Basics of Logic Design Arithmetic Logic Unit (ALU)
|
|
- Corey Preston
- 5 years ago
- Views:
Transcription
1 Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building the uilding locks Outline Review Digitl uilding locks An Arithmetic Logic Unit (ALU) Reding Appendix B, Chpter 3 CPS 4
2 Review: Digitl Design Logic Design, Switching Circuits, Digitl Logic Recll: Everything is uilt from trnsistors A trnsistor is switch It is either on or off On or off cn represent True or Flse Given unch of its ( or ) Is this instruction lw or eq? Wht register do I red? How do I dd two numers? Need method to reson out complex expressions CPS 4 3 Review: Boolen Functions Boolen functions hve rguments tht tke two vlues ({T,F} or {,}) nd they return single or set of ({T,F} or {,}) vlue(s). Boolen functions cn lwys e represented y tle clled Truth Tle Exmple: F: {,}3 -> {,} c f f CPS 4 4
3 Review: Boolen Functions nd Expressions F(A, B, C) = (A * B) + (~A * C) A B C F CPS 4 5 Review: Boolen Gtes Gtes re electronics devices tht implement simple Boolen functions Exmples AND(,) OR(,) NOT() XOR(,) NAND(,) NOR(,) XNOR(,) CPS 4 6
4 Boolen Functions, Gtes nd Circuits Circuits re mde from network of gtes. (function compositions). XOR(,) F = ~* + ~* XOR(,) F CPS 4 7 Digitl Design Exmples Input: its representing n unsigned numer (n) Output: n s unsigned inry numer Input: its representing n unsigned numer (n) Output: 3-n s unsigned inry numer CPS 4 8
5 More Design Exmples X is 3-it quntity. Write logic function tht is true if nd only if X contins t lest two s.. Implement the logic function from prolem. using only AND, OR nd NOT gtes. (Note there re no constrints on the numer of gte inputs.) By implement, I men drw the circuit digrm. 3. Write logic function tht is true if nd only if X, when interpreted s n unsigned inry numer, is greter thn the numer Implement the logic function from prolem 3. using only AND, OR nd NOT gtes. (Note there re no constrints on the numer of gte inputs.) CPS 4 9 Prity Exmple The prity code of inry word counts the numer of ones in word. If there re n even numer of ones the prity code is, if there re n odd numer of ones the prity code is. For exmple, the prity of is, nd the prity of is. Construct the truth tle for function tht computes the prity of four-it word. Implement this function using AND, OR nd NOT gtes. (Note there re no constrints on the numer of gte inputs.) CPS 4
6 Design Exmple Consider mchine with 4 registers Given -it input (register specifier, I, I ) Wnt one of 4 output its (O 3 -O ) to e E.g., llows single register to e ccessed Wht is the circuit for this? CPS 4 Circuit Exmple: Decoder Q 3 I I Q Q Q Q3 Q Q Q I I CPS 4
7 Circuit Exmple: x MUX Multiplexor (MUX) selects from one of mny inputs y MUX(A, B, S) = (A * S) + (B * ~S) s B Gte Gte 3 Y = (A * S) + (B * ~S) A Gte S CPS 4 3 Exmple 4x MUX c d y c d 3 y s s S CPS 4 4
8 Arithmetic nd Logicl Opertions in ISA Wht opertions re there? How do we implement them? Consider -it Adder CPS 4 5 Truth Tle for -it Addition + C in Sum C out Wht is the circuit for Sum nd for Cout? CPS 4 6
9 A -it Cin Sum + Cout C in Sum C out CPS 4 7 Exmple: 4-it dder S3 S S S C out C in 3 3 CPS 4 8
10 ALU Slice (Almost) Cin 3 Q F Q + NOT OR 3 AND Adder Cout F CPS 4 9 Sutrction How do we perform integer sutrction? Wht is the HW? CPS 4
11 ALU Slice Cin 3 B inv F Q NOT - OR - 3 AND Q Su B invert Adder Cout F CPS 4 Exmple: Adder/Sutrcter S3 S S S C out C in Add/Su 3 3 Add/Su = => Addition Add/Su = => Sutrction CPS 4
12 Exmple: (= 53 ) + (= 4 ) (=-33 ) Overflow Exmple: (=-43 ) + (=-54 ) (= 3 ) Exmple3: (= 53 ) + (=- ) (= 3 ) Exmple4: (= ) + (= 4 ) (= 63 ) CPS 4 3 Add/Sutrct With Overflow detection OVERFLOW S n- S n- S S Add/Su n- n- n- n- CPS 4 4
13 The new ALU Slice Cin 3 Q A F Q NOT - OR - 3 AND Add/su Add/su Cout F CPS 4 5 The ALU Overflow = Zero Q n- Q n- Q Q ALU Slice ALU Slice ALU Slice ALU Slice ALU control n- n- n- n- CPS 4 6
14 Astrction: The ALU Generl structure Two opernd inputs Control inputs ALU Opertion Input A Input B ALU Zero Result Overflow Crry Out CPS 4 7 The Shift Opertion Consider n 8-it mchine How do I implement the shift opertion? CPS 4 8
15 Shifter Shift- Shift- Shift-4 Q7 Q6 Q5 Q4 Q3 Q Q Q CPS 4 9 Summry thus fr Given Boolen function, generte circuit tht relizes the function. Constructed circuits tht cn dd nd sutrct. The ALU: circuit tht cn dd, sutrct, detect overflow, compre, nd do it-wise opertions (AND, OR, NOT) Shifter Next up: Storge Elements: Registers, Ltches, Buses CPS 4 3
Today s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued)
Tod s Lecture Bsics of Logic Design: Boolen Alger, Logic Gtes Alvin R. Leeck CPS 4 Lecture 8 Homework #2 Due Ferur 3 Outline Review (sseml recursion) Building the uilding locks Logic Design Truth tles,
More informationCourse Administration
/4/7 Spring 7 EE 363: Computer Orgniztion Arithmetic for Computers Numer Representtion & ALU Avinsh Kodi Deprtment of Electricl Engineering & Computer Science Ohio University, Athens, Ohio 457 E-mil: kodi@ohio.edu
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationConcepts Introduced. A 1-Bit Logical Unit. 1-Bit Half Adder (cont.) 1-Bit Half Adder
oncepts Introduced A -Bit Logicl Unit sic rithmetic/logic unit clocks ltches nd ip-ops registers SRAMs nd RAMs nite stte mchines Below is -it logicl unit tht performs AN nd OR opertions Both the AN nd
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationDescribing Combinational circuits in BSV
Decriing Comintionl circuit in BSV Arvind Computer Science & Artificil Intelligence L. Mchuett Intitute of Technology Ferury 13, 2018 http://cg.cil.mit.edu/6.s084 L03-1 Three imple comintionl circuit NOT
More informationCS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras
CS 3 : Computer Systems - II Shnkr Blchndrn (shnkr@cse.iitm.c.in) Dept. of Computer Science & Engineering IIT Mdrs Recp Differentite Between s nd s Truth Tbles b AND b OR NOT September 4, 27 Introduction
More informationLecture Topics. Announcements. Today: Integer Arithmetic (P&H ) Next: continued. Consulting hours. Introduction to Sim. Milestone #1 (due 1/26)
Lecture Topics Today: Integer Arithmetic (P&H 3.1-3.4) Next: continued 1 Announcements Consulting hours Introduction to Sim Milestone #1 (due 1/26) 2 1 Overview: Integer Operations Internal representation
More information10/9/2012. Operator is an operation performed over data at runtime. Arithmetic, Logical, Comparison, Assignment, Etc. Operators have precedence
/9/22 P f Performing i Si Simple l Clcultions C l l ti with ith C#. Opertors in C# nd Opertor Precedence 2. Arithmetic Opertors 3. Logicl Opertors 4. Bitwise Opertors 5. Comprison Opertors 6. Assignment
More information6/23/2011. Review: IEEE-754. CSE 2021: Computer Organization. Exercises. Examples. Shakil M. Khan (adapted from Profs. Roumani & Asif)
6/23/2 CSE 22: Computer Orgniztion Lecture-8() Floting point computing (IEEE 754) Review: IEEE-754 single: 8 its doule: its single: 23 its doule: 52 its S Exponent Frction S x ( ) ( Frction) 2 (Exponent
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationLists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
More informationLAB L Hardware Building Blocks
LAB L Hrdwre Building Blocks Perform the following groups of tsks: LL1.v 1. In previous l we creted the 2-to-1 mux shown in the left prt of the figure elow nd found tht it cts s n if sttement. c c 0 1
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationVirtual Machine (Part I)
Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More information5 Regular 4-Sided Composition
Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationCMU Fall VLSI CAD
CMU Fll 01 18-760 VLSI CAD [120 pts] Homework 2. Out Thu Sep 13, Due Thu Sep 27 01. 1. BDD ordering [10 pts] We sw tht vrible order is highly significnt for something s simple s multiplexor. How bout something
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationRegister Transfer Language and Microoperations (Part 2)
Register Transfer Language and Microoperations (Part 2) Adapted by Dr. Adel Ammar Computer Organization 1 MICROOPERATIONS Computer system microoperations are of four types: Register transfer microoperations
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationCS 31: Intro to Systems Digital Logic
CS 3: Intro to Systems Digital Logic Martin Gagné Swarthmore College January 3, 27 You re going to want scratch papr today borrow some if needed. Quick nnouncements Late Policy Reminder 3 late days total
More informationALU Design. 1-bit Full Adder 4-bit Arithmetic circuits. Arithmetic and Logic Unit Flags. Add/Subtract/Increament/Decrement Circuit
LU Design -bit Full dder 4-bit rithmetic circuits dd/subtract/increament/decrement Circuit rithmetic and Logic Unit Flags Carry-Out, Sign, Zero, Overflow Shift and Rotate t Operations COE2 (Fall27) LU
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationIntroduction to hardware design using VHDL
Introuction to hrwre esign using VHDL Tim Güneysu n Nele Mentens ECC school Novemer 11, 2017, Nijmegen Outline Implementtion pltforms Introuction to VHDL Hrwre tutoril 1 Implementtion pltforms Microprocessor
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationLecture Topics. Announcements. Today: Integer Arithmetic (P&H ) Next: The MIPS ISA (P&H ) Consulting hours. Milestone #1 (due 1/26)
Lecture Topics Today: Integer Arithmetic (P&H 3.1-3.4) Next: The MIPS ISA (P&H 2.1-2.14) 1 Announcements Consulting hours Milestone #1 (due 1/26) Milestone #2 (due 2/2) 2 1 Review: Integer Operations Internal
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationHow to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
More informationParallel logic circuits
Computer Mathematics Week 9 Parallel logic circuits College of Information cience and Engineering Ritsumeikan University last week the mathematics of logic circuits the foundation of all digital design
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationComputer Architecture and Organization: L04: Micro-operations
Computer Architecture and Organization: L4: Micro-operations By: A. H. Abdul Hafez Abdul.hafez@hku.edu.tr, ah.abdulhafez@gmail.com, hafez@research.iiit.ac.in 1 Outlines 1. Arithmetic microoperation 2.
More informationDigital Design. Chapter 6: Optimizations and Tradeoffs
Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationECE468 Computer Organization & Architecture. The Design Process & ALU Design
ECE6 Computer Organization & Architecture The Design Process & Design The Design Process "To Design Is To Represent" Design activity yields description/representation of an object -- Traditional craftsman
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationBUILDING BLOCKS OF A BASIC MICROPROCESSOR. Part 1 PowerPoint Format of Lecture 3 of Book
BUILDING BLOCKS OF A BASIC MICROPROCESSOR Part PowerPoint Format of Lecture 3 of Book Decoder Tri-state device Full adder, full subtractor Arithmetic Logic Unit (ALU) Memories Example showing how to write
More informationMisrepresentation of Preferences
Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationChapter 1: Boolean Logic Boolean Logic 1
Chpter 1: Boolen Logic 1 1. Boolen Logic 1 Such simple things, And we mke of them something so complex it defets us, Almost. (John Ashery, Americn poet, 1927-) Every digitl device e it personl computer,
More informationECE 2030B 1:00pm Computer Engineering Spring problems, 5 pages Exam Two 10 March 2010
Instructions: This is a closed book, closed note exam. Calculators are not permitted. If you have a question, raise your hand and I will come to you. Please work the exam in pencil and do not separate
More informationECE 448 Lecture 3. Combinational-Circuit Building Blocks. Data Flow Modeling of Combinational Logic
ECE 448 Lecture 3 Combinational-Circuit Building Blocks Data Flow Modeling of Combinational Logic George Mason University Reading Required P. Chu, FPGA Prototyping by VHDL Examples Chapter 3, RT-level
More informationComputer Organization and Levels of Abstraction
Computer Organization and Levels of Abstraction Announcements Today: PS 7 Lab 8: Sound Lab tonight bring machines and headphones! PA 7 Tomorrow: Lab 9 Friday: PS8 Today (Short) Floating point review Boolean
More informationECE 448 Lecture 3. Combinational-Circuit Building Blocks. Data Flow Modeling of Combinational Logic
ECE 448 Lecture 3 Combinational-Circuit Building Blocks Data Flow Modeling of Combinational Logic George Mason University Reading Required P. Chu, FPGA Prototyping by VHDL Examples Chapter 3, RT-level
More informationIntegration. October 25, 2016
Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve
More informationUNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES
UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not
More informationDigital Design. Chapter 4: Datapath Components
Digitl Design Chpter 4: Dtpth Components Slides to ccompny the textbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com Copyright
More informationChapter 3 Arithmetic for Computers
Chapter 3 Arithmetic for Computers 1 Arithmetic Where we've been: Abstractions: Instruction Set Architecture Assembly Language and Machine Language What's up ahead: Implementing the Architecture operation
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationCS2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014
CS DIGITAL LOGIC & STATE MACHINE DESIGN SPRING DUE : April 7, HOMEWOR V READ : Relted portions of Chpters III, IV, VI, VII nd VIII ASSIGNMENT : There re seven questions Solve ll homework nd exm problems
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationRegister Transfer Level (RTL) Design
CSE4: Components nd Design Techniques for Digitl Systems Register Trnsfer Level (RTL) Design Tjn Simunic Rosing Where we re now Wht we hve covered lst time: Register Trnsfer Level (RTL) design Wht we re
More informationLecture 6: Signed Numbers & Arithmetic Circuits. BCD (Binary Coded Decimal) Points Addressed in this Lecture
Points ddressed in this Lecture Lecture 6: Signed Numbers rithmetic Circuits Professor Peter Cheung Department of EEE, Imperial College London (Floyd 2.5-2.7, 6.1-6.7) (Tocci 6.1-6.11, 9.1-9.2, 9.4) Representing
More informationVirtual Machine I: Stack Arithmetic
Virtul Mchine I: Stck Arithmetic Building Modern Computer From First Principles www.nnd2tetris.org Elements of Computing Systems, Nisn & Schocken, MIT Press, www.nnd2tetris.org, Chpter 7: Virtul Mchine
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationECE 2020B Fundamentals of Digital Design Spring problems, 6 pages Exam Two Solutions 26 February 2014
Problem 1 (4 parts, 21 points) Encoders and Pass Gates Part A (8 points) Suppose the circuit below has the following input priority: I 1 > I 3 > I 0 > I 2. Complete the truth table by filling in the input
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationCMSC 331 First Midterm Exam
0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete
More informationREGISTER TRANSFER AND MICROOPERATIONS
1 REGISTER TRANSFER AND MICROOPERATIONS Register Transfer Language Register Transfer Bus and Memory Transfers Arithmetic Microoperations Logic Microoperations Shift Microoperations Arithmetic Logic Shift
More informationREGISTER TRANSFER AND MICROOPERATIONS
REGISTER TRANSFER AND MICROOPERATIONS Register Transfer Language Register Transfer Bus and Memory Transfers Arithmetic Microoperations Logic Microoperations Shift Microoperations Arithmetic Logic Shift
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationEECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining
EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more
More informationCombinational Circuits
Combinational Circuits Q. What is a combinational circuit? A. Digital: signals are or. A. No feedback: no loops. analog circuits: signals vary continuously sequential circuits: loops allowed (stay tuned)
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More information6. Combinational Circuits. Building Blocks. Digital Circuits. Wires. Q. What is a digital system? A. Digital: signals are 0 or 1.
Digital Circuits 6 Combinational Circuits Q What is a digital system? A Digital: signals are or analog: signals vary continuously Q Why digital systems? A Accurate, reliable, fast, cheap Basic abstractions
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More informationComputer Organization and Levels of Abstraction
Computer Organization and Levels of Abstraction Announcements PS8 Due today PS9 Due July 22 Sound Lab tonight bring machines and headphones! Binary Search Today Review of binary floating point notation
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationCS 31: Intro to Systems Digital Logic. Kevin Webb Swarthmore College February 3, 2015
CS 31: Intro to Systems Digital Logic Kevin Webb Swarthmore College February 3, 2015 Reading Quiz Today Hardware basics Machine memory models Digital signals Logic gates Circuits: Borrow some paper if
More informationDigital Design. Chapter 1: Introduction. Digital Design. Copyright 2006 Frank Vahid
Chpter : Introduction Copyright 6 Why Study?. Look under the hood of computers Solid understnding --> confidence, insight, even better progrmmer when wre of hrdwre resource issues Electronic devices becoming
More information