DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM
|
|
- Barnard Young
- 6 years ago
- Views:
Transcription
1 DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM Daniela Maria Cirillo San Raffaele Scientific Institute, Milan
2 COI/CA OSR as signed MTA with Janssen and Otzuka as SRL and is involved in the development of MGIT test for delamanid OSR has received reimbursement for participation to the reproducibility study sponsored by Janssen OSR is leading the SRLN project partially financed by Otzuka for the development of DLM DST in MGIT
3 DELAMANID (DLM) Delamanid is a nitromidoxazole compound that specifically impairs the bio-synthesis of methoxy- and keto-mycolic acids, by disrupting metabolism of the cell wall (Matsumoto M, 2006, Plos Med). Active on both replicating and not bacilli (Matsumoto M, 2006, Plos Med). Like other Nitroimidazoles, DLM require activation by mycobacterial F420-dependent deazaflavin-dependent nitroreductase (Rv3547 or Ddn) (Matsumoto M. et al., Plos One 2006) Mechanism of resistance: Mutations in genes involved in coenzyme F420 biosynthesis and metabolism [fbia (Rv3261), fbib (Rv3262), fbic (Rv1173), fgd1 (Rv0407)] has been proposed as possible mechanisms of resistance to DLM (Choi KP et al., J. Bacteriol. 2002) Spontaneous rate of resistance to delamanid in in he range of 6.44 x x 10-5 (EMA, 2013)
4 DELAMANID - DELTYBA Well tolerated in TB patients, associated to higher favourable treatment outcomes and significantly lower mortality, not associated with clinically relevant drug-drug interactions (Blair HA, 2015,Drugs; Gler MT, 2012, Engl J Med). Conditional approval by WHO in 2014 for MDR-XDR TB treatment Deltyba has received marketing authorization by the European Medicine Agency and the Japanese Ministry of Health, Labor and Welfare in 2014 (Ryan NJ, 2014, Drugs). Delamanid is available in the UK, Germany and other European Countries for the management of MDR-TB patients and has received conditional approval by the world health organization (WHO).
5 AIMS To develop a standardized protocol for rapid Delamanid (DLM) susceptibility testing (DST) using the semi-automated BACTEC MGIT 960 To define a breakpoint able to accurately discriminate between susceptibility and resistance of Mycobacterium tuberculosis (MTB) towards DLM.
6 EXPERIMENTAL PLAN Validation of the resazurin microtiter assay (REMA) and MGIT MIC against the 7H11 agar based protocol (APM) on a panel of 19 Otsuka precharacterized strains Determination of MIC distribution in REMA and MGIT of clinical isolates never exposed to the drug. Results confirmed by APM WGS of study strains to explore genetic polymorphisms in the five genes involved in the F420 mediated activation
7 7H11/REMA/MGIT µg/ml RESISTANT STRAINS SUSCEPTIBLE STRAINS A break point of 0,2 µg/ml has been proposed by Otsuka based on previous work on a collection of wt and resistant mutant in vitro generated strains The break point has been discussed with the EUCAST committee (0,06 µg/ml)
8 DLM mic Determination of DLM MIC for a panel of 19 reference strains using REMA (from 0,0005 to 32 mg/l), MGIT and 7H11 (from 0,0005 to 16 mg/l) Otsuka has independently established a 7H11-based DST method for testing strains and based on MIC performed on a collection of wt and resistant mutant in vitro generated strains defined a Breakpoint of 0,2 mg/l.
9 MGIT-REMA ON OTSUKA PANEL Code #strain MIC (OTSK) REMA 7H11 MGIT 1 MGIT 2 OTSK N0268 R > 32 > 16 > 16 > 16 OTSK N1002 R OTSK N0185 R > 32 > 16 > 16 > 16 OTSK N0652 R 0,5 1 0,25 0,25 OTSK N0339 S 0,03 0,004 0,016 0,008 OTSK N0085 S 0,008 0,016 0,008 0,004 OTSK N0001 S 0,016 0,016 0,016 0,008 OTSK N0082 S 0,016 0,016 0,008 0,008 OTSK N0299 S 0,008 0,016 0,016 0,01 OTSK N0156 S 0,004 0,004 0,004 0,008 OTSK N0400 S 0,008 0,004 0,004 0,016 OTSK N0117 S 0,008 0,008 0,016 0,008 OTSK N0110 S 0,004 0,016 0,008 0,008 OTSK N0678 S 0,008 0,002 0,004 0,008 OTSK N0097 S 0,008 0,004 0,016 0,016 OTSK N0667 S 0,004 0,004 0,004 0,004 OTSK N0946 S 0,008 0,004 0,004 0,004 OTSK N0193 S 0,03 0,125 0,03 0,03 H37RV S 0,004 0,016 0,004 0,008
10 WGS ON OTSUKA PANEL Code #strain MIC ddn (Rv3547) fgd (Rv0407) fbia (Rv3261) fbib (Rv3262) fbic (Rv1173) Lineage OTSK N0268 R Insertion pos: Phe 320 (silent) wt wt wt Beijing OTSK N1002 R pos CA->C DEL Phe 320 (silent) wt wt wt Beijing OTSK N0185 R INSERTION + GTCA (pos: ) wt wt wt Trp678Gly Leu 55 (silent) LAM OTSK N0184 R Pos G->GTCA INS wt wt wt Trp678Gly Leu 55 (silent) LAM OTSK N0652 R Leu107Pro wt wt wt wt LAM OTSK N0339 S wt wt wt wt wt LAM OTSK N0085 S wt wt wt wt wt LAM OTSK N0001 S wt Phe 320 (silent) wt wt wt Beijing OTSK N0082 S wt Phe 320 (silent) wt wt wt Beijing OTSK N0299 S wt wt wt wt Asp375Asn LAM OTSK N0156 S wt Phe 320 (silent) wt wt wt Beijing OTSK N0400 S wt Phe 320 (silent) Val 5 (silent) wt wt EAI "Manila" OTSK N0117 S OTSK N0110 S wt Phe 320 (silent) wt wt wt Beijing OTSK N0678 S wt wt wt wt wt LAM OTSK N0097 S wt wt wt wt Try678Gly Leu 55 (silent) LAM OTSK N0667 S wt wt wt wt Lys 8 (silent) Euro-Am Sup OTSK N0946 S wt wt wt wt wt Euro-Am Sup OTSK N0193 S wt Phe 320 (silent) wt wt wt Beijing
11 SELECTION OF CLINICAL STRAINS: n 288 America 1% XDR 14% Europe 43% Africa 23% pre-xdr 16% Susceptible 29% Asia 33% MDR 32% NO-MDR 9% TUR 1% Euro- America n Ural Superlin 6% eage Ghana 1% Beijing 38% AFRI II 1% LAM Haarlem 10% 10% EAI 8% Delhi- CAS 5%
12 MIC IN REMA AND MGIT DLM MIC [µg/ml] 0,03 0,06 0,125 0,25 0,5 1 Total Susceptible MDR pre-xdr XDR NO_MDR Total number of strains DLM MIC [µg/ml] 0,03 0,06 0,125 0,25 0,5 1 Total Susceptible MDR pre-xdr XDR NO_MDR Total number of strains
13 EXTENDED MIC in REMA and MGIT
14 CORRELATION MGIT-REMA Table 1. Correlation of drug susceptibility results obtained for 221 clinical strains tested both in MGIT and REMA. Conventional breakpoint of 0.2 mg/l determined by agar proportion method was considered when assigning the definition of Susceptible (S) or Resistant (R)
15 CHARACTERIZATION OF THE 4 DLM RESISTANT STRAINS Strain Lineage Phenotipic DST SNP ddn (Rv3547) fbia (Rv3261) DLM_R1 Beijing MDR tgg->tag W88STOP wt Beijing subfamily W148 DLM_R2 Beijing MDR tgg->tag W88STOP wt DLM_R3 Beijing MDR tgg->tag W88STOP wt DLM_R4 Beijing XDR Aag->Tag wt K250STOP 3 Strains resistant harboured a stop codon mutation in ddn (W88STOP) and 1 FbiA (K250STOP).
16 SNPs IN GENES INVOLVED IN DLM ACTIVATION Genome analysis of the 167 DLM susceptible strains revealed eleven polymorphisms in the five genes associated to drug activation ddn, fgd1, fbia, fbib, fbic leading to amino acid exchanges in 39 (22.8%) out of 171 strains (Table 2). gene Nucleotide change Amino-acid change number of strains with the SNP ddn fbia fbib fbic fgd1 Cgg->Tgg R72W 2 gag->gac E83D 1 cag->cgg Q120R 4 acg->atg T302M 2 ctg->cgg K447R 1 aag->agg L448R 1 Ttc->Ctc F220L 8 Acg->Gcg T273A 5 acc->atc T681I 1 aag->atg* K270M* 13 Aag->Gag* K296E* 1 Two of the identified SNPs were previously described as lineage-specific mutation of Haarlem (K270M) and M. africanum WA2 (K296E) genotypes.
17 MULTICENTER STUDY FOR THE VALIDATION OF BREAKPOINT Validation of breakpoint in MGIT using 75 clinical isolates per study site plus 25 isolates from the original panel in four to six SR laboratories ( tests in total)
18 CONCLUSION DST for DLM can be performed in both MGIT and REMA. We propose mg/l as a breakpoint to screen for DLM sensitivity to this new drug Pre-exposure high level resistance was observed on clinical strains Low level resistance was not observed WGS analysis in genes involved in the activation pathways show presence of several SNPs non related to an increased MIC STOPcodons in the same genes are clearly associated to high level of resistance
19 ACKNOWLEDGEMENTS Otsuka Becton Dickinson San Raffaele Scientific Institute,Milano: S. Battaglia E. Borroni A. Cabibbe A. Trovato E. Schena GMBH, Gouting H. Hoffman S. Hoffman L. Nedialkova Research Center, Borstel M. Merkel C. Upatel S.Niemann SRL network WHO - LDR
20 SNPs in genes involved in DLM activation Phenotype Lineage fgd1 fbia fbib fbic ddn Rv3547 nt change MIC MDR Beijing wt wt wt wt Trp88STOP TGG->TGA 32 MDRGenome Beijing analysis wt of the wt167 DLM wt susceptible wt Trp88STOP strains revealed TGG->TGA eleven 32 MDRpolymorphisms Beijing in the wt five genes wt associated wt to drug wt activation Trp88STOPddn, fgd1, TGG->TGA fbia, fbib, 32 DR EAI wt wt wt wt Arg72Trp AGG->TGG 0,002 MDRfbiC leading Ural to amino wtacid exchanges wt in 39 wt (22.8%) wt out of Glu83Asp 171 strains (Table GAG->GAT 2). 0,001 MDR-AG EAI wt wt wt wt Arg72Trp AGG->TGG 0,004 MDR M. africanum WA2 Lys296Glu* wt wt wt wt AAG->GAG 0,001 MDR Harlem Lys270Ser* wt wt wt wt AAG->ATG 0,004 XDR Beijing Lys250STOP wt wt wt wt AAG->TAG 32 MDR-FQ Eur-Am Superlineage wt Thr302Met wt wt wt ACG->ATG 0,001 MDR Eur-Am Superlineage wt Thr302Met wt wt wt ACG->ATG 0,002 DR Eur-Am Superlineage wt Gln120Arg Phe220Leu wt wt CAA->CGA;TTC->TTA 0,0016 DR Eur-Am Superlineage wt Gln120Arg wt wt wt CAA->CGA 0,008 S Eur-Am Superlineage wt Gln120Arg wt wt wt CAA->CGA 0,004 S Eur-Am Superlineage wt Gln120Arg wt wt wt CAA->CGA 0,008 MDR Beijing wt wt Phe220Leu wt wt TTC->TTA 0,004 MDR Delhi/CAS wt wt Lys448Arg wt wt AAG->AGA 0,008 S Eur-Am Superlineage wt wt Leu447Arg wt wt CTA->CGA 0,004 S Eur-Am Superlineage wt wt wt Thr273Ala wt ACT->GCT 0,002 S Eur-Am Superlineage wt wt wt Thr273Ala wt ACT->GCT 0,004 S Eur-Am Superlineage wt wt Phe220Leu Thr273Ala wt TTC->TTA 0,008 S Eur-Am Superlineage wt wt wt Thr273Ala wt ACT->GCT 0,008 S Beijing wt wt wt wt Thr681Ile ACC->ATC 0,004 Two of the identified SNPs were previously described as lineage-specific mutation of Haarlem (K270M) and M. africanum WA2 (K296E) genotypes.
Evolution of high-level ethambutol-resistant tuberculosis. through interacting mutations in decaprenylphosphoryl-β-darabinose
Supplementary Information: Evolution of high-level ethambutol-resistant tuberculosis through interacting mutations in decaprenylphosphoryl-β-darabinose biosynthetic and utilization pathway genes Hassan
More informationby the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.
Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator
More informationGenome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner
Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications
More informationHP22.1 Roth Random Primer Kit A für die RAPD-PCR
HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz
More informationSUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells
SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh
More informationPyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds
Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,
More information6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3
6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}
More informationwarm-up exercise Representing Data Digitally goals for today proteins example from nature
Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,
More informationSupplementary Table 1. Data collection and refinement statistics
Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (
More informationAppendix A. Example code output. Chapter 1. Chapter 3
Appendix A Example code output This is a compilation of output from selected examples. Some of these examples requires exernal input from e.g. STDIN, for such examples the interaction with the program
More informationTCGR: A Novel DNA/RNA Visualization Technique
TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu
More informationGenome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department
http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:
More informationMachine Learning Classifiers
Machine Learning Classifiers Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision trees Naïve Bayes Perceptrons, Multi-layer Neural Networks
More information2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA
176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45
More informationMLiB - Mandatory Project 2. Gene finding using HMMs
MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA
More informationAnalyzing Variant Call results using EuPathDB Galaxy, Part II
Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is
More informationDigging into acceptor splice site prediction: an iterative feature selection approach
Digging into acceptor splice site prediction: an iterative feature selection approach Yvan Saeys, Sven Degroeve, and Yves Van de Peer Department of Plant Systems Biology, Ghent University, Flanders Interuniversity
More informationCrick s Hypothesis Revisited: The Existence of a Universal Coding Frame
Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Jean-Louis Lassez*, Ryan A. Rossi Computer Science Department, Coastal Carolina University jlassez@coastal.edu, raross@coastal.edu
More informationDNA Sequencing. Overview
BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles
More informationA relation between trinucleotide comma-free codes and trinucleotide circular codes
Theoretical Computer Science 401 (2008) 17 26 www.elsevier.com/locate/tcs A relation between trinucleotide comma-free codes and trinucleotide circular codes Christian J. Michel a,, Giuseppe Pirillo b,c,
More informationSupplementary Materials:
Supplementary Materials: Amino acid codo n Numb er Table S1. Codon usage in all the protein coding genes. RSC U Proportion (%) Amino acid codo n Numb er RSC U Proportion (%) Phe UUU 861 1.31 5.71 Ser UCU
More informationDegenerate Coding and Sequence Compacting
ESI The Erwin Schrödinger International Boltzmanngasse 9 Institute for Mathematical Physics A-1090 Wien, Austria Degenerate Coding and Sequence Compacting Maya Gorel Kirzhner V.M. Vienna, Preprint ESI
More informationSupplementary Data. Image Processing Workflow Diagram A - Preprocessing. B - Hough Transform. C - Angle Histogram (Rose Plot)
Supplementary Data Image Processing Workflow Diagram A - Preprocessing B - Hough Transform C - Angle Histogram (Rose Plot) D - Determination of holes Description of Image Processing Workflow The key steps
More informationThe Human PAX6 Mutation Database
1998 Oxford University Press Nucleic Acids Research, 1998, Vol. 26, No. 1 259 264 The Human PAX6 Mutation Database Alastair Brown*, Mark McKie, Veronica van Heyningen and Jane Prosser Medical Research
More informationHuntington s Disease and Vertex Pharmaceuticals
Huntington s Disease and Vertex Pharmaceuticals Jeff Stack, Ph.D. Vertex, San Diego HDSA Annual Convention June 7, 2008 www.vrtx.com Outline Background on Vertex Pharmaceuticals Vertex drug discovery collaboration
More informationAssembly in the Clouds
Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools
More informationScalable Solutions for DNA Sequence Analysis
Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000
More informationStructural analysis and haplotype diversity in swine LEP and MC4R genes
J. Anim. Breed. Genet. ISSN - OIGINAL ATICLE Structural analysis and haplotype diversity in swine LEP and MC genes M. D Andrea, F. Pilla, E. Giuffra, D. Waddington & A.L. Archibald University of Molise,
More informationQuality Assurance International standards (ISO/CLSI) Susanne Karlsmose DTU Food, Denmark
Quality Assurance International standards (ISO/CLSI) Susanne Karlsmose suska@food.dtu.dk DTU Food, Denmark Definition A quality management system can be defined as: Coordinated activities to direct and
More information10/8/13 Comp 555 Fall
10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear
More informationPlanning for CPIC Database content, functionality, API
Planning for CPIC Database content, functionality, API Listening Sessions CPIC Informatics Call 11/27/18 CPIC Call 12/6/18 Developing new tools to expand and customize use of CPIC guidelines Make guidelines
More informationSequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes
Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity
More informationSupporting Information
Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2015. Supporting Information for Small, DOI: 10.1002/smll.201501370 A Compact DNA Cube with Side Length 10 nm Max B. Scheible, Luvena
More informationThe Stop TB Partnership
The Stop TB Partnership Vision, principles, opportunities and challenges of successful National Stop TB Partnerships Dr Giuliano Gargioni National Consultative Meeting of Partners PARTNERSHIP FOR TUBERCULOSIS
More informationUser Manual. Ver. 3.0 March 19, 2012
User Manual Ver. 3.0 March 19, 2012 Table of Contents 1. Introduction... 2 1.1 Rationale... 2 1.2 Software Work-Flow... 3 1.3 New in GenomeGems 3.0... 4 2. Software Description... 5 2.1 Key Features...
More information10/15/2009 Comp 590/Comp Fall
Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg
More informationPhD: a web database application for phenotype data management
Bioinformatics Advance Access published June 28, 2005 The Author (2005). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org PhD:
More informationA CAM(Content Addressable Memory)-based architecture for molecular sequence matching
A CAM(Content Addressable Memory)-based architecture for molecular sequence matching P.K. Lala 1 and J.P. Parkerson 2 1 Department Electrical Engineering, Texas A&M University, Texarkana, Texas, USA 2
More informationTopics of the talk. Biodatabases. Data types. Some sequence terminology...
Topics of the talk Biodatabases Jarno Tuimala / Eija Korpelainen CSC What data are stored in biological databases? What constitutes a good database? Nucleic acid sequence databases Amino acid sequence
More informationISO INTERNATIONAL STANDARD. Health informatics Genomic Sequence Variation Markup Language (GSVML)
INTERNATIONAL STANDARD ISO 25720 First edition 2009-08-15 Health informatics Genomic Sequence Variation Markup Language (GSVML) Informatique de santé Langage de balisage de la variation de séquence génomique
More informationLABORATORY STANDARD OPERATING PROCEDURE FOR PULSENET CODE: PNL28 MLVA OF SHIGA TOXIN-PRODUCING ESCHERICHIA COLI
1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Shiga toxin-producing Escherichia coli O157 (STEC O157) and Salmonella enterica serotypes Typhimurium and Enteritidis.
More informationCDISC in Europe. CDISC Interchange Japan, Tokyo, July 20, 2010
CDISC in Europe Pierre-Yves Lastic, PhD Chairman, CDISC E3C & French User Group Senior Director, Data Privacy & Healthcare Interoperability Standards, Sanofi-Aventis R&D CDISC Interchange Japan, Tokyo,
More informationand genomic DNA (Mut) and WT of patient healthy women and
Supplementary Figure 1 TEKT germline variations in the control group and blood sampless of 84 breast cancerr patients. (a) TEKT44 wild-typee (WT), mutant (Mut) and WT to Mut genotype byy Sanger sequencing
More informationTHIRD MEETING OF THE CORE GROUP OF THE GLOBAL DRUG- RESISTANT TB INITIATIVE
THIRD MEETING OF THE CORE GROUP OF THE GLOBAL DRUG- RESISTANT TB INITIATIVE 1 MAY, 2015 GENEVA, SWITZERLAND 0 Table of Contents List of participants... 2 Background... 4 Welcome address... 4 Meeting objectives...
More informationFOURTH MEETING OF THE CORE GROUP OF THE GLOBAL DRUG RESISTANT TB INITIATIVE 1 DECEMBER 2015 CAPETOWN, SOUTH AFRICA. 1 P a g e
FOURTH MEETING OF THE CORE GROUP OF THE GLOBAL DRUG RESISTANT TB INITIATIVE 1 DECEMBER 2015 CAPETOWN, SOUTH AFRICA 1 P a g e Contents Page 3 Background Meeting Objectives Session 1. Update from the GDI
More informationA Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data
International Journal of Electrical and Computer Engineering (IJECE) Vol. 4, No. 1, Feburary 2014, pp. 93~100 ISSN: 2088-8708 93 A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving
More informationProgramming Applications. What is Computer Programming?
Programming Applications What is Computer Programming? An algorithm is a series of steps for solving a problem A programming language is a way to express our algorithm to a computer Programming is the
More informationIVDR Breakout. Copyright 2017 BSI. All rights reserved.
IVDR Breakout 1 IVDR Classification and conformity assessment 2 Classification- IVDR 3 Classification of IVDs Re-classification of IVDs will mean 80-90 % will no longer be able to self certify conformity
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Curtin JA, Fridlyand J, Kageshita T, et al. Distinct sets of
More informationOVERVIEW OF VIETNAM S ICT SECTOR & EHEALTH IN VIETNAM. Geneve, 07/2012
OVERVIEW OF VIETNAM S ICT SECTOR & EHEALTH IN VIETNAM Geneve, 07/2012 Nội dung Contents 1. Vietnam ICT: MP and potential 2. IT Application in the Health sector & Ehealth in Vietnam 3. Recommendations,
More informationFinding Selection in All the Right Places TA Notes and Key Lab 9
Objectives: Finding Selection in All the Right Places TA Notes and Key Lab 9 1. Use published genome data to look for evidence of selection in individual genes. 2. Understand the need for DNA sequence
More informationTable S1. Phenotypic and molecular screening results based on 36 F1 generation seeds of commercial tomato hybrid varieties.
Table S1. Phenotypic and molecular screening results based on 36 F1 generation seeds of commercial tomato hybrid varieties. Serial No Variety Name Type of seed Field screening P2017.04.9 Molecular Screening
More informationBringing Connected Diagnostics to Scale
Bringing Connected Diagnostics to Scale Connected Diagnostics Opportunity Improve Linkage to Care Reduce Loss to Follow Up Improve Surveillance Reduce Transcription Errors Diagnostics Data Monitor Quality
More informationmhealth and Integreation of Promise
mhealth and Integreation of Promise Hal Wolf October 31, 2013 1 Where will Innovation land in an Evidence Based world? mhealth By Any Other Name 'When I use a word,' Humpty Dumpty said in rather a scornful
More informationGrid Computing a new tool for science
Grid Computing a new tool for science CERN, the European Organization for Nuclear Research Dr. Wolfgang von Rüden Wolfgang von Rüden, CERN, IT Department Grid Computing July 2006 CERN stands for over 50
More informationAim: To assess the effect of BioZen chip on biological activity of mobile phone radiation.
Protective effects of BioZen chip against mobile phone radiation on the model of developing quail embryo Drs Igor Yakymenko 1, Olexandr Tsybulin 2, Anatoliy Burlaka 3 1 Department of Biochemistry and Environmental
More informationde Bruijn graphs for sequencing data
de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:
More informationAutomating the Collection and Processing of Cancer Mutation Data
Automating the Collection and Processing of Cancer Mutation Data Master s Project Report Jeremy Watson Advisor: Ben Raphael 1. Introduction 1 The Raphael lab has developed multiple software packages, such
More informationEfficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside
Efficient Selection of Unique and Popular Oligos for Large EST Databases Stefano Lonardi University of California, Riverside joint work with Jie Zheng, Timothy Close, Tao Jiang University of California,
More informationIn-Memory Technology in Life Sciences
in Life Sciences Dr. Matthieu-P. Schapranow In-Memory Database Applications in Healthcare 2016 Apr Intelligent Healthcare Networks in the 21 st Century? Hospital Research Center Laboratory Researcher Clinician
More informationNetwork Based Models For Analysis of SNPs Yalta Opt
Outline Network Based Models For Analysis of Yalta Optimization Conference 2010 Network Science Zeynep Ertem*, Sergiy Butenko*, Clare Gill** *Department of Industrial and Systems Engineering, **Department
More informationGraph Algorithms in Bioinformatics
Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics
More informationGE Healthcare. Visualize Analyze. Realize. IN Cell Miner HCM Data management for high-content analysis and screening
GE Healthcare Visualize Analyze Realize IN Cell Miner HCM Data management for high-content analysis and screening Managing the data mountain High-content analysis (HCA) provides quantitative insights in
More informationOvercoming an extreme drug resistant (XDR) pathogen: Avibactam restores susceptibility to ceftazidime for Burkholderia cepacia
Overcoming an extreme drug resistant (XDR) pathogen: Avibactam restores susceptibility to ceftazidime for Burkholderia cepacia complex isolates from Cystic Fibrosis patients Krisztina M. Papp-Wallace,
More informationSequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics
Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments
More informationDr Michaela Black, Prof. Jonathan Wallace.
Dr Michaela Black, Prof. Jonathan Wallace mm.black@ulster.ac.uk jg.wallace@ulster.ac.uk http://www.midasproject.eu http://www.midasproject.eu Outline MIDAS - Strengths MIDAS - Consortium Partners MIDAS
More informationGlobal AMR Surveillance System
Global AMR Surveillance System Second OIE Global Conference on Antimicrobial Resistance and Prudent Use of Antimicrobial Agents in Animals Putting Standards into Practice Marrakesh, Morocco, 29 to 31 October
More informationThe Lilly Safety Mailing Process
The Lilly Safety Mailing Process 1 After this presentation you will be able to: Define Safety Mailings and the type of adverse events that trigger safety mailings. Define Principal Investigator (PI) and
More informationSOP for Influenza autocuration
SOP for Influenza autocuration Authors: Catherine Macken (c.macken@auckland.ac.nz), Sam Zaremba (Sam.Zaremba@ngc.com), Guangyu Sun (gsun@vecna.com), Sherry He (she@virusbrc.org), Christian Suloway (csuloway@virusbrc.org),
More informationGenome 373: Genome Assembly. Doug Fowler
Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-
More informationextended EudraVigilance Medicinal Product Dictionary (XEVMPD) e-learning
extended EudraVigilance Medicinal Product Dictionary (XEVMPD) e-learning Session 3: Database Architecture Version 5.3 An agency of the European Union Roles of the XEVMPD in the EV System (1) The roles
More informationZB MED. Libraries and the Information Infrastructure in Germany: Nutrition Environment Agriculture. Medicine Health
Libraries and the Information Infrastructure in Germany: standards and recent developments Ulrich Korwitz German National Library of Medicine ZB MED Foto Haus Bonn Medicine Health Nutrition Environment
More informationMEXICO (52) NETHERLANDS (31) SINGAPORE (65) SOUTH AFRICA (27) / 5 SPAIN (34)
WORLDCLASS GLOBAL SUPPORT AUSTRALIA (61) 2 9844 6000 GERMANY (49) 2151 333 625 MEXICO (52) 5 559 1635 SWEDEN (46) 8 564 85900 CANADA (1) 905 819 1234 HONG KONG (852) 2814 7431 NETHERLANDS (31) 2972 30630
More informationEvoluzione dei sistemi di sorveglianza europei European Centre for Disease Control
Evoluzione dei sistemi di sorveglianza europei European Centre for Disease Control Dr Denis Coulombier Head of unit for preparedness and response European Centre for Disease Prevention and Control Convegno
More informationClinical Case Poster Forum Guidelines
Clinical Case Poster Forum Guidelines Eligibility All osteopathic medical students, residents, and faculty in Arizona. General One entry per person Do not need to register for the AOMA Convention in order
More informationEpigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers
Supplementary Information for Epigenetic regulation of the nuclear-coded GCAT and SHMT2 genes confers human age-associated mitochondrial respiration defects Osamu Hashizume, Sakiko Ohnishi, Takayuki Mito,
More informationde novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January /73
1/73 de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January 2014 2/73 YOUR INSTRUCTOR IS.. - Postdoc at Penn State, USA - PhD at INRIA / ENS Cachan,
More informationShortest Path Algorithm
Shortest Path Algorithm C Works just fine on this graph. C Length of shortest path = Copyright 2005 DIMACS BioMath Connect Institute Robert Hochberg Dynamic Programming SP #1 Same Questions, Different
More informationCAP BIOINFORMATICS Su-Shing Chen CISE. 8/19/2005 Su-Shing Chen, CISE 1
CAP 5510-2 BIOINFORMATICS Su-Shing Chen CISE 8/19/2005 Su-Shing Chen, CISE 1 Building Local Genomic Databases Genomic research integrates sequence data with gene function knowledge. Gene ontology to represent
More informationComputational Methods for de novo Assembly of Next-Generation Genome Sequencing Data
1/39 Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi ENS Cachan Brittany / IRISA (Genscale team) Advisor : Dominique Lavenier 2/39 INTRODUCTION, YEAR 2000
More informationDNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization
Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just
More informationIntroduction to the Points to Consider Documents. MedDRA trademark is owned by IFPMA on behalf of ICH
Introduction to the Points to Consider Documents MedDRA trademark is owned by IFPMA on behalf of ICH MedDRA was developed under the auspices of the International Conference on Harmonisation of Technical
More informationSupplemental Information
Supplemental Information Title: Generation of clonal zebrafish line by androgenesis without egg irradiation Jilun Hou a,, Takafumi Fujimoto b, *, Taiju Saito c, Etsuro Yamaha d, Katsutoshi Arai b 1 Supplemental
More information3. Open Vector NTI 9 (note 2) from desktop. A three pane window appears.
SOP: SP043.. Recombinant Plasmid Map Design Vector NTI Materials and Reagents: 1. Dell Dimension XPS T450 Room C210 2. Vector NTI 9 application, on desktop 3. Tuberculist database open in Internet Explorer
More informationDrug Response and Genotype
: The Pharmacogenetics Knowledge Base Daniel L. Rubin, M.D., M.S. Stanford Medical Informatics Stanford University School of Medicine Drug Response and Genotype Patient responses to drugs are variable
More informationDRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure
TM DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure About DRAGEN Edico Genome s DRAGEN TM (Dynamic Read Analysis for GENomics) Bio-IT Platform provides ultra-rapid secondary analysis of
More informationEN-Projects. EN-Projects supplies medical equipment packages: a single source. through which you can design, build, equip, train and maintain any
EN-Projects TURNKEY HEALTHCARE PROJECTS EN-Projects supplies medical equipment packages: a single source through which you can design, build, equip, train and maintain any size of healthcare facility a
More informationCOLLEGE OF IMAGING ARTS AND SCIENCES. Medical Illustration
ROCHESTER INSTITUTE OF TECHNOLOGY COURSE OUTLINE FORM COLLEGE OF IMAGING ARTS AND SCIENCES Medical Illustration NEW COURSE: CIAS-ILLM-608-ScientificVisualizationX 1.0 Course Designations and Approvals
More informationGeBBA Lab Genomic and Bioinformatic Applied to Biotech
GeBBA Lab Genomic and Bioinformatic Applied to Biotech Sergio D Ascia, NSI Bologna Italy - s.dascia@nsi-mail.it Giuseppe Frangiamone, NSI Bologna Italy g.frangiamone@nsi-mail.it NSI - Nier Soluzioni Informatiche
More informationGuidance for the format and content of the final study report of non-interventional post-authorisation safety studies
23 January 2013 EMA/48663/2013 Patient Health Protection Guidance for the format and content of the final study report of non-interventional post-authorisation safety studies Introduction From 10 January
More informationTransforming Care: Leveraging Healthcare Technology To Improve Health For The Pediatric And Adolescent Population. Albert Oriol, CIO Rady Children s
Transforming Care: Leveraging Healthcare Technology To Improve Health For The Pediatric And Adolescent Population Albert Oriol, CIO Rady Children s Agenda Context: Rady Children s Hospital San Diego The
More information(DNA#): Molecular Biology Computation Language Proposal
(DNA#): Molecular Biology Computation Language Proposal Aalhad Patankar, Min Fan, Nan Yu, Oriana Fuentes, Stan Peceny {ap3536, mf3084, ny2263, oif2102, skp2140} @columbia.edu Motivation Inspired by the
More informationComputational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
More informationNEW. JOFRACAL Temperature and Pressure Calibration Software. Text output file for eg. Excel PRODUCT DESCRIPTION. Specification Sheet SS-CP-2510-US
NEW Text output file for eg. Excel Temperature and Pressure Multiple possibilities Can be used with all JOFRA temperature, pressure and signal calibrators equipped with an RS232 interface Easy to use Various
More informationStandards Development
Thailand s ehealth & Health Information Standards Development Collaborating across countries to harmonize information system standards understanding country opportunities and developing strategies to deal
More informationATHENA Manual. Table of Contents...1 Introduction...1 Example...1 Input Files...2 Algorithms...7 Sample files...8
Last Updated: 01/30/2012 ATHENA Manual Table of Contents Table of Contents...1 Introduction...1 Example...1 Input Files...2 Algorithms...7 Sample files...8 Introduction ATHENA applies grammatical evolution
More informationTutorial: How to use the Wheat TILLING database
Tutorial: How to use the Wheat TILLING database Last Updated: 9/7/16 1. Visit http://dubcovskylab.ucdavis.edu/wheat_blast to go to the BLAST page or click on the Wheat BLAST button on the homepage. 2.
More informationMultiple Sequence Alignment Gene Finding, Conserved Elements
Multiple Sequence Alignment Gene Finding, Conserved Elements Definition Given N sequences x 1, x 2,, x N : Insert gaps (-) in each sequence x i, such that All sequences have the same length L Score of
More informationCOMBAT TB. An integrated environment for Tuberculosis data analysis
COMBAT TB An integrated environment for Tuberculosis data analysis Worldwide: more than 10 million infected 1.8 million deaths in 2015 Majority of disease burden in Africa and Asia 1% of SA population
More informationde novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
More information