TP RNA-seq : Differential expression analysis

Size: px
Start display at page:

Download "TP RNA-seq : Differential expression analysis"

Transcription

1 TP RNA-seq : Differential expression analysis

2 Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

3 Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 3

4 Input data 8 fastq files : RNA-seq paired-end Illumina 2 x 75 pb Ex : Hct116_rep1_R1.fastq cell line replicate pair 1 fasta file : reference genome sequence chr22.fasta 1 gtf file : reference genome annotation chr22.gtf 4

5 Data import Go to the web page : Go to «Shared Data» and click on «Data Librairies» Then click on «[FORMATION] Input Data» and select the folder «Roscoff», then validate by clicking on «GO», at the bottom of the page 5

6 Data import Return at the home page by clicking on «Analyze data» Rename the history, click on «Unnamed history» then type a new name and press enter 6

7 Steps of analysis Quality control Mapping Quantification Differential analysis Formation NGS & Cancer - Analyses RNA-Seq novembre 2014

8 Steps of analysis Quality control Mapping Quantification Differential analysis Formation NGS & Cancer - Analyses RNA-Seq novembre 2014

9 Steps of analysis Quality control FastQC FASTQ Trimmer Mapping Quantification Differential analysis Formation NGS & Cancer - Analyses RNA-Seq novembre 2014

10 Quality control In the left panel, type «fastqc» in the search tool, then click on «FastQC:Read QC» Select «Gm12878_rep1_R1.fastq» sample and click on «Execute» 10

11 Quality control Run the tool again by clicking on the rerun icon, and select «Gm12878_rep1_R2.fastq» sample To view the results, click on the eye on the dataset 11

12 Quality control Encoding quality 12

13 Quality control The end of the sequence is generally of poor quality Trimming 13

14 Fastq trimming Type «fastq trim» on the search tool, then select the «FASTQ Quality Trimmer» tool. Galaxy is don't aware of the quality of the fastq The datatype of the fastq need to be changed manually 14

15 Change datatype To change the dataype, click on the pencil icon on the dataset Then click on «Dataype», search the fastqsanger format and validate by clicking on «Save» Repeat this operation for all the fastq 15

16 Fastq trimming Use the «FASTQ Quality Trimmer» tool on Gm12878_rep1_R1.fastq 16

17 Fastq trimming Repeat this operation for Gm12878_rep1_R2.fastq 17

18 Fastq trimming Rename the outputs of fastq trimming, click on the pencil icon, type a new name and don't forget to save. 18

19 Quality control You can check the result of trimming by running «FastQC:Read QC» on the trimmed fastq. 19

20 Quality control Before trimming After trimming 20

21 Steps of analysis Quality control Mapping Tophat2 Quantification Differential analysis Formation NGS & Cancer - Analyses RNA-Seq novembre 2014

22 Mapping Which mapper? (Fonseca N A et al. Bioinformatics 2012;28: ) 22

23 Mapping Tophat2 : - Use Bowtie2 - splice aware - optimised for 75 pb reads or longer - several options : not all include in galaxy - different mode (ex : tophat-fusion) - tophat+tophat citations - alternatives : STAR, RUM, Mapsplice (Trapnell C et al. Bioinformatics 2009 ;25: ) 23

24 Mapping In the left panel in the section «NGS : RNA-seq Fusion», click on «Tophat2» 24

25 Mapping You can run an other job on the dataset even if is not terminated We use the tool «flagstat» to have statistics on the mapping 25

26 Mapping Tophat outputs : - bed files : coordinates of splice junctions, insertions or deletions - bam file : accepted_hits mapped reads BAM = binary alignment format Bam-to-Sam SAM = sequence alignment format 26

27 Mapping Header SAM file ID:TopHat SO:coordinate LN: VN: CL:/bioinfo/local/build/tophat /tophat -p 4 -r 200 [ ] Read 616L7AAXX_HWUSI:2:41:19518: chr M = GTGCCTGGCTGACTTATTGGCATTTCTAACAGAGAAGAAGAGAAAGTAAGCAACTTGGAAAACATTTTTGAGGAT GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBGGGGEGGGGFGGGFGGGGFFGFGGGEFDGGGGGGGGFAGEGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YT:Z:UU XP:Z:chr M 213 Mandatory fields 616L7AAXX_HWUSI:2:41:19518: Read sequence AGAACTCCCGTGAGACTGAAGGTAGGCAGTGAAGCAAATGTTTGCATTCTTGTGTGGCTCTGATTAGCATCAGGA Read quality DFFDF=FEFFGGGGGGFGGGGGGGGEGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG Optionnal fields chr AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 50 YT:Z:UU 75M = XP:Z:chr M NH:i:1 NH:i:1 27

28 Mapping SAM file : Read 616L7AAXX_HWUSI:2:41:19518: chr M = GTGCCTGGCTGACTTATTGGCATTTCTAACAGAGAAGAAGAGAAAGTAAGCAACTTGGAAAACATTTTTGAGGAT GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBGGGGEGGGGFGGGFGGGGFFGFGGGEFDGGGGGGGGFAGEGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YT:Z:UU XP:Z:chr M L7AAXX_HWUSI:2:41:19518: chr M = AGAACTCCCGTGAGACTGAAGGTAGGCAGTGAAGCAAATGTTTGCATTCTTGTGTGGCTCTGATTAGCATCAGGA DFFDF=FEFFGGGGGGFGGGGGGGGEGGGFGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:75 YT:Z:UU XP:Z:chr M -213 NH:i:1 NH:i:1 Flags Explain SAM flags : 28

29 Mapping Flagstat output : Rename the «accepted_hits» dataset 29

30 Mapping Visualization with IGV - download the bam file : click on the disk icon - download the bam_index : click on the arrow then select «Download bam_index» 30

31 Mapping - Open IGV and click on «File», then «Load from file», select the bam file, click on open 31

32 Mapping - To view alignment, you can specify a gene of your choice, here we use LGALS1 as example 32

33 Steps of analysis Quality control Mapping Quantification HTSeq-count Differential analysis 33

34 Quantification Search the tool «htseq-count», change the stranded option to «No» and click on «Execute» 34

35 Quantification HTSeq-count : Counting reads in features - input : BAM file GTF file reference annotation - feature type and ID Attribute : chr20 protein_coding gene_name "ZNF366"; chr20 protein_coding gene_name "ZNF366"; chr20 protein_coding gene_name "ZNF366"; chr20 protein_coding gene_name "ZNF366"; chr20 protein_coding gene_name "ZNF366"; exon gene_id "ENSBTAG "; transcript_id "ENSBTAT "; CDS gene_id "ENSBTAG "; transcript_id "ENSBTAT "; exon gene_id "ENSBTAG "; transcript_id "ENSBTAT "; CDS gene_id "ENSBTAG "; transcript_id "ENSBTAT "; exon gene_id "ENSBTAG "; transcript_id "ENSBTAT "; - counting mode : union 35

36 Quantification 36

37 Steps of analysis Quality control Mapping Workflow Quantification Differential analysis 37

38 Workflow Rename the htseq-count output Click on the wheel of History panel, then click on «Extract Workflow» 38

39 Workflow Uncheck the unusued datasets, then click on «Create Workflow» 39

40 Workflow Click on «Workflow» on the top menu Click on the Workflow that have been created, and select «Edit» 40

41 Workflow You can view the schema of the Workflow, move the datasets to organize the workflow like you want 41

42 Workflow Change the name of the output files 42

43 Workflow Click on the wheel of the Workflow panel and select «Save» then «Run» Now, we can run the workflow on the 3 others samples : Gm12878_rep2, Hct116_rep1 and Hct116_rep2 43

44 Workflow Click on the pages to enable list Select the R1 of sample Select the R2 of sample 44

45 Steps of analysis Quality control Mapping Quantification Differential analysis DESeq 45

46 Differential analysis Search and select the «DESeq» tool 46

47 Differential analysis 47

48 Differential analysis DESeq : differential expression analysis for sequence count data - at gene level transcripts, exons levels : DEXSeq - comparison of 2 conditions complex designs (ex : Time-series) : DESeq2 - alernatives : edger, limma DESeq manual : /DESeq/inst/doc/DESeq.pdf 48

49 Differential analysis Steps of analysis with DESeq : - Normalization of expression : comparable expression - Variance estimation : by the negative binomial distribution - Inference : calling of differential expression Choice of parameters : - mode : explication of dispersion - method : impact of design - type : fonction to estimate dispersion 49

50 Differential analysis Outputs of deseq : - html file : figures to understand and verify the experiment - 2 tabular files : results for significantly over-expressed genes and sub-expressed genes. id = gene identification basemean = normalized mean counts foldchange = mean ratios pval = p value padj = adjusted p value 50

51 Differential analysis 51

52 Differential analysis 52

53 Differential analysis Differentially expressed genes Low counts Not differentially expressed genes (Ex : on the entire genome) 53

54 Differential analysis 54

55 Differential analysis 55

56 Differential analysis - Red line : estimated dispersion - Black dots : observed dispersion 56

57 Differential analysis Overexpression cond1 MA-plot : Mean Average Plot Overexpression Cond2 Significant genes Not significant genes FoldChange = 1 Genes expression 57

58 Differential analysis Volcano Plot -/+ Inf : not expressed genes in one condition Significance Significant genes Not significant genes Overexpression cond2 Overexpression cond1 58

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

RNA-Seq Analysis With the Tuxedo Suite

RNA-Seq Analysis With the Tuxedo Suite June 2016 RNA-Seq Analysis With the Tuxedo Suite Dena Leshkowitz Introduction In this exercise we will learn how to analyse RNA-Seq data using the Tuxedo Suite tools: Tophat, Cuffmerge, Cufflinks and Cuffdiff.

More information

de.nbi and its Galaxy interface for RNA-Seq

de.nbi and its Galaxy interface for RNA-Seq de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

NGS FASTQ file format

NGS FASTQ file format NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see

More information

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.

Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly

Goal: Learn how to use various tool to extract information from RNAseq reads. 4.1 Mapping RNAseq Reads to a Genome Assembly ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

INF-BIO5121/ Oct 7, Analyzing mirna data using Lifeportal PRACTICALS

INF-BIO5121/ Oct 7, Analyzing mirna data using Lifeportal PRACTICALS INF-BIO5121/9121 - Oct 7, 2014 Analyzing mirna data using Lifeportal PRACTICALS In this experiment we have mirna data from the livers of baboons (Papio Hamadryas) before and after they are given a high

More information

NGS : reads quality control

NGS : reads quality control NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq

More information

Goal: Learn how to use various tool to extract information from RNAseq reads.

Goal: Learn how to use various tool to extract information from RNAseq reads. ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta

More information

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv

Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Mapping and Viewing Deep Sequencing Data bowtie2, samtools, igv Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology tan@ciwemb.edu 27 August 2013

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017

Tutorial. RNA-Seq Analysis of Breast Cancer Data. Sample to Insight. November 21, 2017 RNA-Seq Analysis of Breast Cancer Data November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

The QoRTs Analysis Pipeline Example Walkthrough

The QoRTs Analysis Pipeline Example Walkthrough The QoRTs Analysis Pipeline Example Walkthrough Stephen Hartley National Human Genome Research Institute National Institutes of Health October 31, 2017 QoRTs v1.0.1 JunctionSeq v1.9.0 Contents 1 Overview

More information

NGS Analyses with Galaxy

NGS Analyses with Galaxy 1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation

mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Gene expression estimation mrna-seq Basic processing Read mapping (shown here, but optional. May due if time allows) Tophat Gene expression estimation cufflinks Confidence intervals Gene expression changes (separate use case) Sample

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

JunctionSeq Package User Manual

JunctionSeq Package User Manual JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health March 30, 2017 JunctionSeq v1.5.4 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Using Galaxy for NGS Analyses Luce Skrabanek

Using Galaxy for NGS Analyses Luce Skrabanek Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User

More information

Differential Expression

Differential Expression Differential Expression Data In this practical, as before, we will work with RNA-Seq data from Arabidopsis seeds that matured at standard temperature (ST, 22 C day/18 C night) or at high temperature (HT,

More information

!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,

!#$%&$'()#$*)+,-./).010#,23+3,3034566,&((46,7$+-./&((468, !"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.

More information

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads

Exercise 1 Review. --outfiltermismatchnmax : max number of mismatch (Default 10) --outreadsunmapped fastx: output unmapped reads Exercise 1 Review Setting parameters STAR --quantmode GeneCounts --genomedir genomedb -- runthreadn 2 --outfiltermismatchnmax 2 --readfilesin WTa.fastq.gz --readfilescommand zcat --outfilenameprefix WTa

More information

Reference guided RNA-seq data analysis using BioHPC Lab computers

Reference guided RNA-seq data analysis using BioHPC Lab computers Reference guided RNA-seq data analysis using BioHPC Lab computers This document assumes that you already know some basics of how to use a Linux computer. Some of the command lines in this document are

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary

version /1/2011 Source code Linux x86_64 binary Mac OS X x86_64 binary Cufflinks RNA-Seq analysis tools - Getting Started 1 of 6 14.07.2011 09:42 Cufflinks Transcript assembly, differential expression, and differential regulation for RNA-Seq Site Map Home Getting started

More information

Differential gene expression analysis using RNA-seq

Differential gene expression analysis using RNA-seq https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, September/October 2018 Friederike Dündar with Luce Skrabanek & Paul Zumbo Day 3: Counting reads

More information

Exercises: Analysing RNA-Seq data

Exercises: Analysing RNA-Seq data Exercises: Analysing RNA-Seq data Version 2018-03 Exercises: Analysing RNA-Seq data 2 Licence This manual is 2011-18, Simon Andrews, Laura Biggins. This manual is distributed under the creative commons

More information

Analyzing Variant Call results using EuPathDB Galaxy, Part II

Analyzing Variant Call results using EuPathDB Galaxy, Part II Analyzing Variant Call results using EuPathDB Galaxy, Part II In this exercise, we will work in groups to examine the results from the SNP analysis workflow that we started yesterday. The first step is

More information

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University

RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day four Quantifying expression Intro to R Differential expression

More information

The QoRTs Analysis Pipeline Example Walkthrough

The QoRTs Analysis Pipeline Example Walkthrough The QoRTs Analysis Pipeline Example Walkthrough Stephen Hartley National Human Genome Research Institute National Institutes of Health March 30, 2017 QoRTs v1.2.0 JunctionSeq v1.5.4 Contents 1 Overview

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub

11/8/2017 Trinity De novo Transcriptome Assembly Workshop trinityrnaseq/rnaseq_trinity_tuxedo_workshop Wiki GitHub trinityrnaseq / RNASeq_Trinity_Tuxedo_Workshop Trinity De novo Transcriptome Assembly Workshop Brian Haas edited this page on Oct 17, 2015 14 revisions De novo RNA-Seq Assembly and Analysis Using Trinity

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

Accessible, Transparent and Reproducible Analysis with Galaxy

Accessible, Transparent and Reproducible Analysis with Galaxy Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain.

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain. O. Graña *a,b, M. Rubio-Camarillo a, F. Fdez-Riverola b, D.G. Pisano a and D. Glez-Peña b a Bioinformatics Unit, Structural Biology and BioComputing Programme, Spanish National Cancer Research Centre (CNIO).

More information

JunctionSeq Package User Manual

JunctionSeq Package User Manual JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health v0.6.10 November 20, 2015 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................

More information

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf

More information

ChIP-Seq Tutorial on Galaxy

ChIP-Seq Tutorial on Galaxy 1 Introduction ChIP-Seq Tutorial on Galaxy 2 December 2010 (modified April 6, 2017) Rory Stark The aim of this practical is to give you some experience handling ChIP-Seq data. We will be working with data

More information

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software:

Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat a.tgz. Software: A Tutorial: De novo RNA- Seq Assembly and Analysis Using Trinity and edger The following data and software resources are required for following the tutorial: Data: ftp://ftp.broad.mit.edu/pub/users/bhaas/rnaseq_workshop/rnaseq_workshop_dat

More information

RNA-Seq data analysis software. User Guide 023UG050V0200

RNA-Seq data analysis software. User Guide 023UG050V0200 RNA-Seq data analysis software User Guide 023UG050V0200 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen

More information

Using Galaxy: RNA-seq

Using Galaxy: RNA-seq Using Galaxy: RNA-seq Stanford University September 23, 2014 Jennifer Hillman-Jackson Galaxy Team Penn State University http://galaxyproject.org/ The Agenda Introduction RNA-seq Example - Data Prep: QC

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Saint Louis University St. Louis, Missouri April 30, 2013 Dave Clements, Emory University http://galaxyproject.org/ Agenda 9:00 Welcome 9:20 Basic Analysis with Galaxy 10:30 Basic

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

JunctionSeq Package User Manual

JunctionSeq Package User Manual JunctionSeq Package User Manual Stephen Hartley National Human Genome Research Institute National Institutes of Health February 16, 2016 JunctionSeq v1.1.3 Contents 1 Overview 2 2 Requirements 3 2.1 Alignment.........................................

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP)

Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN. Sophie Gallina CNRS Evo-Eco-Paléo (EEP) Cycle «Analyse de données de séquençage à haut-débit» Module 1/5 Analyse ADN Sophie Gallina CNRS Evo-Eco-Paléo (EEP) (sophie.gallina@univ-lille1.fr) Module 1/5 Analyse DNA NGS Introduction Galaxy : upload

More information

From the Schnable Lab:

From the Schnable Lab: From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software

More information

ChIP-seq (NGS) Data Formats

ChIP-seq (NGS) Data Formats ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/

More information

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide. BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data

More information

Identiyfing splice junctions from RNA-Seq data

Identiyfing splice junctions from RNA-Seq data Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice

More information

miarma-seq: mirna-seq And RNA-Seq Multiprocess Analysis tool. mrna detection from RNA-Seq Data User s Guide

miarma-seq: mirna-seq And RNA-Seq Multiprocess Analysis tool. mrna detection from RNA-Seq Data User s Guide miarma-seq: mirna-seq And RNA-Seq Multiprocess Analysis tool. mrna detection from RNA-Seq Data User s Guide Eduardo Andrés-León, Rocío Núñez-Torres and Ana M Rojas. Instituto de Biomedicina de Sevilla

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017 1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior

More information

Differential gene expression analysis

Differential gene expression analysis Differential gene expression analysis Overview In this exercise, we will analyze RNA-seq data to measure changes in gene expression levels between wild-type and a mutant strain of the bacterium Listeria

More information

Standard output. Some of the output files can be redirected into the standard output, which may facilitate in creating the pipelines:

Standard output. Some of the output files can be redirected into the standard output, which may facilitate in creating the pipelines: Lecture 18 RNA-seq Alignment Standard output Some of the output files can be redirected into the standard output, which may facilitate in creating the pipelines: Filtering of the alignments STAR performs

More information

Benchmarking of RNA-seq aligners

Benchmarking of RNA-seq aligners Lecture 17 RNA-seq Alignment STAR Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Based on this analysis the most reliable

More information

RNA-Seq data analysis software. User Guide 023UG050V0100

RNA-Seq data analysis software. User Guide 023UG050V0100 RNA-Seq data analysis software User Guide 023UG050V0100 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen

More information

Expression Analysis with the Advanced RNA-Seq Plugin

Expression Analysis with the Advanced RNA-Seq Plugin Expression Analysis with the Advanced RNA-Seq Plugin May 24, 2016 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

A short Introduction to UCSC Genome Browser

A short Introduction to UCSC Genome Browser A short Introduction to UCSC Genome Browser Elodie Girard, Nicolas Servant Institut Curie/INSERM U900 Bioinformatics, Biostatistics, Epidemiology and computational Systems Biology of Cancer 1 Why using

More information

Getting Started. April Strand Life Sciences, Inc All rights reserved.

Getting Started. April Strand Life Sciences, Inc All rights reserved. Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6

More information

RNASeq2017 Course Salerno, September 27-29, 2017

RNASeq2017 Course Salerno, September 27-29, 2017 RNASeq2017 Course Salerno, September 27-29, 2017 RNA- seq Hands on Exercise Fabrizio Ferrè, University of Bologna Alma Mater (fabrizio.ferre@unibo.it) Hands- on tutorial based on the EBI teaching materials

More information

RNA-Seq data analysis software. User Guide 023UG050V0210

RNA-Seq data analysis software. User Guide 023UG050V0210 RNA-Seq data analysis software User Guide 023UG050V0210 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen

More information

Importing your Exeter NGS data into Galaxy:

Importing your Exeter NGS data into Galaxy: Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina

More information

Our typical RNA quantification pipeline

Our typical RNA quantification pipeline RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Package RNASeqR. January 8, 2019

Package RNASeqR. January 8, 2019 Type Package Package RNASeqR January 8, 2019 Title RNASeqR: RNA-Seq workflow for case-control study Version 1.1.3 Date 2018-8-7 Author Maintainer biocviews Genetics, Infrastructure,

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Introduction to Cancer Genomics

Introduction to Cancer Genomics Introduction to Cancer Genomics Gene expression data analysis part I David Gfeller Computational Cancer Biology Ludwig Center for Cancer research david.gfeller@unil.ch 1 Overview 1. Basic understanding

More information

LFCseq: a nonparametric approach for differential expression analysis of RNA-seq data - supplementary materials

LFCseq: a nonparametric approach for differential expression analysis of RNA-seq data - supplementary materials LFCseq: a nonparametric approach for differential expression analysis of RNA-seq data - supplementary materials Bingqing Lin 1, Li-Feng Zhang 1, and Xin Chen 1 School of Biological Sciences, School of

More information

Fusion Detection Using QIAseq RNAscan Panels

Fusion Detection Using QIAseq RNAscan Panels Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com

More information