Supplementary Materials:

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner

Genome Reconstruction: A Puzzle with a Billion Pieces Phillip E. C. Compeau and Pavel A. Pevzner Outline I. Problem II. Two Historical Detours III.Example IV.The Mathematics of DNA Sequencing V.Complications

by the Genevestigator program (www.genevestigator.com). Darker blue color indicates higher gene expression.

Figure S1. Tissue-specific expression profile of the genes that were screened through the RHEPatmatch and root-specific microarray filters. The gene expression profile (heat map) was drawn by the Genevestigator

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

Appendix A. Example code output. Chapter 1. Chapter 3

Appendix A Example code output This is a compilation of output from selected examples. Some of these examples requires exernal input from e.g. STDIN, for such examples the interaction with the program

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds

Pyramidal and Chiral Groupings of Gold Nanocrystals Assembled Using DNA Scaffolds February 27, 2009 Alexander Mastroianni, Shelley Claridge, A. Paul Alivisatos Department of Chemistry, University of California,

6 Anhang. 6.1 Transgene Su(var)3-9-Linien. P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,III 2 5 I,II,III,IV 3

6.1 Transgene Su(var)3-9-n P{GS.ry + hs(su(var)3-9)egfp} 1 I,II,III,IV 3 2I 3 3 I,II,III 3 4 I,II,II 5 I,II,III,IV 3 6 7 I,II,II 8 I,II,II 10 I,II 3 P{GS.ry + UAS(Su(var)3-9)EGFP} A AII 3 B P{GS.ry + (10.5kbSu(var)3-9EGFP)}

TCGR: A Novel DNA/RNA Visualization Technique

TCGR: A Novel DNA/RNA Visualization Technique Donya Quick and Margaret H. Dunham Department of Computer Science and Engineering Southern Methodist University Dallas, Texas 75275 dquick@mail.smu.edu, mhd@engr.smu.edu

Genome Reconstruction: A Puzzle with a Billion Pieces. Phillip Compeau Carnegie Mellon University Computational Biology Department

http://cbd.cmu.edu Genome Reconstruction: A Puzzle with a Billion Pieces Phillip Compeau Carnegie Mellon University Computational Biology Department Eternity II: The Highest-Stakes Puzzle in History Courtesy:

SUPPLEMENTARY INFORMATION. Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells

SUPPLEMENTARY INFORMATION Systematic evaluation of CRISPR-Cas systems reveals design principles for genome editing in human cells Yuanming Wang 1,2,7, Kaiwen Ivy Liu 2,7, Norfala-Aliah Binte Sutrisnoh

Supplementary Table 1. Data collection and refinement statistics

Supplementary Table 1. Data collection and refinement statistics APY-EphA4 APY-βAla8.am-EphA4 Crystal Space group P2 1 P2 1 Cell dimensions a, b, c (Å) 36.27, 127.7, 84.57 37.22, 127.2, 84.6 α, β, γ (

warm-up exercise Representing Data Digitally goals for today proteins example from nature

Representing Data Digitally Anne Condon September 6, 007 warm-up exercise pick two examples of in your everyday life* in what media are the is represented? is the converted from one representation to another,

./pharo Pharo.image eval 3 + 4 ./pharo Pharo.image my_script.st BioSequence newdna: atcggtcggctta. BioSequence newambiguousdna: AAGTCAGTGTACTATTAGCATGCATGTGCAACACATTAGCTG. BioSequence newunambiguousdna:

Machine Learning Classifiers

Machine Learning Classifiers Outline Different types of learning problems Different types of learning algorithms Supervised learning Decision trees Naïve Bayes Perceptrons, Multi-layer Neural Networks

In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition

In Silico Modelling and Analysis of Ribosome Kinetics and aa-trna Competition D. Bošnački 1, T.E. Pronk 2, and E.P. de Vink 3, 1 Dept. of Biomedical Engineering, Eindhoven University of Technology 2 Swammerdam

Digging into acceptor splice site prediction: an iterative feature selection approach

Digging into acceptor splice site prediction: an iterative feature selection approach Yvan Saeys, Sven Degroeve, and Yves Van de Peer Department of Plant Systems Biology, Ghent University, Flanders Interuniversity

Supplementary Data. Image Processing Workflow Diagram A - Preprocessing. B - Hough Transform. C - Angle Histogram (Rose Plot)

Supplementary Data Image Processing Workflow Diagram A - Preprocessing B - Hough Transform C - Angle Histogram (Rose Plot) D - Determination of holes Description of Image Processing Workflow The key steps

2 41L Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR C K65 Tag- A AAT CCA TAC AAT ACT CCA GTA TTT GCY ATA AAG AA

176 SUPPLEMENTAL TABLES 177 Table S1. ASPE Primers for HIV-1 group M subtype B Primer no Type a Sequence (5'-3') Tag ID b Position c 1 M41 Tag- AA GAA AAA ATA AAA GCA TTA RYA GAA ATT TGT RMW GAR A d 45

A relation between trinucleotide comma-free codes and trinucleotide circular codes

Theoretical Computer Science 401 (2008) 17 26 www.elsevier.com/locate/tcs A relation between trinucleotide comma-free codes and trinucleotide circular codes Christian J. Michel a,, Giuseppe Pirillo b,c,

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame

Crick s Hypothesis Revisited: The Existence of a Universal Coding Frame Jean-Louis Lassez*, Ryan A. Rossi Computer Science Department, Coastal Carolina University jlassez@coastal.edu, raross@coastal.edu

SAY IT WITH DNA: Making New Messages

Y WH : Making New Messages ince you will be expected to decipher a message in the unit exam, it would be wise to get as much practice as possible. f you can have fun in the process, so much the better!

Degenerate Coding and Sequence Compacting

ESI The Erwin Schrödinger International Boltzmanngasse 9 Institute for Mathematical Physics A-1090 Wien, Austria Degenerate Coding and Sequence Compacting Maya Gorel Kirzhner V.M. Vienna, Preprint ESI

LABORATORY STANDARD OPERATING PROCEDURE FOR PULSENET CODE: PNL28 MLVA OF SHIGA TOXIN-PRODUCING ESCHERICHIA COLI

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Shiga toxin-producing Escherichia coli O157 (STEC O157) and Salmonella enterica serotypes Typhimurium and Enteritidis.

MLiB - Mandatory Project 2. Gene finding using HMMs

MLiB - Mandatory Project 2 Gene finding using HMMs Viterbi decoding >NC_002737.1 Streptococcus pyogenes M1 GAS TTGTTGATATTCTGTTTTTTCTTTTTTAGTTTTCCACATGAAAAATAGTTGAAAACAATA GCGGTGTCCCCTTAAAATGGCTTTTCCACAGGTTGTGGAGAACCCAAATTAACAGTGTTA

Efficient Selection of Unique and Popular Oligos for Large EST Databases. Stefano Lonardi. University of California, Riverside

Efficient Selection of Unique and Popular Oligos for Large EST Databases Stefano Lonardi University of California, Riverside joint work with Jie Zheng, Timothy Close, Tao Jiang University of California,

Giri Narasimhan & Kip Irvine

COP 4516: Competitive Programming and Problem Solving! Giri Narasimhan & Kip Irvine Phone: x3748 & x1528 {giri,irvinek}@cs.fiu.edu Problems to think about!! What is the least number of comparisons you

Supporting Information

Copyright WILEY VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 2015. Supporting Information for Small, DOI: 10.1002/smll.201501370 A Compact DNA Cube with Side Length 10 nm Max B. Scheible, Luvena

Sequence Assembly. BMI/CS 576 Mark Craven Some sequencing successes

Sequence Assembly BMI/CS 576 www.biostat.wisc.edu/bmi576/ Mark Craven craven@biostat.wisc.edu Some sequencing successes Yersinia pestis Cannabis sativa The sequencing problem We want to determine the identity

RB-Tree Augmentation. OS-Rank. OS-Select. Augment x with Size(x), where. Size(x) = size of subtree rooted at x Size(NIL) = 0

RB-Tree Augmentation Augment x with Size(x), where Size(x) = size of subtree rooted at x Size(NIL) = 0 COT 5407 10/6/05 1 OS-Rank OS-RANK(x,y) // Different from text (recursive version) // Find the rank

Structural analysis and haplotype diversity in swine LEP and MC4R genes

J. Anim. Breed. Genet. ISSN - OIGINAL ATICLE Structural analysis and haplotype diversity in swine LEP and MC genes M. D Andrea, F. Pilla, E. Giuffra, D. Waddington & A.L. Archibald University of Molise,

Assignment 4. the three-dimensional positions of every single atom in the le,

Assignment 4 1 Overview and Background Many of the assignments in this course will introduce you to topics in computational biology. You do not need to know anything about biology to do these assignments

Scalable Solutions for DNA Sequence Analysis

Scalable Solutions for DNA Sequence Analysis Michael Schatz Dec 4, 2009 JHU/UMD Joint Sequencing Meeting The Evolution of DNA Sequencing Year Genome Technology Cost 2001 Venter et al. Sanger (ABI) $300,000,000

Supporting information

Supporting information 1S. DECOMP output for the peptide amino-acid decomposition test with monoisotopic mass = 1000 +/- 0.2 # imsdecomp 1.3 # Copyright 2007,2008 Informatics for Mass Spectrometry group

Figure 2.1: Simple model of a communication system

Chapter 2 Codes In the previous chapter we examined the fundamental unit of information, the bit, and its various abstract representations: the mathematical bit, the control bit, the classical bit, and

Channel. Figure 2.1: Simple model of a communication system

Chapter 2 Codes In the previous chapter we examined the fundamental unit of information, the bit, and its various abstract representations: the Boolean bit (with its associated Boolean algebra and realization

Genomic Perl. From Bioinformatics Basics to Working Code REX A. DWYER. Genomic Perl Consultancy, Inc.

Genomic Perl From Bioinformatics Basics to Working Code REX A. DWYER Genomic Perl Consultancy, Inc. published by the press syndicate of the university of cambridge The Pitt Building, Trumpington Street,

Greedy Algorithms Huffman Coding

Greedy Algorithms Huffman Coding Huffman Coding Problem Example: Release 29.1 of 15-Feb-2005 of TrEMBL Protein Database contains 1,614,107 sequence entries, comprising 505,947,503 amino acids. There are

Homework Python-1. Sup Biotech 3 Python. Pierre Parutto

Homework Python-1 Sup Biotech 3 Python Pierre Parutto October 9, 2016 Preamble Document Property Authors Pierre Parutto Version 1.0 Number of pages 9 Contact Contact the assistant team at: supbiotech-bioinfo-bt3@googlegroups.com

Homework Python-1. Sup Biotech 3 Python. Pierre Parutto

Homework Python-1 Sup Biotech 3 Python Pierre Parutto November 7, 2016 Preamble Document Property Authors Pierre Parutto Version 1.0 Number of pages 14 Contact Contact the assistant team at: supbiotech-bioinfo-bt3@googlegroups.com

CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly

CSCI2950-C Lecture 4 DNA Sequencing and Fragment Assembly Ben Raphael Sept. 22, 2009 http://cs.brown.edu/courses/csci2950-c/ l-mer composition Def: Given string s, the Spectrum ( s, l ) is unordered multiset

A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving on DNA-encoded Data

International Journal of Electrical and Computer Engineering (IJECE) Vol. 4, No. 1, Feburary 2014, pp. 93~100 ISSN: 2088-8708 93 A Novel Implementation of an Extended 8x8 Playfair Cipher Using Interweaving

DNA Sequencing. Overview

BINF 3350, Genomics and Bioinformatics DNA Sequencing Young-Rae Cho Associate Professor Department of Computer Science Baylor University Overview Backgrounds Eulerian Cycles Problem Hamiltonian Cycles

Assembly in the Clouds

Assembly in the Clouds Michael Schatz October 13, 2010 Beyond the Genome Shredded Book Reconstruction Dickens accidentally shreds the first printing of A Tale of Two Cities Text printed on 5 long spools

Figure 2.1: Simple model of a communication system

Chapter 2 Codes In the previous chapter we examined the fundamental unit of information, the bit, and its physical forms (the quantum bit and the classical bit), its classical mathematical model (the Boolean

OFFICE OF RESEARCH AND SPONSORED PROGRAMS

OFFICE OF RESEARCH AND SPONSORED PROGRAMS June 9, 2016 Mr. Satoshi Harada Department of Innovation Research Japan Science and Technology Agency (JST) K s Gobancho, 7, Gobancho, Chiyoda-ku, Tokyo, 102-0076

de Bruijn graphs for sequencing data

de Bruijn graphs for sequencing data Rayan Chikhi CNRS Bonsai team, CRIStAL/INRIA, Univ. Lille 1 SMPGD 2016 1 MOTIVATION - de Bruijn graphs are instrumental for reference-free sequencing data analysis:

DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM

DELAMANID SUSCEPTIBILITY TESTING IN AN AUTOMATED LIQUID CULTURE SYSTEM Daniela Maria Cirillo San Raffaele Scientific Institute, Milan COI/CA OSR as signed MTA with Janssen and Otzuka as SRL and is involved

(DNA#): Molecular Biology Computation Language Proposal

(DNA#): Molecular Biology Computation Language Proposal Aalhad Patankar, Min Fan, Nan Yu, Oriana Fuentes, Stan Peceny {ap3536, mf3084, ny2263, oif2102, skp2140} @columbia.edu Motivation Inspired by the

DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization

Eulerian & Hamiltonian Cycle Problems DNA Sequencing The Shortest Superstring & Traveling Salesman Problems Sequencing by Hybridization The Bridge Obsession Problem Find a tour crossing every bridge just

10/15/2009 Comp 590/Comp Fall

Lecture 13: Graph Algorithms Study Chapter 8.1 8.8 10/15/2009 Comp 590/Comp 790-90 Fall 2009 1 The Bridge Obsession Problem Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg

Lecture 5: Markov models

Master s course Bioinformatics Data Analysis and Tools Lecture 5: Markov models Centre for Integrative Bioinformatics Problem in biology Data and patterns are often not clear cut When we want to make a

Purpose of sequence assembly

Sequence Assembly Purpose of sequence assembly Reconstruct long DNA/RNA sequences from short sequence reads Genome sequencing RNA sequencing for gene discovery Amplicon sequencing But not for transcript

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Computational Biology IST Ana Teresa Freitas 2015/2016 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics

Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data

1/39 Computational Methods for de novo Assembly of Next-Generation Genome Sequencing Data Rayan Chikhi ENS Cachan Brittany / IRISA (Genscale team) Advisor : Dominique Lavenier 2/39 INTRODUCTION, YEAR 2000

Sequencing. Computational Biology IST Ana Teresa Freitas 2011/2012. (BACs) Whole-genome shotgun sequencing Celera Genomics

Computational Biology IST Ana Teresa Freitas 2011/2012 Sequencing Clone-by-clone shotgun sequencing Human Genome Project Whole-genome shotgun sequencing Celera Genomics (BACs) 1 Must take the fragments

Python for Bioinformatics

Python for Bioinformatics A look into the BioPython world... Christian Skjødt csh@cbs.dtu.dk Today s program 09-10: 10-12: 12-13: 13-13.30: 13.30-16: 16:00-17: Lecture: Introduction to BioPython Exercise:

Global Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties

Global Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties From LCS to Alignment: Change the Scoring The Longest Common Subsequence (LCS) problem the simplest form of sequence

3. The object system(s)

3. The object system(s) Thomas Lumley Ken Rice Universities of Washington and Auckland Seattle, June 2011 Generics and methods Many functions in R are generic. This means that the function itself (eg plot,

PERFORMANCE ANALYSIS OF DATAMINIG TECHNIQUE IN RBC, WBC and PLATELET CANCER DATASETS

PERFORMANCE ANALYSIS OF DATAMINIG TECHNIQUE IN RBC, WBC and PLATELET CANCER DATASETS Mayilvaganan M 1 and Hemalatha 2 1 Associate Professor, Department of Computer Science, PSG College of arts and science,

Supplementary Information

Supplementary Information Supplementary Figure S1 The scheme of MtbHadAB/MtbHadBC dehydration reaction. The reaction is reversible. However, in the context of FAS-II elongation cycle, this reaction tends

Biopython. Karin Lagesen.

Biopython Karin Lagesen karin.lagesen@bio.uio.no Object oriented programming Biopython is object-oriented Some knowledge helps understand how biopython works OOP is a way of organizing data and methods

Ramachandran Plot. 4ytn. PRO 51 (D) ~l. l TRP 539 (E) Phi (degrees) Plot statistics

B Ramachandran Plot ~b b 135 b ~b PRO 51 (D) ~l l TRP 539 (E) Psi (degrees) 5-5 a SER (B) A ~a L LYS (F) ALA 35 (E) - -135 ~b b HIS 59 (G) ALA 173 (E) ASP ALA 13173 (F)(A) ASP LYS 13315 LYS (B)(E) 315

QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation

QuasiAlign: Position Sensitive P-Mer Frequency Clustering with Applications to Genomic Classification and Differentiation Anurag Nagar Southern Methodist University Michael Hahsler Southern Methodist University

Machine Learning Methods. Majid Masso, PhD Bioinformatics and Computational Biology George Mason University

Machine Learning Methods Majid Masso, PhD Bioinformatics and Computational Biology George Mason University Introductory Example Attributes X and Y measured for each person (example or instance) in a training

DNA Fragment Assembly

Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly Overlap

Due Thursday, July 18 at 11:00AM

CS106B Summer 2013 Handout #10 July 10, 2013 Assignment 3: Recursion! Parts of this handout were written by Julie Zelenski, Jerry Cain, and Eric Roberts. This assignment consists of four recursive functions

10/8/13 Comp 555 Fall

10/8/13 Comp 555 Fall 2013 1 Find a tour crossing every bridge just once Leonhard Euler, 1735 Bridges of Königsberg 10/8/13 Comp 555 Fall 2013 2 Find a cycle that visits every edge exactly once Linear

de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January /73

1/73 de novo assembly Rayan Chikhi Pennsylvania State University Workshop On Genomics - Cesky Krumlov - January 2014 2/73 YOUR INSTRUCTOR IS.. - Postdoc at Penn State, USA - PhD at INRIA / ENS Cachan,

How to Run NCBI BLAST on zcluster at GACRC

How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?

Sequence Assembly Required!

Sequence Assembly Required! 1 October 3, ISMB 20172007 1 Sequence Assembly Genome Sequenced Fragments (reads) Assembled Contigs Finished Genome 2 Greedy solution is bounded 3 Typical assembly strategy

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare

Detecting Superbubbles in Assembly Graphs. Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)!

Detecting Superbubbles in Assembly Graphs Taku Onodera (U. Tokyo)! Kunihiko Sadakane (NII)! Tetsuo Shibuya (U. Tokyo)! de Bruijn Graph-based Assembly Reads (substrings of original DNA sequence) de Bruijn

Building and Animating Amino Acids and DNA Nucleotides in ShockWave Using 3ds max

1 Building and Animating Amino Acids and DNA Nucleotides in ShockWave Using 3ds max MIT Center for Educational Computing Initiatives THIS PDF DOCUMENT HAS BOOKMARKS FOR NAVIGATION CLICK ON THE TAB TO THE

Programming Applications. What is Computer Programming?

Programming Applications What is Computer Programming? An algorithm is a series of steps for solving a problem A programming language is a way to express our algorithm to a computer Programming is the

Phylogenetics on CUDA (Parallel) Architectures Bradly Alicea

Descent w/modification Descent w/modification Descent w/modification Descent w/modification CPU Descent w/modification Descent w/modification Phylogenetics on CUDA (Parallel) Architectures Bradly Alicea

Please cite the following papers if you perform simulations with PACE:

Citation: Please cite the following papers if you perform simulations with PACE: 1) Han, W.; Schulten, K. J. Chem. Theory Comput. 2012, 8, 4413. 2) Han, W.; Wan, C.-K.; Jiang, F.; Wu, Y.-D. J. Chem. Theory

Algorithms and Data Structures

Algorithms and Data Structures Sorting beyond Value Comparisons Marius Kloft Content of this Lecture Radix Exchange Sort Sorting bitstrings in linear time (almost) Bucket Sort Marius Kloft: Alg&DS, Summer

Tutorial: chloroplast genomes

Tutorial: chloroplast genomes Stacia Wyman Department of Computer Sciences Williams College Williamstown, MA 01267 March 10, 2005 ASSUMPTIONS: You are using Internet Explorer under OS X on the Mac. You

CSE : Computational Issues in Molecular Biology. Lecture 7. Spring 2004

CSE 397-497: Computational Issues in Molecular Biology Lecture 7 Spring 2004-1 - CSE seminar on Monday Title: Redundancy Elimination Within Large Collections of Files Speaker: Dr. Fred Douglis (IBM T.J.

Multiple Sequence Alignment Gene Finding, Conserved Elements

Multiple Sequence Alignment Gene Finding, Conserved Elements Definition Given N sequences x 1, x 2,, x N : Insert gaps (-) in each sequence x i, such that All sequences have the same length L Score of

SEQUENCE MATCHING IN HOLOGRAPHICALLY STORED GENETIC STRINGS JOSEPH LEGARDE MERKLING, B.S., B.S. A THESIS ELECTRICAL ENGINEERING

SEQUENCE MATCHING IN HOLOGRAPHICALLY STORED GENETIC STRINGS by JOSEPH LEGARDE MERKLING, B.S., B.S. A THESIS IN ELECTRICAL ENGINEERING Submitted to the Graduate Faculty of Texas Tech University in Partial

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis.

1. PURPOSE: to describe the standardized laboratory protocol for molecular subtyping of Salmonella enterica serotype Enteritidis. 2. SCOPE: to provide the PulseNet participants with a single protocol for

Genome 373: Genome Assembly. Doug Fowler

Genome 373: Genome Assembly Doug Fowler What are some of the things we ve seen we can do with HTS data? We ve seen that HTS can enable a wide variety of analyses ranging from ID ing variants to genome-

Computational Theory MAT542 (Computational Methods in Genomics) - Part 2 & 3 -

Computational Theory MAT542 (Computational Methods in Genomics) - Part 2 & 3 - Benjamin King Mount Desert Island Biological Laboratory bking@mdibl.org Overview of 4 Lectures Introduction to Computation

Automated Alignment of RNA Sequences to Pseudoknotted Structures

From: ISMB-97 Proceedings. Copyright 1997, AAAI (www.aaai.org). All rights reserved. Automated Alignment of RNA Sequences to Pseudoknotted Structures Jack E. Tabaska and Gary D. Stormo Dept. of Molecular,

PLAYING WITH PYTHON: DE-CODING DNA

PLAYING WITH PYTHON: DE-CODING DNA A quick recap of the range function. The range you know: range with start/stop Range with variable steps print range(5) [0, 1, 2, 3, 4] print range(1,5) [1, 2, 3, 4]

1. Open the SPDBV_4.04_OSX folder on the desktop and double click DeepView to open.

Molecular of inhibitor-bound Lysozyme This lab will not require a lab report. Rather each student will follow this tutorial, answer the italicized questions (worth 2 points each) directly on this protocol/worksheet,

Algorithms for Bioinformatics

Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 58670 Algorithms for Bioinformatics Lecture 5: Graph Algorithms

DNA Fragment Assembly

SIGCSE 009 Algorithms in Bioinformatics Sami Khuri Department of Computer Science San José State University San José, California, USA khuri@cs.sjsu.edu www.cs.sjsu.edu/faculty/khuri DNA Fragment Assembly

Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.

Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD

Previous Year. Examination. (Original Question Paper with Answer Key) JOINT ADMISSION TEST FOR M.Sc IN IITs AND IISc

Prevus Year of Examinatn (Origina Questn Paper ith Anser Key) JOINT ADMISSION TEST FOR M.Sc IN IITs AND IISc For more questn papers, pee visit: a a INDIAN INSTITUTE OF SCIENCE BANGALORE - 560012 Prram

WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches

WSSP-10 Chapter 7 BLASTN: DNA vs DNA searches 4-3 DSAP: BLASTn Page p. 7-1 NCBI BLAST Home Page p. 7-1 NCBI BLASTN search page p. 7-2 Copy sequence from DSAP or wave form program p. 7-2 Choose a database

Data Mining for Bioinformatics

Data Mining for Bioinformatics Sumeet Dua Pradeep Chowriappa Data Mining for Bioinformatics Data Mining for Bioinformatics Sumeet Dua Pradeep Chowriappa CRC Press Taylor & Francis Group 6000 Broken Sound

Sequence data handling by computer. R.Staden. MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK. Received 10 October 1977

Volume Number 11 November 1877 NucleJC Acids Research Sequence data handling by computer R.Staden MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK Received 10 October 1977 ABSTRACT

NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints

1 NOSEP: Non-Overlapping Sequence Pattern Mining with Gap Constraints Youxi Wu, Yao Tong, Xingquan Zhu, Senior, IEEE, and Xindong Wu, Fellow, IEEE Abstract Sequence pattern mining aims to discover frequent

VESPA Manual Version 1.0β Andrew E. Webb, Thomas A. Walsh and Mary J. O Connell September,

VESPA Manual Version 1.0β Andrew E. Webb, Thomas A. Walsh and Mary J. O Connell September, 2015 www.mol-evol.org/vespa Table of Contents Table of Figures... 3 1.1: Introduction... 4 1.2: Phase and Pipeline

Amino Acid Graph Representation for Efficient Safe Transfer of Multiple DNA Sequence as Pre Order Trees

International Journal of Bioinformatics and Biomedical Engineering Vol. 1, No. 3, 2015, pp. 292-299 http://www.aiscience.org/journal/ijbbe Amino Acid Graph Representation for Efficient Safe Transfer of

Graph Algorithms in Bioinformatics

Graph Algorithms in Bioinformatics Bioinformatics: Issues and Algorithms CSE 308-408 Fall 2007 Lecture 13 Lopresti Fall 2007 Lecture 13-1 - Outline Introduction to graph theory Eulerian & Hamiltonian Cycle

Strings. Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas

Strings Genome 559: Introduction to Statistical and Computational Genomics Prof. James H. Thomas Run a program by typing at a terminal prompt (which may be > or $ or something else depending on your computer;

Canine Coronavirus Detection in Feces from Diarrhea and Healthy. Dogs by Nested2PCR

PCR 3 1, 133, 1,2 (1.,210095 ;2.,210012) Canine Coronavirus Detection in Feces from Diarrhea and Healthy Dogs by Nested2PCR WAN G Yu2yan 1, LU Cheng2ping 133, WEN Hai 1,2 (1. Key L ab of A nimal disease

Algorithms for Bioinformatics

Adapted from slides by Alexandru Tomescu, Leena Salmela and Veli Mäkinen, which are partly from http://bix.ucsd.edu/bioalgorithms/slides.php 582670 Algorithms for Bioinformatics Lecture 3: Graph Algorithms