Shape Representation and Indexing Based on Region Connection Calculus and Oriented Matroid Theory
|
|
- Mae Hampton
- 5 years ago
- Views:
Transcription
1 Shpe Representtion nd Indexing Bsed on Region Connection Clculus nd Oriented Mtroid Theory Ernesto Stffetti 1, Antoni Gru 2, Frncesc Serrtos 3, nd Alerto Snfeliu 1 1 Institute of Industril Rootics (CSIC-UPC) Llorens i Artigs 4-6, Brcelon Spin {estffetti,snfeliu}@iri.upc.es 2 Deprtment of Automtic Control, Technicl University of Ctloni Pu Grgllo 5, Brcelon Spin ntoni.gru@upc.es 3 Deprtment of Computer Engineering nd Mthemtics Rovir i Virgili University, Av. Pisos Ctlnes 26, Trrgon Spin frncesc.serrtos@etse.urv.es Astrct. In this pper novel method for indexing views of 3D ojects is presented. The topologicl properties of the regions of the views of set of ojects re used to define n index sed on the region connection clculus nd oriented mtroid theory. Both re formlisms for qulittive sptil representtion nd resoning nd re complementry in the sense tht wheres the region connection clculus encodes informtion out connectivity of pirs of connected regions of the view, oriented mtroids encode reltive position of the disjoint regions of the view nd give locl nd glol topologicl informtion out their sptil distriution. This indexing technique is pplied to 3D oject hypothesis genertion from single views to reduce cndidtes in oject recognition processes. 1 Introduction In this pper we present new method for indexing views of 3D ojects which is pplied to 3D oject hypothesis genertion from single views to reduce cndidtes in 3D oject recognition processes. Given set of views of different 3D ojects, the prolem of oject recognition using single view ecomes the prolem of finding suset of the set of regions in the imge with reltionl structure identicl to tht of memer of the set of views. The stndrd wy to reduce the complexity of shpe mtching is sudividing the prolem into hypothesis genertion followed y verifiction. To e of interest for oject recognition, hypothesis genertion should e reltively fst lthough imprecise procedure in which severl possile cndidtes for mtching re generted. In this wy the verifiction cn e crried out using more complex, nd therefore, slower procedure [1] over reduced numer of I. Nyström et l. (Eds.): DGCI 2003, LNCS 2886, pp , c Springer-Verlg Berlin Heidelerg 2003
2 268 Ernesto Stffetti et l. DC(, ) EC(, ) PO(, ) TPP(, ) NTPP(, ) EQ(, ) () () (c) (d) (e) (f) Fig. 1. Some of the 8 possile reltive positions of two regions nd the corresponding descriptions using the formlism of the region connection clculus. The other two cn e otined from (d) nd (e) interchnging with. In sitution () is disconnected from, in() is externlly connected to, in sitution (c) is prtilly overlpped to, in(d) is tngentil proper prt of, in(e) is non-tngentil proper prt of nd, finlly, in sitution (f) nd coincide. cndidtes. The hypothesis genertion cn e crried out very efficiently if it is formulted s n indexing prolem where the set of views of the set of 3D ojects re stored into tle tht is indexed y some function of the views themselves. In this pper n indexing technique tht comines the region connection clculus nd oriented mtroid theory is presented. More precisely, the type of connectivity etween connected regions of the views is descried y mens of the formlism of the region connection clculus [2], wheres the topologicl properties of the disconnected regions of the views re encoded into dt structure clled set of cocircuits [3]. The set of cocircuits, tht re one of the severl comintoril dt structure referred to s oriented mtroids, encode incidence reltions nd reltive position of the elements of the imge nd give locl nd glol topologicl informtion out their sptil distriution. Resoning with the region connection clculus is sed on composition tles, while oriented mtroids permit lgeric techniques to e used. These two descriptions merged re used s n index of the dtse. This indexing method is employed to the hypothesis genertion for 3D oject recognition from single views tht cn e regrded s qulittive counterprt of the geometric hshing technique [4]. For nother pproch to shpe representtion nd indexing sed on comintoril geometry see [5]. The region connection clculus nd oriented mtroids re introduced in Section 2 wheres Section 3 descries the proposed indexing method. In Section 4 some experimentl results re reported nd Section 5 contins the conclusions. 2 Qulittive Sptil Representtion Qulittive resoning is sed on comprtive knowledge rther thn on metric informtion. Mny methods for shpe representtion nd nlysis re sed on extrcting points nd edges which re used to define projectively invrint descriptors. In this pper, insted of points, regions of the imges re tken into ccount. The motivtion ehind this choice is tht the regions of n imge cn e more relily extrcted thn vertices nd edges. In the following sections two formlisms for qulittive representtion nd resoning re descried: the first
3 Shpe Representtion nd Indexing 269 OUT(, ) P-INS(, ) INS(, ) () () (c) Fig. 2. Some of the possile positions of convex region with respect to the convex hull of non-convex one. one is sed on the region connection clculus nd the second one is derived from oriented mtroid theory. 2.1 Region Connection Clculus For sptilly extended ojects we cn qulittively distinguish the interior, the oundry, nd the exterior of the oject, without tking into ccount the concrete shpe or size of the oject. A set theoreticl nlysis of the possile reltions etween ojects sed on the ove prtition is provided y [6]. The reltion etween ojects tht they exmine is the intersection etween their oundries nd interiors. This setting is sed on the distinction of the vlues empty nd non-empty for the intersection. Some vrints of this theory were developed y Cohn nd his coworkers in series of ppers (see for exmple [2]). In this work the distinction etween interior nd the oundry of n oject is ndoned, nd eight topologicl reltions derived from the single inry reltion connected to re tken into ccount. Some of them re represented in Fig. 1. Some of these reltions, nmely those of Fig. 1.d nd Fig. 1.e, re not symmetricl nd, following the nottion of [2], their inverses re denoted TPPi(, ) nd NTTPi(, ), respectively. Furthermore in [2] the theory is extended to hndle concve ojects y distinguishing the regions inside nd outside of the convex hull of the ojects. A convex oject cn e inside, prtilly inside or outside the convex hull of non-convex one (Fig. 2). If oth regions re non-convex 23 reltions etween them cn e defined. These reltions permit qulittive description of rther complex reltions, such s tht represented in Fig. 3. Moreover, y mens of this formlism clled region connection clculus it is possile, for instnce, to infer the reltive position of two regions knowing their position with respect to third one. Resoning with the region connection clculus is essentilly sed on composition tles. 2.2 Oriented Mtroids Oriented mtroid theory [3], [7], [8] is rod setting in which the comintoril properties of geometricl configurtions cn e descried nd nlyzed. It
4 270 Ernesto Stffetti et l. Fig. 3. With the formlism of the region connection clculus the reltion etween these two disconnected non-convex regions, where is prtilly inside the convex hull of nd vice vers, is denoted y P-INS P-INSi DC(, ). provides common generliztion of lrge numer of different mthemticl ojects usully treted t the level of usul coordintes. In this section oriented mtroids will e introduced over rrngements of points using two comintoril dt structures clled chirotope nd set of cocircuits, which represent the min tools to trnslte geometric prolems into this formlism. In the strction process from the concrete configurtion of points to the oriented mtroid, metric informtion is lost ut the structurl properties of the configurtion of points re represented t purely comintoril level. Oriented Mtroids of Arrngements of Points. Given point configurtion in R d 1 whose elements re the columns of the mtrix P =(p 1,p 2,...,p n ), the ssocited vector configurtion is finite spnning sequence of vectors {x 1, x 2,..., x n } in R d represented s columns of the mtrix X =(x 1,x 2,...,x n ) where ech point p i is represented in homogeneous coordintes s x i = ( p i ) 1. To encode the comintoril properties of the point configurtion we cn use dt structure clled chirotope [8], which cn e computed y mens of the ssocited vector configurtion X. The chirotope of X is the mp χ X : {1, 2,..., n} d {+, 0, } (λ 1,λ 2,...,λ d ) sign ([x λ1,x λ2,...,x λd ]) tht ssigns to ech d-tuple of vectors of the finite configurtion X sign + or depending on whether it forms sis of R d hving positive or negtive orienttion, respectively. This function ssigns the vlue 0 to those d-tuples tht do not constitute sis of R d. The chirotope descries the incidence structure etween the points of X nd the hyperplnes spnned y the sme points nd, t the sme time, encodes the reltive position of the points of the configurtion with respect to the hyperplnes tht they spn. Consider the point configurtion P represented in Fig. 4 whose ssocited vector configurtion X is given in Tle 1. Tle 1. Vector configurtion tht corresponds to the plnr point configurtion represented in Fig. 4. x 1 =(0, 3, 1) T x 2 =( 3, 1, 1) T x 3 =( 2, 2, 1) T x 4 =(2, 2, 1) T x 5 =(3, 1, 1) T x 6 =(0, 0, 1) T
5 p2 p1 p6 Shpe Representtion nd Indexing 271 p5 p3 p4 Fig. 4. A plnr point configurtion. Tle 2. Chirotope of the plnr point configurtion represented in Fig. 4. χ(1, 2, 3)=+χ(1, 2, 4)=+χ(1, 2, 5)=+χ(1, 2, 6)=+χ(1, 3, 4)=+ χ(1, 3, 5)=+χ(1, 3, 6)=+χ(1, 4, 5)=+χ(1, 4, 6) = χ(1, 5, 6) = χ(2, 3, 4)=+χ(2, 3, 5)=+χ(2, 3, 6)=+χ(2, 4, 5)=+χ(2, 4, 6)=+ χ(2, 5, 6) = χ(3, 4, 5)=+χ(3, 4, 6)=+χ(3, 5, 6)=+χ(4, 5, 6)=+ Tle 3. Set of cocircuits of the plnr point configurtion represented in Fig. 4. (0, 0, +, +, +, +) (0,, 0, +, +, +) (0,,, 0, +, ) (0,,,, 0, ) (0,,, +, +, 0) (+, 0, 0, +, +, +) (+, 0,, 0, +, +) (+, 0,,, 0, ) (+, 0,,, +, 0) (+, +, 0, 0, +, +) (+, +, 0,, 0, +) (+, +, 0,,, 0) (+, +, +, 0, 0, +) (, +, +, 0,, 0) (,, +, +, 0, 0) The chirotope χ X of this vector configurtion is given y the orienttions listed in Tle 2. The element χ(1, 2, 3) = + indictes tht in the tringle formed y p 1, p 2, nd p 3 these points re counterclockwise ordered. These orienttions cn e rerrnged in n equivlent dt structure clled set of cocircuits of X shown in Tle 3. In this plnr cse, the set of cocircuits of X is the set of ll prtitions generted y the lines pssing through two points of the configurtion. For exmple, (0, 0, +, +, +, +) mens tht the points p 3, p 4, p 5, nd p 6 lie on the hlf plne determined y the line through the points p 1 nd p 2. Reversing ll the signs of the set of cocircuits we otin n equivlent description of the plnr rrngement of points. Besides chirotopes nd cocircuits there re severl dt structures cple of encoding the topologicl properties of point configurtion. In [8] their definitions cn e found nd it is shown tht ll of them re equivlent nd re referred to s oriented mtroids. Oriented Mtroid of Arrngements of Regions. Consider segmented view of 3D oject. Extrcting the oriented mtroid of view is not strightforwrd since the regions tht form the imge cnnot e reduced to points, tking for instnce their centroids, without losing essentil topologicl informtion for
6 e1 e2 IS,T l2 IS,T RS,T 272 Ernesto Stffetti et l. oject recognition. Therefore, the convex hull [9] of ech region is employed to represent the region itself. Then, pirs of the resulting convex polygons re considered nd the oriented mtroid is computed sed on the sptil loction of the other convex regions of the imge with respect to the two lines rising in merging the convex hulls of pirs disconnected regions. Consider, for instnce, the ordered pir of convex regions (S, T ) of Fig. 5.. It is esy to see tht the convex hull of these two plnr convex disconnected polygonl regions is polygon whose set of vertices is included in the union of the set of vertices of S nd T. On the contrry, the set of edges of the convex hull of S nd T is not included in the union of their set of edges. Indeed, two new ridging edges, e 1 nd e 2, pper s illustrted in Fig. 5.. Actully, efficient lgorithms for merging convex hulls re sed on finding these two edges [10]. LS,T T U l1 Z S V () () (c) Fig. 5. Steps of encoding of the comintoril properties of view of n oject into chirotope. Consider the two lines l 1 nd l 2 tht support e 1 nd e 2. These two lines divide the imge into three or four zones depending on the loction of their intersection point with respect to the imge. Let R S,T, L S,T (Fig. 5.) e, respectively, the rightmost nd leftmost zones with respect to l 1 nd l 2 nd I S,T the zone of the imge comprised etween them. Since, R S,T, L S,T nd I S,T cn e univoclly determined from the ordered couple of region (S, T ), the loction of region U with respect to the regions (S, T ) of the imge is encoded into chirotope using the following rule + if U L S,T, χ(s, T, U) = 0 if U I S,T, if U R S,T. It hs een implicitly ssumed tht U is completely contined into either R S,T L S,T or I S,T ut, in generl, it elongs to more tht one of them. In this cse, since the rtio of res is n ffine invrint, introducing n pproximtion, we cn choose the sign sed on which region contins the lrgest portion of the re of U. For instnce, if regions U, V nd Z re locted s in Fig. 5.c we hve tht χ(s, T, U) = +,χ(s, T, V )= 0 nd χ(s, T, Z) =. 2.3 Invrince of the Representtion Consider 3D point configurtion nd one of its views. The comintoril structure of the 3D point configurtion nd tht of its 2D perspective projection re
7 Shpe Representtion nd Indexing 273 relted in the following wy: if x 0 represents in homogeneous coordintes the center of the cmer, p 0, we hve tht sign[ x i, x j, x k ] = sign[x i,x j,x k,x 0 ] (1) where x i, x j nd x k re the homogeneous coordintes of the 3D points p i, p j nd p k, nd x i, x j nd x k re those of the corresponding points in the view, p i, p j nd p k. Eqution (1) cn e regrded s projection eqution for chirotopes. It is esy to see tht, wheres the mtrix tht represents in homogeneous coordintes the vertices of projected set of points is coordinte-dependent, n oriented mtroid is coordinte-free representtion. Moreover, the representtion of oject views sed on oriented mtroid is topologicl invrint, tht is, n invrint under homeomorphisms. Roughly speking, this mens tht the oriented mtroid tht represents the rrngement of points of view of n oject does not chnge when the points undergo continuous trnsformtion tht does not chnge ny orienttion of the chirotope. Doe to this property this representtion is roust to discretiztion errors of the imge s well s to smll chnges of the point of view tht does not chnge ny orienttion of the chirotope. Since projective trnsformtions cn e regrded s specil homeomorphisms, we cn ssert tht the representtion of the projected set of points sed on oriented mtroids is projective invrint. However, since ffine nd Eucliden trnsformtions re specil projective trnsformtions, the oriented mtroid of the projected set of points of view of n oject does not chnge under rottions, trnsltions, nd ffine trnsformtions of the plnr rrngement of points themselves. These considertions cn e extended to the cse in which oriented mtroids represent rrngements of plnr regions. Since the rtio of res is not invrint under projective trnsformtions this representtion will e invrint only under ffine nd Eucliden trnsformtions of the views. 3 Indexing Views of 3D Ojects The process of indexing dtse of views of set of ojects strts with some preliminry choices, nmely the fetures used to chrcterize the regions of the segmented views of the set of 3D ojects. Suppose tht hue nd re re used to chrcterize ech region. Another prmeter to choose is the numer of levels in which the hue is quntized nd the numer of regions hving the sme hue tht will e tken into ccount. These choices, of course, depend on the properties of the views of the dtse. Then, the views re segmented ccording to these choices nd the convex hull of ech region is computed. As consequence, the resulting imges re compositions of convex polygonl regions tht cn e disconnected or prtilly or completely overlpped. In Fig. 6 re represented two views of two ojects in which hue quntiztion with 6 levels W, R, Y, G, B nd N hs een pplied nd only the two iggest regions with the sme hue vlue re tken into ccount.
8 G2 B2 B2 274 Ernesto Stffetti et l. Let (W, R, Y, G, B, N) e the ordered tuple of hue levels considered. For exmple, lels G 1 nd G 2 in Fig. 6 denote, respectively, the first nd the second regions of the views with the iggest re hving the sme hue vlue G. The type of connection etween the existing regions is descried using the formlism of the region connection clculus. For ech pir of disconnected regions the set of cocircuits is computed. This is done for ech view of the dtse nd this informtion is comined into unique index tle whose entries re sptil comintions of fetures nd whose records contin list of the views in which ech comintion is present. W Y N G1 R N B1 W B1 G1 Oject 1 Oject 2 Fig. 6. Two views of two ojects whose topologicl properties re indexed in Tle 4. In Tle 4 the index of the topologicl properties of the two views v 1,1 nd v 1,2 of the ojects represented in Fig. 6 is reported. In the first column the reltion etween ordered couples of regions is descried in terms of the region connection clculus. The symol for certin couple (S, T ) indictes tht no view contins two regions hving fetures S nd T. This is the cse of the regions R nd Y. When S nd T re disconnected, the corresponding cocircuit is present in the index. The symol in correspondence with certin feture indictes tht no region with tht feture is present in the views listed in the record. For exmple, the cocircuit WR contins in the column Y ecuse no region with the Y feture is present in v 1,1. If (S, T ) is couple of connected regions, the corresponding row of the index is empty ecuse the cocircuit cnnot e computed. 3.1 Hypothesis Genertion for Oject Recognition Given dtse of views of set of 3D ojects nd view v i of one of them, not necessrily contined in the dtse, its set of cocircuits is computed. Ech cocircuit is used to ccess the tle tht constitutes the index of the dtse. Then the views tht est mtch v i re selected sed on the numer of correspondences they hve with v i in terms of cocircuits. It is esy to see tht this method for hypothesis genertion, tht cn e regrded s qulittive version of the geometric hshing technique [4], is lso roust to prtil occlusions of the ojects. Indeed, if region of n imge is
9 Shpe Representtion nd Indexing 275 Tle 4. Index of the topologicl properties of the two views v 1,1 nd v 1,2 of the two ojects represented in Fig. 6. Connection W R Y G 1 G 2 B 1 B 2 N Ojects WR DC v 1,1 WY DC v 1,2 WG 1 NTPP v 1,1 WG 1 DC v 1,2 WG 2 DC v 1,1 WB 1 DC v 1,1 WB 1 NTPP v 1,2 WB 2 DC v 1,1 WB 2 NTPPi v 1,2 WN DC v 1,1 WN DC v 1,2 RY RG 1 NTPP v 1,1 B 2N DC v 1,1 B 2N DC v 1,2 occluded, the set of cocircuits cn still e computed nd therefore, the numer of correspondences with the views of the dtse cn still e clculted. In this cse, oviously, its selectivity decreses. 4 Experimentl Results The method hs een fully implemented nd experiments with different sets of 3D ojects hve een crried out to vlidte it. Sixteen views of ech oject with ngulr seprtion of 22.5 degrees hve een used for the experiments. These imges hve een segmented using the segmenttion method descried in [11]. Then, the index of the lerning set of eight views per oject tken t the ngles 0, 45, 90, 135, 180, 225, 270 nd 315 hs een creted. In the recognition process the set of cocircuits of ech imge of the test set composed y the eight views not used in the lerning process tht is, the views tken t ngles: 22.5, 67.5, 115.5, 157.5, 202.5, 247.5, nd degrees, hs een clculted. The experimentl results re encourging nd currently we re refining the method introducing distnce mesure etween set of cocircuits. 5 Conclusions In this pper new method for indexing dtse of views of 3D oject hs een presented. It is sed on the comintion of two qulittive representtions derived from the region connection clculus nd oriented mtroid theory. This comintion of qulittive representtions chrcterizes the locl nd glol topology of the regions of n imge, is invrint under ffine nd Eucliden trnsformtion of the views, intrinsiclly roust to discretiztion errors of the imge nd insensitive to smll displcements of the point of view.
10 276 Ernesto Stffetti et l. References 1. Serrtos, F., Alquézr, R., Snfeliu, A.: Function-descried for modeling ojects represented y ttriuted grphs. Pttern Recognition 36 (2003) Cohn, A., Bennett, B., Goody, J., Gotts, N.M.: Qulittive sptil representtion nd resoning with the region connection clculus. GeoInformtic 1 (1997) Björner, A., Vergns, M.L., Sturmfels, B., White, N., Ziegler, G.M.: Oriented Mtroids. Volume 43 of Encyclopedi of Mthemtics nd its Applictions. Cmridge University Press (1993) 4. Lmdn, Y., Schwrtz, J.T., Wolfson, H.J.: Affine invrint model-sed oject recognition. IEEE Trnsctions on Rootics nd Automtion 6 (1990) 5. Crlsson, S.: Comintoril geometry for shpe representtion nd indexing. In: Proceedings of the Interntionl Workshop on Oject Representtion for Computer Vision. (1996) 6. Egenhofer, M.J., Frnzos, R.D.: Point set topologicl reltions. Interntionl Journl of Geogrphicl Informtion Systems 5 (1991) Bokowski, J., Sturmfels, B.: Computtionl Synthetic Geometry. Volume 1355 of Lecture Notes in Mthemtics. Springer Verlg (1989) 8. Richter-Geert, J., Ziegler, G.M.: Oriented mtroids. In Goodmn, J.E., O Rourke, J., eds.: Hndook of Discrete nd Computtionl Geometry. CRC Press (1997) 9. Rourke, J.O.: Computtionl Geometry in C. Cmridge University Press (1999) 10. Toussint, G.T.: Solving geometric prolems with the rotting clipers. In: Proceedings of IEEE MELECON 83, Athens, Greece (1983) 11. Comniciu, D., Meer, P.: Men shift: A roust pproch towrd feture spce nlysis. IEEE Trnsctions on Pttern Anlysis nd Mchine Intelligence 24 (2002)
Object and image indexing based on region connection calculus and oriented matroid theory
Discrete Applied Mthemtics 147 (2005) 345 361 www.elsevier.com/locte/dm Oject nd imge indexing sed on region connection clculus nd oriented mtroid theory Ernesto Stffetti, Antoni Gru, Frncesc Serrtos c,
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationAn Expressive Hybrid Model for the Composition of Cardinal Directions
An Expressive Hyrid Model for the Composition of Crdinl Directions Ah Lin Kor nd Brndon Bennett School of Computing, University of Leeds, Leeds LS2 9JT, UK e-mil:{lin,brndon}@comp.leeds.c.uk Astrct In
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationGENERATING ORTHOIMAGES FOR CLOSE-RANGE OBJECTS BY AUTOMATICALLY DETECTING BREAKLINES
GENEATING OTHOIMAGES FO CLOSE-ANGE OBJECTS BY AUTOMATICALLY DETECTING BEAKLINES Efstrtios Stylinidis 1, Lzros Sechidis 1, Petros Ptis 1, Spiros Sptls 2 Aristotle University of Thessloniki 1 Deprtment of
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationF. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997.
Forced convex n-gons in the plne F. R. K. Chung y University ofpennsylvni Phildelphi, Pennsylvni 19104 R. L. Grhm AT&T Ls - Reserch Murry Hill, New Jersey 07974 Mrch 2,1997 Astrct In seminl pper from 1935,
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationMathematics Background
For more roust techer experience, plese visit Techer Plce t mthdshord.com/cmp3 Mthemtics Bckground Extending Understnding of Two-Dimensionl Geometry In Grde 6, re nd perimeter were introduced to develop
More informationClass-XI Mathematics Conic Sections Chapter-11 Chapter Notes Key Concepts
Clss-XI Mthemtics Conic Sections Chpter-11 Chpter Notes Key Concepts 1. Let be fixed verticl line nd m be nother line intersecting it t fixed point V nd inclined to it t nd ngle On rotting the line m round
More informationII. THE ALGORITHM. A. Depth Map Processing
Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationCOLOUR IMAGE MATCHING FOR DTM GENERATION AND HOUSE EXTRACTION
Hee Ju Prk OLOUR IMAGE MATHING FOR DTM GENERATION AND HOUSE EXTRATION Hee Ju PARK, Petr ZINMMERMANN * Swiss Federl Institute of Technology, Zuric Switzerlnd Institute for Geodesy nd Photogrmmetry heeju@ns.shingu-c.c.kr
More informationUSING HOUGH TRANSFORM IN LINE EXTRACTION
Stylinidis, Efstrtios USING HOUGH TRANSFORM IN LINE EXTRACTION Efstrtios STYLIANIDIS, Petros PATIAS The Aristotle University of Thessloniki, Deprtment of Cdstre Photogrmmetry nd Crtogrphy Univ. Box 473,
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationLecture 5: Spatial Analysis Algorithms
Lecture 5: Sptil Algorithms GEOG 49: Advnced GIS Sptil Anlsis Algorithms Bsis of much of GIS nlsis tod Mnipultion of mp coordintes Bsed on Eucliden coordinte geometr http://stronom.swin.edu.u/~pbourke/geometr/
More informationComplete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
More information50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:
5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )
More informationRigid Body Transformations
igid od Kinemtics igid od Trnsformtions Vij Kumr igid od Kinemtics emrk out Nottion Vectors,,, u, v, p, q, Potentil for Confusion! Mtrices,, C, g, h, igid od Kinemtics The vector nd its skew smmetric mtri
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationFig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.
Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationUnit 5 Vocabulary. A function is a special relationship where each input has a single output.
MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationTopics in Analytic Geometry
Nme Chpter 10 Topics in Anltic Geometr Section 10.1 Lines Objective: In this lesson ou lerned how to find the inclintion of line, the ngle between two lines, nd the distnce between point nd line. Importnt
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More information8.2 Areas in the Plane
39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to
More informationText mining: bag of words representation and beyond it
Text mining: bg of words representtion nd beyond it Jsmink Dobš Fculty of Orgniztion nd Informtics University of Zgreb 1 Outline Definition of text mining Vector spce model or Bg of words representtion
More informationOn the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis
On the Detection of Step Edges in Algorithms Bsed on Grdient Vector Anlysis A. Lrr6, E. Montseny Computer Engineering Dept. Universitt Rovir i Virgili Crreter de Slou sin 43006 Trrgon, Spin Emil: lrre@etse.urv.es
More informationTree Structured Symmetrical Systems of Linear Equations and their Graphical Solution
Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More information4-1 NAME DATE PERIOD. Study Guide. Parallel Lines and Planes P Q, O Q. Sample answers: A J, A F, and D E
4-1 NAME DATE PERIOD Pges 142 147 Prllel Lines nd Plnes When plnes do not intersect, they re sid to e prllel. Also, when lines in the sme plne do not intersect, they re prllel. But when lines re not in
More information15. 3D-Reconstruction from Vanishing Points
15. 3D-Reconstruction from Vnishing Points Christin B.U. Perwss 1 nd Jon Lseny 2 1 Cvendish Lortory, Cmridge 2 C. U. Engineering Deprtment, Cmridge 15.1 Introduction 3D-reconstruction is currently n ctive
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationLily Yen and Mogens Hansen
SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst
More informationCS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.
1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationON THE DEHN COMPLEX OF VIRTUAL LINKS
ON THE DEHN COMPLEX OF VIRTUAL LINKS RACHEL BYRD, JENS HARLANDER Astrct. A virtul link comes with vriety of link complements. This rticle is concerned with the Dehn spce, pseudo mnifold with oundry, nd
More informationBasic Geometry and Topology
Bsic Geometry nd Topology Stephn Stolz Septemer 7, 2015 Contents 1 Pointset Topology 1 1.1 Metric spces................................... 1 1.2 Topologicl spces................................ 5 1.3 Constructions
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationAVolumePreservingMapfromCubetoOctahedron
Globl Journl of Science Frontier Reserch: F Mthemtics nd Decision Sciences Volume 18 Issue 1 Version 1.0 er 018 Type: Double Blind Peer Reviewed Interntionl Reserch Journl Publisher: Globl Journls Online
More informationSpectral Analysis of MCDF Operations in Image Processing
Spectrl Anlysis of MCDF Opertions in Imge Processing ZHIQIANG MA 1,2 WANWU GUO 3 1 School of Computer Science, Northest Norml University Chngchun, Jilin, Chin 2 Deprtment of Computer Science, JilinUniversity
More informationEfficient K-NN Search in Polyphonic Music Databases Using a Lower Bounding Mechanism
Efficient K-NN Serch in Polyphonic Music Dtses Using Lower Bounding Mechnism Ning-Hn Liu Deprtment of Computer Science Ntionl Tsing Hu University Hsinchu,Tiwn 300, R.O.C 886-3-575679 nhliou@yhoo.com.tw
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationTopic 3: 2D Transformations 9/10/2016. Today s Topics. Transformations. Lets start out simple. Points as Homogeneous 2D Point Coords
Tody s Topics 3. Trnsformtions in 2D 4. Coordinte-free geometry 5. (curves & surfces) Topic 3: 2D Trnsformtions 6. Trnsformtions in 3D Simple Trnsformtions Homogeneous coordintes Homogeneous 2D trnsformtions
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationStatistical classification of spatial relationships among mathematical symbols
2009 10th Interntionl Conference on Document Anlysis nd Recognition Sttisticl clssifiction of sptil reltionships mong mthemticl symbols Wl Aly, Seiichi Uchid Deprtment of Intelligent Systems, Kyushu University
More informationSection 9.2 Hyperbolas
Section 9. Hperols 597 Section 9. Hperols In the lst section, we lerned tht plnets hve pproimtel ellipticl orits round the sun. When n oject like comet is moving quickl, it is le to escpe the grvittionl
More informationOutline. Two combinatorial optimization problems in machine learning. Talk objectives. Grammar induction. DFA induction.
Outline Two comintoril optimiztion prolems in mchine lerning Pierre.Dupont@uclouvin.e 1 Feture selection ICTEAM Institute Université ctholique de Louvin Belgium My 1, 011 P. Dupont (UCL Mchine Lerning
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationTO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
More informationModeling and Simulation of Short Range 3D Triangulation-Based Laser Scanning System
Modeling nd Simultion of Short Rnge 3D Tringultion-Bsed Lser Scnning System Theodor Borngiu Anmri Dogr Alexndru Dumitrche April 14, 2008 Abstrct In this pper, simultion environment for short rnge 3D lser
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationdocuments 1. Introduction
www.ijcsi.org 4 Efficient structurl similrity computtion etween XML documents Ali Aïtelhdj Computer Science Deprtment, Fculty of Electricl Engineering nd Computer Science Mouloud Mmmeri University of Tizi-Ouzou
More informationThe Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center
Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationCombinatorial synthesis approach employing graph networks
ville online t www.sciencedirect.com VN NGINRING INFORMTIS dvnced ngineering Informtics (00) www.elsevier.com/locte/ei omintoril synthesis pproch employing grph networks Offer Shi, *, Noel Titus, Krthik
More informationGeometrical tile design for complex neighborhoods
COMPUTATIONAL NEUROSCIENCE ORIGINAL RESEARCH ARTICLE pulished: 23 Novemer 2009 doi: 103389/neuro100202009 Geometricl tile design for complex neighorhoods Eugen Czeizler* nd Lil Kri Deprtment of Computer
More informationAn Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure
, Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured
More informationCS380: Computer Graphics Modeling Transformations. Sung-Eui Yoon ( 윤성의 ) Course URL:
CS38: Computer Grphics Modeling Trnsformtions Sung-Eui Yoon ( 윤성의 ) Course URL: http://sgl.kist.c.kr/~sungeui/cg/ Clss Ojectives (Ch. 3.5) Know the clssic dt processing steps, rendering pipeline, for rendering
More informationTOWARDS GRADIENT BASED AERODYNAMIC OPTIMIZATION OF WIND TURBINE BLADES USING OVERSET GRIDS
TOWARDS GRADIENT BASED AERODYNAMIC OPTIMIZATION OF WIND TURBINE BLADES USING OVERSET GRIDS S. H. Jongsm E. T. A. vn de Weide H. W. M. Hoeijmkers Overset symposium 10-18-2012 Deprtment of mechnicl engineering
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationMachine vision system for surface inspection on brushed industrial parts.
Mchine vision system for surfce inspection on rushed industril prts. Nicols Bonnot, Rlph Seulin, Frederic Merienne Lortoire Le2i, CNRS UMR 5158, University of Burgundy, Le Creusot, Frnce. ABSTRACT This
More informationLost in Translation: A Reflection on the Ballot Problem and André's Original Method
Lost in Trnsltion: A Reflection on the Bllot Prolem nd André's Originl Method Mrc Renult Shippensurg University Presented t MthFest August 5, 2007 The Bllot Prolem (1887) In how mny wys cn upsteps nd downsteps
More informationA Sparse Grid Representation for Dynamic Three-Dimensional Worlds
A Sprse Grid Representtion for Dynmic Three-Dimensionl Worlds Nthn R. Sturtevnt Deprtment of Computer Science University of Denver Denver, CO, 80208 sturtevnt@cs.du.edu Astrct Grid representtions offer
More information