and Custom Tracks
Advanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
ChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
ChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
Introduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
Tutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
Finding and Exporting Data. BioMart
September 2017 Finding and Exporting Data Not sure what tool to use to find and export data? BioMart is used to retrieve data for complex queries, involving a few or many genes or even complete genomes.
ChIP-Seq Tutorial on Galaxy
1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data
The UCSC Genome Browser
The UCSC Genome Browser Search, retrieve and display the data that you want Materials prepared by Warren C. Lathe, Ph.D. Mary Mangan, Ph.D. www.openhelix.com Updated: Q3 2006 Version_0906 Copyright OpenHelix.
David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
Browser Exercises - I. Alignments and Comparative genomics
Browser Exercises - I Alignments and Comparative genomics 1. Navigating to the Genome Browser (GBrowse) Note: For this exercise use http://www.tritrypdb.org a. Navigate to the Genome Browser (GBrowse)
ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
You will be re-directed to the following result page.
ENCODE Element Browser Goal: to navigate the candidate DNA elements predicted by the ENCODE consortium, including gene expression, DNase I hypersensitive sites, TF binding sites, and candidate enhancers/promoters.
W ASHU E PI G ENOME B ROWSER
Roadmap Epigenomics Workshop W ASHU E PI G ENOME B ROWSER SOT 2016 Satellite Meeting March 17 th, 2016 Ernest N. Morial Convention Center, New Orleans, LA Presenter: Ting Wang Tutorial Overview: WashU
Creating and Using Genome Assemblies Tutorial
Creating and Using Genome Assemblies Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Create a Genome Assembly for Danio rerio 2 2. Building Annotation Sources 5 A. Creating a Reference
epigenomegateway.wustl.edu
Everything can be found at epigenomegateway.wustl.edu REFERENCES 1. Zhou X, et al., Nature Methods 8, 989-990 (2011) 2. Zhou X & Wang T, Current Protocols in Bioinformatics Unit 10.10 (2012) 3. Zhou X,
BovineMine Documentation
BovineMine Documentation Release 1.0 Deepak Unni, Aditi Tayal, Colin Diesh, Christine Elsik, Darren Hag Oct 06, 2017 Contents 1 Tutorial 3 1.1 Overview.................................................
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
W ASHU E PI G ENOME B ROWSER
W ASHU E PI G ENOME B ROWSER Keystone Symposium on DNA and RNA Methylation January 23 rd, 2018 Fairmont Hotel Vancouver, Vancouver, British Columbia, Canada Presenter: Renee Sears and Josh Jang Tutorial
ChIP-seq hands-on practical using Galaxy
ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
Tutorial: RNA-Seq analysis part I: Getting started
: RNA-Seq analysis part I: Getting started August 9, 2012 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com : RNA-Seq analysis
Introduction to Galaxy
Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of
NGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
Maize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
JBrowse. To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start
JBrowse To get started early: Double click VirtualBox on the desktop Click JBrowse 2016 Tutorial Click Start JBrowse PAG 2015 Scott Cain GMOD Coordinator scott@scottcain.net What is GMOD? A set of interoperable
Genome Browser Background and Strategy
Genome Browser Background and Strategy April 12th, 2017 BIOL 7210 - Faction I (Outbreak) - Genome Browser Group Adam Dabrowski Mrunal Dehankar Shareef Khalid Hubert Pan Ajay Ramakrishnan Ankit Srivastava
Sequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
ChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
Exercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
Analyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
High-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool
The Galaxy Track Browser: Transforming the Genome Browser from Visualization Tool to Analysis Tool Jeremy Goecks * Kanwei Li Ω Dave Clements ℵ The Galaxy Team James Taylor ℇ Emory University Emory University
Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises
UCSC Genome Browser Pittsburgh Workshop -- Practical Exercises We will be using human assembly hg19. These problems will take you through a variety of resources at the UCSC Genome Browser. You will learn
GEP Project Management System: TSS Project Submission
GEP Project Management System: TSS Project Submission Author Wilson Leung wleung@wustl.edu Document History Initial Draft 08/21/2015 Version GEP Project Management System (Version alpha) Introduction In
Integrated Genome browser (IGB) installation
Integrated Genome browser (IGB) installation Navigate to the IGB download page http://bioviz.org/igb/download.html You will see three icons for download: The three icons correspond to different memory
Topics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
de.nbi and its Galaxy interface for RNA-Seq
de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/
How To: Run the ENCODE histone ChIP- seq analysis pipeline on DNAnexus
How To: Run the ENCODE histone ChIP- seq analysis pipeline on DNAnexus Overview: In this exercise, we will run the ENCODE Uniform Processing ChIP- seq Pipeline on a small test dataset containing reads
Table of contents Genomatix AG 1
Table of contents! Introduction! 3 Getting started! 5 The Genome Browser window! 9 The toolbar! 9 The general annotation tracks! 12 Annotation tracks! 13 The 'Sequence' track! 14 The 'Position' track!
BIOINFORMATICS. Savant: Genome Browser for High Throughput Sequencing Data
BIOINFORMATICS Vol. 00 no. 00 2010 Pages 1 6 Savant: Genome Browser for High Throughput Sequencing Data Marc Fiume 1,, Vanessa Williams 1, and Michael Brudno 1,2 1 Department of Computer Science, University
ChIP- seq Analysis. BaRC Hot Topics - Feb 24 th 2015 BioinformaBcs and Research CompuBng Whitehead InsBtute. hgp://barc.wi.mit.
ChIP- seq Analysis BaRC Hot Topics - Feb 24 th 2015 BioinformaBcs and Research CompuBng Whitehead InsBtute hgp://barc.wi.mit.edu/hot_topics/ Before we start: 1. Log into tak (step 0 on the exercises) 2.
Tutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
Agilent Genomic Workbench Lite Edition 6.5
Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010
Helpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
Genome Browser. Background and Strategy
Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples
Public Repositories Tutorial: Bulk Downloads
Public Repositories Tutorial: Bulk Downloads Almost all of the public databases, genome browsers, and other tools you have explored so far offer some form of access to rapidly download all or large chunks
WASHU EPIGENOME BROWSER 2018 epigenomegateway.wustl.edu
WASHU EPIGENOME BROWSER 2018 epigenomegateway.wustl.edu 3 BROWSER MAP 14 15 16 17 18 19 20 21 22 23 24 1 2 5 4 8 9 10 12 6 11 7 13 Key 1 = Go to this page number to learn about the browser feature TABLE
Preprint. Bovine Genome Database: Tools for Mining the Bos taurus Genome. Running Title: Bovine Genome Database
Preprint Hagen D.E., Unni D.R., Tayal A., Burns G.W., Elsik C.G. (2018) Bovine Genome Database: Tools for Mining the Bos taurus Genome. In: Kollmar M. (eds) Eukaryotic Genomic Databases. Methods in Molecular
Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
Galaxy. Daniel Blankenberg The Galaxy Team
Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing
Tutorial: Jump Start on the Human Epigenome Browser at Washington University
Tutorial: Jump Start on the Human Epigenome Browser at Washington University This brief tutorial aims to introduce some of the basic features of the Human Epigenome Browser, allowing users to navigate
Tutorial 1: Using Excel to find unique values in a list
Tutorial 1: Using Excel to find unique values in a list It is not uncommon to have a list of data that contains redundant values. Genes with multiple transcript isoforms is one example. If you are only
UCSC Genome Browser ASHG 2014 Workshop
UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,
BioMart: a research data management tool for the biomedical sciences
Yale University From the SelectedWorks of Rolando Garcia-Milian 2014 BioMart: a research data management tool for the biomedical sciences Rolando Garcia-Milian, Yale University Available at: https://works.bepress.com/rolando_garciamilian/2/
Under the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
Exon Probeset Annotations and Transcript Cluster Groupings
Exon Probeset Annotations and Transcript Cluster Groupings I. Introduction This whitepaper covers the procedure used to group and annotate probesets. Appropriate grouping of probesets into transcript clusters
Design and Annotation Files
Design and Annotation Files Release Notes SeqCap EZ Exome Target Enrichment System The design and annotation files provide information about genomic regions covered by the capture probes and the genes
Welcome to GenomeView 101!
Welcome to GenomeView 101! 1. Start your computer 2. Download and extract the example data http://www.broadinstitute.org/~tabeel/broade.zip Suggestion: - Linux, Mac: make new folder in your home directory
Chen lab workshop. Christian Frech
GBrowse Generic genome browser Chen lab workshop Christian Frech January 18, 2010 1 A generic genome browser why do we need it? Genome databases have similar requirements View DNA sequence and its associated
NGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
BIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 14 2011, pages 1889 1893 doi:10.1093/bioinformatics/btr309 Genome analysis Advance Access publication May 19, 2011 GenPlay, a multipurpose genome analyzer and
User's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
The software and data for the RNA-Seq exercise are already available on the USB system
BIT815 Notes on R analysis of RNA-seq data The software and data for the RNA-Seq exercise are already available on the USB system The notes below regarding installation of R packages and other software
Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.
Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take
Genetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
This module contains three plugins: Decouple.pl, Add.pl and Delete.pl.
NeoChr NeoChr is used to construct new chromosome denovo. It would assist users to grab related genes in different pathways of various organism manually, to rewire genes relationship logically*, and to
Using the GenomicFeatures package
Using the GenomicFeatures package Marc Carlson Fred Hutchinson Cancer Research Center December 10th 2010 Bioconductor Annotation Packages: a bigger picture PLATFORM PKGS GENE ID HOMOLOGY PKGS GENE ID ORG
KisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013
Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data 29th may 2013 Next Generation Sequencing A sequencing experiment now produces millions of short reads ( 100 nt)
HymenopteraMine Documentation
HymenopteraMine Documentation Release 1.0 Aditi Tayal, Deepak Unni, Colin Diesh, Chris Elsik, Darren Hagen Apr 06, 2017 Contents 1 Welcome to HymenopteraMine 3 1.1 Overview of HymenopteraMine.....................................
HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
![HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)](/thumbs/71/65752105.jpg "HIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)")
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
Integra(ve Genomics Viewer IGV. Tom Carroll MRC Clinical Sciences Centre
Integra(ve Genomics Viewer IGV Tom Carroll MRC Clinical Sciences Centre Introduc(on to IGV. What is IGV. How to run IGV. Naviga(ng IGV. The IGV user interface. Moving around genomes. Loading and visualising
Sequencing Data. Paul Agapow 2011/02/03
Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)
Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG