The Complexity of Nonrepetitive Coloring
|
|
- Alexandrina Hampton
- 5 years ago
- Views:
Transcription
1 The Complexity of Nonrepetitive Coloring Dániel Mrx Institut für Informtik Humoldt-Universitt zu Berlin Mrcus Schefer Deprtment of Computer Science DePul University Astrct A coloring of grph is nonrepetitive if the grph contins no pth tht hs color pttern of the form xx (where x is sequence of colors). We show tht determining whether prticulr coloring of grph is nonrepetitive is conp-hrd, even if the numer of colors is limited to four. The prolem ecomes fixed-prmeter trctle, if we only exclude colorings xx up to fixed length k of x. 1 Squres nd Nonrepetitive Colorings In 1906 Axel Thue pulished his pper Üer unendliche Zeichenreihen which showed the remrkle result tht there is n infinite word over the lphet Σ = {0,1,2} tht does not contin squre, nmely suword of the form xx: Remrkle, ecuse over inry lphet there re only six squrefree words: 0, 1, 01, 10, 010, 101. Remrkle lso, ecuse it is rre instnce of pttern voidnce theorem: counter-exmple to Rmsey theory pulished when Rmsey ws three yers old. Thue s result points in two directions: the study of ptterns in words nd the study of repetition. Comintorics on words hs ecome n ctive reserch field, not lest through its importnce to computer science [11, 12, 13]. In this pper we wnt to follow the second direction studying repetition in structures more generl thn words. There re recent surveys y Grytczuk [8] nd Currie [4] on voiding repetition in vrious res of mthemtics including grph theory, geometry, nd numer theory. One nturl generliztion of word is circulr words, tht is, word whose lst letter is djcent to its first letter. Currie [4] showed tht there re 1
2 squre-free circulr words of every length n 18 on the lphet {0, 1, 2}. Currie s result cn e rephrsed s sying tht the cycle C n on n 18 vertices cn e colored using 3 colors so tht no supth of C n hs coloring of the form xx. We cll such coloring nonrepetitive. The coloring point of view ws introduced y Alon, Grytczuk, H luszczk, nd Riordn in 2002 pper [1], which lso contined the definition of the Thue numer of grph, π(g), s the smllest numer of colors needed in nonrepetitive coloring of G. In this terminology, Currie proved tht π(c n ) = 3 for n 18. Mny prolems relted to the Thue numer re still open. For exmple, it is not yet known whether π(g) is ounded y some constnt for ll plnr grphs G, prticulrly intriguing prolem. Kündgen nd Pelsmjer [10] showed tht grphs of treewidth t most k hve Thue numer t most 4 k, settling the specil cse of outerplnr grphs. It is lso true tht π(g) 36 2, s ws shown y Alon, Grytczuk, H luszczk, nd Riordn [1]. It is lso known tht every grph hs sudivision whose Thue numer is t most 4 (shown y Gryztcuk [7] for 5 nd Brát nd Wood for 4 [7, 9]). We look t the Thue numer from the point of view of computtionl complexity. Deciding whether π(g) k is n -question: is there coloring such tht no supth of the grph hs squre coloring. Deciding question of this form elongs to the complexity clss Σ p 2 = NPNP, the second level of the polynomil-time hierrchy (see [14] for more informtion on the polynomil-time hierrchy). We conjecture tht the Thue numer prolem is complete for tht clss. As first result towrds settling this conjecture we show in Section 2 tht determining whether given coloring of grph is nonrepetitive is conp-complete (in other words, deciding whether coloring is repetitive is NP-complete). Indeed, the prolem remins conp-complete even when restricted to four colors, s we show in Section 3. As n illustrtion of our technique, we otin new proof of the Gryztcuk-Brát-Wood result tht every grph hs sudivision with Thue numer t most 4. Since deciding whether two-coloring of grph is nonrepetitive is trivil, this rises the question of how hrd it is to determine whether coloring of grph with three colors is nonrepetitive. This prolem looks difficult; for exmple, y Currie s result, we cn tke word w tht is squre-free s circulr word of ny length n 18. Then pth of length 2n with coloring ww is not squre-free, ut we hve to look t lock of length n to find this out. This exmple suggests studying nonrepetitiveness with restricted locklengths. Let π k (G) e the smllest numer of colors in coloring of G which 2
3 does not contin pth of length t most 2k with repetitive coloring. This is nturl prmeteriztion of the prolem, π 1 (G) equls the chromtic numer of G, nd π 2 (G) is the str-chromtic numer of G, introduced y Vince [15]. We complement the result tht deciding the nonrepetitiveness of coloring is conp-hrd, y showing how to decide in time k O(k) n 5 log n whether coloring of grph on n vertices contins pth of length t most 2k with repetitive coloring. Using the terminology of prmeterized complexity [5, 6], for ounded lock-lengths, nonrepetitiveness of coloring is fixedprmeter trctle: the exponent of the polynomil running time does not depend on the prmeter k. 2 Nonrepetitiveness of Coloring A word x is squre if x = ww for some word w. A word is nonrepetitive if it does not contin squre s suword. A repetitive sequence in grph with vertex-coloring is pth in the grph whose coloring, s red long the pth, is squre. A grph coloring is nonrepetitive if it does not contin repetitive sequence. Theorem 2.1 Deciding whether coloring of grph is nonrepetitive is conp-complete. Proof We reduce from the Hmiltonin Pth prolem. Let G = (V,E) e grph with V = {v 1,...,v n }. We construct grph H nd coloring tht is nonrepetitive if nd only if G does not hve Hmiltonin pth. The grph H consists of two prts. In the first prt, for ech v i tke K 2,n nd color the two element prtition using colors nd, nd the n-element prtition using colors c i,j (for 1 j n). Next, for every i j we introduce new vertex colored d i,j nd connect it to the vertex of the K 2,n elonging to v i nd the vertex elonging to v j. Also, we connect ll the vertices colored to new vertex colored c. We construct the second prt of H s follows: for ech 1 i,j n, we tke pth P i,j on three vertices, coloring the vertices on P i,j y,c i,j,. We connect the vertex colored y c to the vertices of the pths P i,1 (1 i n). For every P i,j (1 i n, 1 j < n) nd every edge v i v i E we dd new vertex of color d i,i nd connect it to the vertex of P i,j nd the vertex of P i,j+1. Finlly, we connect ll the -vertices of P i,n to new vertex colored c (1 i n). This finishes the construction of H nd its coloring (for n exmple see Figure 1, where G is the dimond, i.e. K 4 e). We clim tht G contins 3
4 c 1,1 c 1,2 c 1,3 c 1,4 d 1,2 d1,3 d 1,4 c 2,1 c 2,2 c 2,3 c 2,4 d 2,1 d 2,4 d 2,3 c 1,1 c 2,1 d 2,1 d 1,2 d 1,3 d 1,4 c 1,2 c 2,2 d 1,2 d 2,1 d 1,3 d 1,4 c 1,3 c 2,3 d 1,2 d 2,1 d 1,3 d 1,4 c 1,4 c 2,4 c 3,1 c 3,2 c 3,3 d 3,2 c d 3,1 c 3,1 d 2,3 d 3,1 d 3,2 c 3,2 d 2,3 d 3,1 d 3,2 c 3,3 d 2,3 d 3,1 d 3,2 c 3,4 c c 3,4 d 3,4 d 3,4 d 3,4 d 3,4 c 4,1 c 4,1 d 4,1 c 4,2 d 4,1 c 4,3 d 4,1 c 4,4 c 4,2 c 4,3 d 4,3 d 4,2 d 4,1 d 4,3 d 4,3 d 4,3 c 4,4 Figure 1: The grph H corresponding to the grph ({1, 2, 3, 4}, {{1,2},{1,3},{1,4},{2, 3},{3,4}}). Hmiltonin pth if nd only if the coloring of H we constructed is repetitive. This implies tht deciding the nonrepetitiveness of grph coloring is conpcomplete. To prove the clim, let us first ssume tht G hs Hmiltonin pth v π(1),...,v π(n). Consider the following pth through H: we strt t the K 2,n ssocited with v π(1), trversing it so we see colors,c π(1),1,. We continue vi the vertex colored d π(1),π(2) to the K 2,n ssocited with v π(2), trversing it s,c π(2),2,, etc. until we rech the vertex in the K 2,n elonging to v π(n). We then continue to the vertex colored c, nd trverse the second hlf of H s follows: P π(1),1, vertex colored d π(1),π(2), P π(2),2, vertex colored d π(2),π(3), etc. finishing with P π(n),n nd the vertex colored c. Since v π(1),...,v π(n) is Hmiltonin pth, this trversl of H is possile, nd, compring the 4
5 colors in the two hlves of H, we see tht they re the sme, nd, therefore, the coloring is repetitive. For the reverse direction, ssume tht H contins pth P such tht the colors long P re of the form ww for some word w. Let us first suppose tht w does not contin the color c. Then P is entirely contined within the first or the second hlf of H. In either cse we cn rgue tht no repetition is possile, since ll the colors except nd re unique nd vertices with colors nd re not djcent. We cn therefore ssume tht w contins c. Consequently, P must contin oth vertices z,z colored c (let z e the vertex connecting the two hlves). Without loss of generlity, we cn ssume tht P strts in the first hlf of H, nd thus there re pths Q,Q, nd Q such tht P = QzQ z Q. The first vertex of Q hs color, while ll neighors of z hve color, which mens tht Q is empty, nd, therefore, P = QzQ z. Let m e the numer of vertices in Q hving some color c i,j ; then m n nd Q hs t lest 4n 1 vertices. On the other hnd, Q cn contin t most 4n vertices of which t most n cn hve some color c i,j ; therefore, m = n, nd Q nd Q hve length 4n 1. Since Q hs length 4n 1, for every i there is j such tht c i,j occurs on Q. Similrly, long Q there is for every j n i such tht c i,j occurs on Q. In other words, there is permuttion π such tht c π(j),j occurs on Q. By the construction of the second hlf of H, v π(1),...,v π(n) is Hmiltonin pth of G. We note tht the proof used n unounded numer of colors to chieve the coding. This cn e remedied s we will see in the next section. 3 The Cse of 4 Colors We reduce the numer of colors y replcing colors with long nonrepetitive sequences on fixed set of colors. As n illustrtion, we first prove simple grph-theoretic result. Proposition 3.1 (Grytczuk, Brát nd Woods) Every grph hs sudivision which cn e nonrepetitively colored with t most 4 colors. Remrk Grytczuk [7] proved tht every grph hs sudivision which cn e colored with t most 5 colors; Brát nd Woods improved his result to 4 colors [9]. Our construction is closer in spirit to Grytczuk s originl proof. The following lemm constructs fmily of nonrepetitive sequences with useful properties. We write x R for the reverse of the sequence x. 5
6 Lemm 3.2 We cn in polynomil time construct m nonrepetitive sequences of length O(m) on colors 1, 2 nd 3 so tht (i) for ny two sequences x nd y, if we split ech sequence into two hlves of equl length, x = x 1 x 2 nd y = y 1 y 2, then x i y i nd x i y R 3 i (for i = 1,2), (ii) ll sequences egin 31 nd end 13, nd (iii) ll sequences hve the sme length. To see tht the lemm is true, tke nonrepetitive sequence x of length 1764m+13 nd permute the colors so it strts with 31. We clim tht every suword of 14 letters hs to contin the sequences 13 nd 31, clim we will verify lter. So if we let x i e the suword of x tht strts with the i-th 31 in x, nd ends with the first 13 t lest 1176m 1 positions lter, we know tht 1176m x i 1176m In this fshion we cn pick 42m sequences x i from x (1 i 42m), since x 42m ends no lter thn position 42m m + 13 = 1764m Note tht ny two of these sequences y nd z overlp in t lest 588m + 13 positions in x, ecuse x 42m must contin position 14 (42m 1) + 1 = 588m 13 nd x 1 ends no erlier thn position 1176m, so there is string of length 588m + 13 common to ll x i ). Since y nd z hlf length t most 1176m + 13 the overlp of length t lest 588m + 13 etween them forces their first hlves, s well s their second hlves to overlp. Therefore, the first hlves of y nd z must differ from ech other, s must the second hlves (otherwise, x would contin squre). Among the 42m sequences, we cn pick 3m sequences of the sme length. While it is possile tht for two of these sequences y nd z, the first hlf of y equls the reverse of the second hlf of z, it is not possile tht the first hlf of y equls the reverse of the second hlf of two other sequences z nd z, since in tht cse the second hlves of z nd z would e identicl, which we excluded. Similrly, the second hlf of y cn e equl to the reverse of t most one other sequence. Hence we cn pick m = 3m/3 sequences fulfilling condition (i). We re left with the proof of the clim tht ny nonrepetitive sequence of length 14 contins the susequence 13, nd, consequently, every other two-digit susequence. So let x e nonrepetitive 14-digit string over the lphet {1,2,3}. A 1 must occur within the first four digits of x. If tht 1 is followed y 3 we re done, so we know tht there is sequence 12 strting within the first four positions of x. Suppose tht sequence continued with 1, i.e. we see 121. Then the next digit cnnot e 2 gin, so we hve 1213, 6
7 nd, therefore, 13 within the first seven digits of x. In other words, we know tht there is sequence 123 strting within the first four positions of x. There re two cses: suppose the next digit fter 123 is 1, i.e. we hve 1231, the next digit hs to e 2 (otherwise we hve 13), followed y 1 (since the word is nonrepetitive): The next digit cnnot e 2, since the word is nonrepetitive, so it hs to e 3 nd we re done, since we hve found 13 within the first nine positions of x. In the second cse, we hve To void repetition, this sequence needs to continue If the next digit is 3, we re done, so we cn ssume we see , which cnnot e followed y 1 (repetition), so we hve , which cnnot e followed y 2 (repetition), giving us followed y 2 (otherwise we hve 13), followed y 1 (repetition), yielding Finlly, this string cnnot e followed y 2, so we see , which mens 13 within x. Proof of Proposition 3.1 It is enough to prove the theorem for the cse G = K n. Let (x i ) m i=1 e fmily of m = ( n 2) nonrepetitive sequences s descried in Lemm 3.2. Replce the i-th edge of G with pth of length x i +7 nd color it 210x i 012. Also, give ech vertex of G color 0. We clim tht this coloring of sudivision G of G is nonrepetitive. Suppose, to the contrry, tht G contins pth P with coloring of the form ww. P hs to contin the color 0, since otherwise ww would e suword of some x i which is not possile (s the x i s re nonrepetitive). There re two types of vertices colored 0: the vertices of G, ll of whose neighors re colored 2, nd the vertices introduced in the sudivision, ll of whose neighors re colored 1 nd 3. Hence, for repetition, P must contin two vertices colored 0 of the sme type, nd tht is only possile if P contins whole pth Q etween two vertices of G. It is not possile tht the coloring of Q is suword of w, since the colorings of the pths (nd their reverses) re unique. Hence, Q must contin the order etween the two hlves of P. In other words, ww hs to contin the following string: 0210v0120, where v = x i for some i (if v = x R i we reverse P), nd the oundry of ww occurs within v. Assuming tht the oundry occurs in the second hlf of v (the other cse eing similr), the first hlf of v must coincide with the prefix or the reverse of suffix of some other x j. This possiility, however, we excluded y the choice of sequences. Corollry 3.3 Deciding whether coloring of grph is nonrepetitive is conp-complete even for colorings with t most 4 colors. 7
8 Proof We will show how to replce the colors in the grph H constructed in the proof of Theorem 2.1 with just 4 colors. Using Lemm 3.2 we otin sequences x i, one for ech of the colors c, c k,j, nd d k,j. If vertex hs color c k,j or d k,j, nd it hs een ssigned sequence x i, replce the vertex with pth of length x i + 7 nd color it 210x i 012. For the two vertices colored c, we proceed similrly, ut in this cse the vertex is replced with pth colored 130x i 031; cll the two pths replcing the c vertices C nd C (where C is the pth connecting the two hlves of G). Finlly, recolor vertices with colors or to hve color 0. This construction uses colors 0,1,2,3 only. We clim tht the coloring of the resulting grph will e nonrepetitive if nd only if the originl grph G did not hve Hmiltonin pth. The proof of one direction remins unchnged: Hmiltonin pth in G still corresponds to repetitive coloring, since we just replced colors y color sequences. Suppose then tht G contins pth P colored ww. As we rgued erlier, P hs to contin the color 0, since otherwise ww would e suword of some x i, which is nonrepetitive. We hve four types of vertices colored 0: those with neighors 1,3, those with neighors 1,2, those with two neighors colored 2 nd those with two neighors colored 3. Let us look t the lst type first. Suppose P does not contin the sequence 303 (which occurs exctly four times: twice on ech of the pths replcing c. In tht cse P cnnot trverse C (or C ), nd is therefore cught within one of the two hlves of G. We clim tht this is impossile. First of ll, oserve tht P does hve to contin t lest one vertex from C or C, since otherwise we rgue s in the proof of Proposition 3.1 tht the two hlves of the grph otined y removing C nd C do not contin squre. (Tht prt of the proof of Theorem 2.1 did not use the fct tht nd re different colors.) Suppose then tht P contins exctly one vertex from C or C. Tht vertex must e one of the end-vertices of C or C colored 1. Then P must contin the sequence 201. If P lies in the left hlf of G, it cn contin t most one 201 (since ll occurrences of 201 overlp in the 1). Hence, the middle of P hs to occur either t 2 01 or In the first cse, P must contin two 010, which is impossile, in the lter cse it hs to contin two 102, which is lso impossile. If P lies in the right hlf, the rgument is similr: there hs to e n occurrence of 201. To mtch it either s 201 or 2 01 or 20 1, the pth P needs to contin vertices from oth C nd C, implying tht ww contins string of the form 210x i 012. As we rgued in Proposition 3.1 this is impossile y the construction of the x i. 8
9 Consequently, P must contin t lest two vertices from C or C ; since we ssumed tht it does not contin 303, P must end, or egin, in C or C with 013 or Both sequences, however, do not occur second time in hlf without overlpping the erlier occurrence, so this is not possile. We conclude tht P must contin the sequence 303. This sequence occurs exctly four times, twice in C nd C. The two occurrences in the sme pth C or C cnnot mtch with ech other, since one egins 3031x i, nd the other (nd the x i s do not contin zeroes). Hence 303 from C must mtch with 303 from C. But then either ll of C or ll of C, nd therefore oth must elong to P. From this point on, we cn rgue s in the originl proof. 4 Bounded-Length Sequences Checking whether coloring of grph is nonrepetitive for lock-lengths up to some fixed vlue k cn e done in polynomil time: we hve to check ll the O(n 2k ) pths of length t most 2k. Here we present n lgorithm tht is significntly more efficient thn rute force: we show tht the prolem is fixed-prmeter trctle, i.e., it cn e solved in time O(f(k)n c ). This mens tht the exponent of n does not increse s k increses. Theorem 4.1 Given vertex-colored grph G(V, E), it cn e checked in time k O(k) V 5 log V whether G hs repetitive sequence of length 2k. Proof The lgorithm is sed on color-coding, introduced y Alon et l. [2]. Assign rndom lel from {1,...,2k} to ech vertex of G independently with uniform distriution. Assume tht we hve polynomil-time lgorithm for checking whether there is repetitive sequence v 1,..., v 2k where vertex v i hs lel i (elow we will present such n lgorithm). If the grph hs repetitive sequence, then the sequence receives the lels 1,..., 2k with proility 1/(2k) 2k, hence the lgorithm finds such repetitive sequence with proility 1/(2k) 2k. If the grph hs no repetitive sequence, then of course no such sequence is found y the lgorithm. Therefore, the lgorithm produces correct nswer with proility 1/(2k) 2k, which cn e incresed to constnt y repeting the lgorithm (2k) 2k times. Rndomized lgorithms sed on color-coding cn e derndomized using stndrd techniques, see [2] nd [5, Section 8.3]. We still need to show how to check whether there is repetitive sequence v 1,..., v 2k where vertex v i hs lel i. For given leling λ : V {1,..., 2k} of the vertices, we proceed s follows. For given vertex x, the 9
10 lgorithm elow checks whether there is repetitive sequence v 1,..., v 2k where λ(v i ) = i nd v k = x. Therefore, the lgorithm hs to e repeted for every possile choice of x, i.e., V times. We uild directed grph D(U,A) where the U is suset of V V. For v,v V, the pir (v,v ) is vertex of D only if v nd v hve the sme color in G, λ(v ) = λ(v) + k, if λ(v) = k, then v = x, nd if λ(v ) = k + 1, then v is neighor of x in G. There is n rc from (v,v ) to (u,u ) in D if nd only if u is neighor of v, u is neighor of v, nd λ(u) = λ(v) + 1. Note tht, y the properties of the vertices in D, the lst requirement lso implies λ(u ) = λ(v ) + 1. It is esy to see tht D is cyclic, hence the length of the longest directed pth cn e determined in time O( A ) using stndrd techniques. We clim tht D hs directed pth on k vertices if nd only if G hs repetitive sequence on 2k vertices. Indeed, if (v 1,v 1 ), (v 2,v 2 ),..., (v k,v k ) is directed pth in D, then v 1,..., v k, v 1,..., v k is pth in G. Notice tht the i-th vertex of the pth in G hs lel i, thus vertex cnnot pper twice in the sequence. Furthermore, v i nd v i hve the sme color in G, hence the pth is repetitive. The converse sttement is lso esy to see: if v 1,..., v 2k is repetitive sequence such tht λ(v i ) = i nd v k = x, then the vertices (v 1,v k+1 ), (v 2,v k+2 ),..., (v k,v 2k ) exist in D nd they form directed pth. The directed grph D contins t most V 2 vertices nd hence t most V 4 edges. Finding the longest pth in the cyclic grph D cn e done in liner time. The lgorithm hs to e repeted for every possile vertex x, thus the running time is V 5 for given leling. The derndomiztion dds fctor O(log V ) to the running time. The cse k = 2 is of specil interest. Grphs tht do not hve repetitive sequences of length t most 4 re often clled str-free or pthic. For pthic coloring, the complexity of the coloring prolem is settled: 10
11 Proposition 4.2 (Colemn, Moré [3]) Deciding whether grph hs str-free coloring with three colors is NP-complete, even if the grph is iprtite. The proof is quite simple: replce ech edge of grph G with three pths of length 2. Then the originl grph is 3-colorle, if nd only if the resulting (iprtite) grph hs str-free 3-coloring. The result ws proved y Colemn nd Moré in the context of computing sprse Hessin mtrices. Acknowledgments We would like to thnk Michel Pelsmjer for crefully reviewing nd discussing the proofs nd mking severl helpful suggestions. References [1] Nog Alon, Jros lw Grytczuk, Mriusz H luszczk, nd Oliver Riordn. Nonrepetitive colorings of grphs. Rndom Structures Algorithms, 21(3-4): , Rndom structures nd lgorithms (Poznn, 2001). [2] Nog Alon, Rphel Yuster, nd Uri Zwick. Color-coding. J. Assoc. Comput. Mch., 42(4): , [3] Thoms F. Colemn nd Jorge J. Moré. Estimtion of sprse Hessin mtrices nd grph coloring prolems. Mth. Progrmming, 28(3): , [4] Jmes D. Currie. Pttern voidnce: themes nd vritions. Theoret. Comput. Sci., 339(1):7 18, [5] R. G. Downey nd M. R. Fellows. Prmeterized complexity. Monogrphs in Computer Science. Springer-Verlg, New York, [6] Jrg Flum nd Mrtin Grohe. Prmeterized Complexity Theory. Springer-Verlg, Berlin, [7] Jros lw Grytczuk. Nonrepetitive grph coloring. unpulished mnuscript, [8] Jros lw Grytczuk. Thue type prolems for grphs, points, nd numers. unpulished mnuscript,
12 [9] Dvid R. Wood János Brát. Notes on nonrepetitive grph coloring. unpulished mnuscript, [10] Andre Kündgen nd Michel J. Pelsmjer. Nonrepetitive colorings of grphs of ounded treewidth. Sumitted to Discrete Mth., [11] M. Lothire. Comintorics on words. Cmridge Mthemticl Lirry. Cmridge University Press, Cmridge, [12] M. Lothire. Algeric comintorics on words, volume 90 of Encyclopedi of Mthemtics nd its Applictions. Cmridge University Press, Cmridge, [13] M. Lothire. Applied comintorics on words, volume 105 of Encyclopedi of Mthemtics nd its Applictions. Cmridge University Press, Cmridge, [14] Mrcus Schefer nd Chris Umns. Completeness in the polynomiltime hierrchy: Prt I: A compendium. SIGACTN: SIGACT News (ACM Specil Interest Group on Automt nd Computility Theory), 33, [15] A. Vince. Str chromtic numer. J. Grph Theory, 12(4): ,
The Complexity of Nonrepetitive Coloring
The Complexity of Nonrepetitive Coloring Dániel Mrx Deprtment of Computer Science nd Informtion Theory Budpest University of Technology nd Econonomics Budpest H-1521, Hungry dmrx@cs.me.hu Mrcus Schefer
More informationF. R. K. Chung y. University ofpennsylvania. Philadelphia, Pennsylvania R. L. Graham. AT&T Labs - Research. March 2,1997.
Forced convex n-gons in the plne F. R. K. Chung y University ofpennsylvni Phildelphi, Pennsylvni 19104 R. L. Grhm AT&T Ls - Reserch Murry Hill, New Jersey 07974 Mrch 2,1997 Astrct In seminl pper from 1935,
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationDefinition of Regular Expression
Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationarxiv: v1 [math.co] 18 Sep 2015
Improvements on the density o miml -plnr grphs rxiv:509.05548v [mth.co] 8 Sep 05 János Brát MTA-ELTE Geometric nd Algeric Comintorics Reserch Group rt@cs.elte.hu nd Géz Tóth Alréd Rényi Institute o Mthemtics,
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationLily Yen and Mogens Hansen
SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationLost in Translation: A Reflection on the Ballot Problem and André's Original Method
Lost in Trnsltion: A Reflection on the Bllot Prolem nd André's Originl Method Mrc Renult Shippensurg University Presented t MthFest August 5, 2007 The Bllot Prolem (1887) In how mny wys cn upsteps nd downsteps
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More information9 Graph Cutting Procedures
9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationTyping with Weird Keyboards Notes
Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationNotes for Graph Theory
Notes for Grph Theory These re notes I wrote up for my grph theory clss in 06. They contin most of the topics typiclly found in grph theory course. There re proofs of lot of the results, ut not of everything.
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationImplementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More informationCSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationON THE DEHN COMPLEX OF VIRTUAL LINKS
ON THE DEHN COMPLEX OF VIRTUAL LINKS RACHEL BYRD, JENS HARLANDER Astrct. A virtul link comes with vriety of link complements. This rticle is concerned with the Dehn spce, pseudo mnifold with oundry, nd
More informationthis grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
More informationOn Approximating Restricted Cycle Covers
On Approximting Restricted Cycle Covers Bodo Mnthey Universität zu Lüeck, Institut für Theoretische Informtik Rtzeurger Allee 160, 23538 Lüeck, Germny mnthey@tcs.uni-lueeck.de Astrct. A cycle cover of
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationSingle-Player and Two-Player Buttons & Scissors Games
Single-Plyer nd Two-Plyer Buttons & Scissors Gmes The MIT Fculty hs mde this rticle openly ville. Plese shre how this ccess enefits you. Your story mtters. Cittion As Pulished Pulisher Burke, Kyle, et
More informationPosition Heaps: A Simple and Dynamic Text Indexing Data Structure
Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationSummer Review Packet For Algebra 2 CP/Honors
Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationInference of node replacement graph grammars
Glley Proof 22/6/27; :6 File: id293.tex; BOKCTP/Hin p. Intelligent Dt Anlysis (27) 24 IOS Press Inference of node replcement grph grmmrs Jcek P. Kukluk, Lwrence B. Holder nd Dine J. Cook Deprtment of Computer
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More informationLR Parsing, Part 2. Constructing Parse Tables. Need to Automatically Construct LR Parse Tables: Action and GOTO Table
TDDD55 Compilers nd Interpreters TDDB44 Compiler Construction LR Prsing, Prt 2 Constructing Prse Tles Prse tle construction Grmmr conflict hndling Ctegories of LR Grmmrs nd Prsers Peter Fritzson, Christoph
More informationEfficient K-NN Search in Polyphonic Music Databases Using a Lower Bounding Mechanism
Efficient K-NN Serch in Polyphonic Music Dtses Using Lower Bounding Mechnism Ning-Hn Liu Deprtment of Computer Science Ntionl Tsing Hu University Hsinchu,Tiwn 300, R.O.C 886-3-575679 nhliou@yhoo.com.tw
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationSome necessary and sufficient conditions for two variable orthogonal designs in order 44
University of Wollongong Reserch Online Fculty of Informtics - Ppers (Archive) Fculty of Engineering n Informtion Sciences 1998 Some necessry n sufficient conitions for two vrile orthogonl esigns in orer
More informationMath 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012
Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl
More informationGeometrical tile design for complex neighborhoods
COMPUTATIONAL NEUROSCIENCE ORIGINAL RESEARCH ARTICLE pulished: 23 Novemer 2009 doi: 103389/neuro100202009 Geometricl tile design for complex neighorhoods Eugen Czeizler* nd Lil Kri Deprtment of Computer
More informationRETRACTS OF TREES AND FREE LEFT ADEQUATE SEMIGROUPS
Proceedings of the Edinurgh Mthemticl Society (2011) 54, 731 747 DOI:10.1017/S0013091509001230 RETRACTS OF TREES AND FREE LEFT ADEQUATE SEMIGROUPS MARK KAMBITES School of Mthemtics, University of Mnchester,
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationTopic 2: Lexing and Flexing
Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationarxiv:math/ v2 [math.co] 28 Feb 2006
Chord Digrms nd Guss Codes for Grphs rxiv:mth/0508269v2 [mth.co] 28 Feb 2006 Thoms Fleming Deprtment of Mthemtics University of Cliforni, Sn Diego L Joll, C 92093-0112 tfleming@mth.ucsd.edu bstrct lke
More informationBasic Geometry and Topology
Bsic Geometry nd Topology Stephn Stolz Septemer 7, 2015 Contents 1 Pointset Topology 1 1.1 Metric spces................................... 1 1.2 Topologicl spces................................ 5 1.3 Constructions
More informationFrom Indexing Data Structures to de Bruijn Graphs
From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,
More informationORDER AUTOMATIC MAPPING CLASS GROUPS. Colin Rourke and Bert Wiest
PACIFIC JOURNAL OF MATHEMATICS ol. 94, No., 000 ORDER AUTOMATIC MAPPING CLASS GROUPS Colin Rourke nd Bert Wiest We prove tht the mpping clss group of compct surfce with finite numer of punctures nd non-empty
More informationTheory of Computation CSE 105
$ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly
More informationHomework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)
Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht
More informationVertex Intersection Graphs of Paths on a Grid
Journl of Grph Algorithms nd Applictions http://jg.info/ vol. 16, no. 2, pp. 129 150 (2012) Vertex Intersection Grphs of Pths on Grid Andrei Asinowski 1 Eld Cohen 2,3 Mrtin Chrles Golumic 2,3 Vincent Limouzy
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationEfficient Algorithms For Optimizing Policy-Constrained Routing
Efficient Algorithms For Optimizing Policy-Constrined Routing Andrew R. Curtis curtis@cs.colostte.edu Ross M. McConnell rmm@cs.colostte.edu Dn Mssey mssey@cs.colostte.edu Astrct Routing policies ply n
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationReducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationDetermining Single Connectivity in Directed Graphs
Determining Single Connectivity in Directed Grphs Adm L. Buchsbum 1 Mrtin C. Crlisle 2 Reserch Report CS-TR-390-92 September 1992 Abstrct In this pper, we consider the problem of determining whether or
More informationThe Math Learning Center PO Box 12929, Salem, Oregon Math Learning Center
Resource Overview Quntile Mesure: Skill or Concept: 80Q Multiply two frctions or frction nd whole numer. (QT N ) Excerpted from: The Mth Lerning Center PO Box 99, Slem, Oregon 9709 099 www.mthlerningcenter.org
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More informationFixed Parameter Algorithms for one-sided crossing minimization Revisited
Fixed Prmeter Algorithms for one-sided crossing minimiztion Revisited Vid Dujmović 1, Henning Fernu 2,3, nd Michel Kufmnn 2 1 McGill University, School of Computer Science, 3480 University St., Montrel,
More information