Dynamic Programming Comp 122, Fall 2004
|
|
- Darleen Blair
- 5 years ago
- Views:
Transcription
1 Dynamic Programming Comp 122, Fall 2004
2 Review: the previous lecture Principles of dynamic programming: optimization problems, optimal substructure property, overlapping subproblems, trade space for time, implementation via bottom-up/memoization. Example of Match Game. Example of Fibinacci: from Divide and Conquer (exponential time complexity) to Dynamic Programming (O(n) time and space), then to more efficient dynamic programming (constant space, O(logn) time) Example of LCS in O(m n) time and space. Today we will show how to reduce the space complexity of LCS to O(n) and in future lectures we will show how to reduce the time complexity of LCS. Comp 122, Spring 2004
3 Longest Common Subsequence Problem: Given 2 sequences, X = x 1,...,x m and Y = y 1,...,y n, find a common subsequence whose length is maximum. X: springtime Comp 122, Spring 2004 Y: printing LCS(X,Y): printi
4 c[, ] 0 c[ prefix, prefix ] 1 max( c[ prefix, ], c[, prefix ]) if if if empty or empty, end( ) end( ), end( ) end( ). Keep track of c[, ] in a table of nm entries: top/down: increasing row order within each row left-to-right: increasing column order p r i n t i n g s p r i n g t i m e Comp 122, Spring 2004
5 c[, ] 0 c[ prefix, prefix ] 1 max( c[ prefix, ], c[, prefix ]) if if if empty or empty, end( ) end( ), end( ) end( ). Time Complexity: O(nm). Space Complexity: O(nm). Can the space complexity be improved if we just compute the length of the LCS and do not need to recover an actual LCS? In this case we only need to compute the alignment score. Can the space complexity be improved and still allow the recovery of an actual LCS? Yes, but for this we will have to address LCS as a longest path problem. p r i n t i n g s p r i n g t i m e Comp 122, Spring 2004
6 Other sequence questions Edit distance: Given 2 sequences, X = x 1,...,x m and Y = y 1,...,y n, what is the minimum number of deletions, insertions, and changes that you must do to change one to another? Protein sequence alignment: Given a score matrix on amino acid pairs, s(a,b) for a,b { } A, and 2 amino acid sequences, X = x 1,...,x m A m and Y = y 1,...,y n A n, find the alignment with lowest score Comp 122, Spring 2004
7 Outline DNA Sequence Comparison: Biological background Sequence Alignment First Biological Success Stories More Grid Graphs: Manhattan Tourist Problem Longest Paths in Grid Graphs Back to Longest Common Subsequence Problem Review: divide and conquer paradigm Reducing the space requirement of LCS
8 Dynamic Programming: String Editing
9 The Central Dogma of Molecular Biology Gene DNA RNA PROTEIN Function > DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGG CAACACTGAGAAAATGGCAGAGCTCATCGCTAAA GGTATCATCGAATCTGGTAAAGACGTCAACACCA TCAACGTGTCTGACGTTAACATCGATGAACTGCT GAACGAAGATATCCTGATCCTGGGTTGCTCTGCC ATGGGCGATGAAGTTCTCGAGGAAAGCGAATTTG > Protein sequence MKIVYWSGTGNTEKMAELIAKGIIES GKDVNTINVSDVNIDELLNEDILILGC SAMGDEVLEESEFEPFIEEISTKISG KKVALFGSYGWGDGKWMRDFEER MNGYGCVVVETPLIVQNEPDEAEQD CIEFGKKIANI
10 The Central Dogma of Molecular Biology Genome: The digital backbone of molecular biology Transcripts from Gene(DNA subsequence) to Proten sequence: Perform functions encoded in the genome
11 The Sequence Alignment Problem A = c t a c g a g a c B = a a c g a c g a t The Scoring Matrix - a c g t a c g t Compare two strings A and B and measure their similarity by finding the optimal alignment between them. The alignment is classically based on the transformation of one sequence into the other, via operations of substitutions, insertions, and deletions (indels). 13
12 Two Sequence Alignment Problems Global Alignment. A = c t a c g a g a c B = a a c g a c g a t Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 14
13 Two Sequence Alignment Problems Global Alignment. A = c t a c g a g a c B = a a c g a c g a t The Scoring Matrix - a c g t a c g t Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 15
14 Two Sequence Alignment Problems Global Alignment. A = c t a c g a g a c B = a a c g a c g a t Value: 2 The Scoring Matrix - a c g t a c g t Local Alignment. A = c t a c g a g a c B = a a c g a c g a t 16
15 Two Sequence Alignment Problems Global Alignment. A = c t a c g a g a c B = a a c g a c g a t Value: 2 The Scoring Matrix - a c g t a c g t Local Alignment. A = c t a c g a g a c B = a a c g a c g a t Value: 5 17
16 2 The O(n ) time, Classical Dynamic Programming Algorithm A = n c t a c c g 5 a g a The Alignment Graph B = n a a c g a c g a t The Scoring Matrix - a c g t a c g t
17 Computing the Optimal Global Alignment Value A = n c t 2 a 3 c a c 1 4 g 5 a g B = n 0 a a c g a c g a t Classical Dynamic Programming: O(n ) 2 Score of = 1 Score of = -1 19
18 Computing an Optimal Local Alignment Value A = n c t a c c g 5 a g a B = n 0 a a c g a c g a t Classical Dynamic Programming: O(n 2 ) Score of = 1 Score of = -1 20
19 DNA Sequence Comparison: First Success Story Finding sequence similarities with genes of known function is a common approach to infer a newly sequenced gene s function In 1984 Russell Doolittle and colleagues found similarities between cancer-causing gene and normal growth factor (PDGF) gene
20 Cystic Fibrosis Cystic fibrosis (CF) is a chronic and frequently fatal genetic disease of the body's mucus glands (abnormally high level of mucus in glands). CF primarily affects the respiratory systems in children. Mucus is a slimy material that coats many epithelial surfaces and is secreted into fluids such as saliva
21 Cystic Fibrosis: Inheritance In early 1980s biologists hypothesized that CF is an autosomal recessive disorder caused by mutations in a gene that remained unknown till 1989 Heterozygous carriers are asymptomatic Must be homozygously recessive in this gene in order to be diagnosed with CF
22 Cystic Fibrosis: Finding the Gene
23 Cystic Fibrosis and the CFTR Protein CFTR (Cystic Fibrosis Transmembrane conductance Regulator) protein is acting in the cell membrane of epithelial cells that secrete mucus These cells line the airways of the nose, lungs, the stomach wall, etc.
24 Mechanism of Cystic Fibrosis The CFTR protein (1480 amino acids) regulates a chloride ion channel Adjusts the wateriness of fluids secreted by the cell Those with cystic fibrosis are missing one single amino acid in their CFTR Mucus ends up being too thick, affecting many organs
25 Cystic Fibrosis and the CFTR Protein CFTR (Cystic Fibrosis Transmembrane conductance Regulator) protein is acting in the cell membrane of epithelial cells that secrete mucus These cells line the airways of the nose, lungs, the stomach wall, etc.
26 Finding Similarities between the Cystic Fibrosis Gene and ATP binding proteins ATP binding proteins are present on cell membrane and act as transport channel In 1989 biologists found similarity between the cystic fibrosis gene and ATP binding proteins A plausible function for cystic fibrosis gene, given the fact that CF involves sweet secretion with abnormally high sodium level
27 Cystic Fibrosis: Mutation Analysis If a high % of cystic fibrosis (CF) patients have a certain mutation in the gene and the normal patients don t, then that could be an indicator of a mutation that is related to CF A certain mutation was found in 70% of CF patients, convincing evidence that it is a predominant genetic diagnostics marker for CF
28 Outline DNA Sequence Comparison: Biological background The Sequence Alignment problem First Biological Success Stories Grid Graphs: Manhattan Tourist Problem Longest Paths in Grid Graphs Back to Longest Common Subsequence Problem Review: divide and conquer paradigm Reducing the space requirement of LCS
29 Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to sink) to travel (only eastward and southward) with the most number of attractions (*) in the Manhattan grid Source * * * * * * * * * * * * Sink
30 Manhattan Tourist Problem (MTP) Imagine seeking a path (from source to sink) to travel (only eastward and southward) with the most number of attractions (*) in the Manhattan grid Source * * * * * * * * * * * * Sink
31 Manhattan Tourist Problem: Formulation Goal: Find the longest (highest scoring) path in a weighted grid. Input: A weighted grid G with two distinct vertices, one labeled source and the other labeled sink Output: A longest path in G from source to sink
32 i coordinate MTP: An Example source j coordinate sink
33 MTP: Greedy Algorithm Is Not Optimal source promising start, but leads to bad choices! sink
34 MTP: Dynamic Programming source j 0 1 i S 0,1 = S 1,0 = 5 Calculate optimal path score for each vertex in the graph Each vertex s score is the maximum of the prior vertices score plus the weight of the respective edge in between
35 MTP: Dynamic Programming (cont d) source j i S 0,2 = S 1,1 = S 2,0 = 8
36 MTP: Dynamic Programming (cont d) source j i S 3,0 = S 1,2 = S 2,1 = S 3,0 = 8
37 MTP: Dynamic Programming (cont d) source j i S 1,3 = S 2,2 = greedy alg. fails! 9 S 3,1 = 9
38 MTP: Dynamic Programming (cont d) source j i S 2,3 = S 3,2 = 9
39 MTP: Dynamic Programming (cont d) source j i Done! (showing all back-traces) S 3,3 = 16
40 MTP: Recurrence Computing the score for a point (i,j) by the recurrence relation: s i, j = max s i-1, j + weight of the edge between (i-1, j) and (i, j) s i, j-1 + weight of the edge between (i, j-1) and (i, j) The running time is n x m for a n by m grid (n = # of rows, m = # of columns)
41 Adding Diagonal Edges to the Grid A 2 A 3 A 1 B What about diagonals? The score at point B is given by: s B = max of s A1 + weight of the edge (A 1, B) s A2 + weight of the edge (A 2, B) s A3 + weight of the edge (A 3, B)
42 Adding Diagonal Edges to the Grid More generally, computing the score for point x is given by the recurrence relation: s x = max of s y + weight of vertex (y, x) where y є Predecessors(x) Predecessors (x) set of vertices that have edges leading to x
43 Traveling in the Grid The only hitch is that one must decide on the order in which visit the vertices By the time the vertex x is analyzed, the values s y for all its predecessors y should be computed otherwise we are in trouble. We need to traverse the vertices in some order Try to find such order for a directed acyclic grid graph???
44 Traversing the Manhattan Grid 3 different strategies: a) Column by column b) Row by row c) Along diagonals a) b) c)
45 Outline DNA Sequence Comparison: Biological background The Sequence Alignment problem First Biological Success Stories Grid Graphs: Manhattan Tourist Problem Generalizing to Longest Paths in Grid Graphs Back to Longest Common Subsequence Problem Review: divide and conquer paradigm Reducing the space requirement of LCS
46 Generalizing to computing longest paths in DAGs: Directed Acyclic Graphs The Manhattan grid is a DAG Exemplify Topological Ordering: DAG for Dressing in the morning problem
47 Topological Ordering A numbering of vertices of the graph is called topological ordering of the DAG if every edge of the DAG connects a vertex with a smaller label to a vertex with a larger label In other words, if vertices are positioned on a line in an increasing order of labels then all edges go from left to right.
48 Topological ordering 2 different topological orderings of the DAG
49 Longest Path in DAG Problem Goal: Find a longest path between two vertices in a weighted DAG Input: A weighted DAG G with source and sink vertices Output: A longest path in G from source to sink
50 Longest Path in DAG: Dynamic Programming Suppose vertex v has indegree k and predecessors {u 1, u 2 u k} Longest path to v from source is: s v = max of su 1 + weight of edge from u 1 to v su 2 + weight of edge from u 2 to v... su k + weight of edge from u 3 to v In General, compute by increasing Topological Order: s v = max (s u + weight of edge from u to v) u є Predecessors(v)
51 Generalizing to Directed Acylclic Grid Graphs Computing the score for point x is given by the recurrence relation: s v = max of s u + weight of vertex (u, v) where u є Predecessors(v) Predecessors (v) set of vertices that have edges leading to v What is the running time for a DAG G(V, E), where V is the set of all vertices and E is the set of all edges? Answer: O(E) since each edge is evaluated once
52 Outline DNA Sequence Comparison: Biological background The Sequence Alignment problem First Biological Success Stories Grid Graphs: Manhattan Tourist Problem Longest Paths in Grid Graphs Back to Longest Common Subsequence Problem Review: divide and conquer paradigm Reducing the space requirement of LCS
53 Edit Graph for LCS Problem j A T C T G A T C i T Every path is a common subsequence. G C A Every diagonal edge adds an extra element to common subsequence T A C LCS Problem: Find a path with maximum number of diagonal edges
54 Alignment: Dynamic Programming s i,j = s i-1, j-1 +1 if v i = w j max s i-1, j +0 s i, j-1 +0 This recurrence corresponds to the Manhattan Tourist problem (three incoming edges into a vertex) with all horizontal and vertical edges weighted by zero and diagonal edges weighted by one.
55 Alignment as a Path in the Edit Graph Every path in the edit graph corresponds to an alignment:
56 Alignment as a Path in the Edit Graph Old Alignment v= AT_GTTAT_ w= ATCGT_A_C New Alignment v= AT_GTTAT_ w= ATCG_TA_C
57 Alignment as a Path in the Edit Graph v= AT_GTTAT_ w= ATCGT_A_C (0,0), (1,1), (2,2), (2,3), (3,4), (4,5), (5,5), (6,6), (7,6), (7,7)
58 Alignment: Dynamic Programming s i,j = s i-1, j-1 +1 if v i = w j max s i-1, j s i, j-1
59 Dynamic Programming Example Initialize 1 st row and 1 st column to be all zeroes. Or, to be more precise, initialize 0 th row and 0 th column to be all zeroes.
60 Dynamic Programming Example S i,j = S i-1, j-1 max S i-1, j S i, j-1 value from NW +1, if v i = w j value from North (top) value from West (left)
61 Dynamic Programming Example A T C G T A C A T G T T A T S i,j = S i-1, j-1 max S i-1, j S i, j-1 value from NW +1, if v i = w j value from North (top) value from West (left)
62 Alignment: Backtracking Arrows from. show where the score originated if from the top if from the left if v i = w j
63 Alignment: Dynamic Programming s i,j = s i-1, j-1 +1 if v i = w j max s i-1, j s i, j-1
64 LCS Algorithm 1. LCS(v,w) 2. for i 1 to n 3. s i, for j 1 to m 5. s 0,j 0 6. for i 1 to n 7. for j 1 to m 8. s i-1,j 9. s i,j max s i,j s i-1,j-1 + 1, if v i = w j 11. if s i,j = s i-1,j b i,j if s i,j = s i,j-1 if s i,j = s i-1,j return (s n,m, b)
65 LCS(v,w) created the alignment grid Now we need a way to read the best alignment of v and w Follow the arrows backwards from sink Now What?
66 Printing LCS: Backtracking 1. PrintLCS(b,v,i,j) 2. if i = 0 or j = 0 3. return 4. if b i,j = 5. PrintLCS(b,v,i-1,j-1) 6. print v i 7. else 8. if b i,j = 9. PrintLCS(b,v,i-1,j) 10. else 11. PrintLCS(b,v,i,j-1)
67 LCS Runtime It takes O(nm) time to fill in the nxm dynamic programming matrix. Why O(nm)? The pseudocode consists of a nested for loop inside of another for loop to set up a nxm matrix. Memory? Naively O(nm) we next show how to reduce it to O(n) by combining divide and conquer with dynamic programming.
68 Outline DNA Sequence Comparison: Biological background The Sequence Alignment problem First Biological Success Stories Grid Graphs: Manhattan Tourist Problem Longest Paths in Grid Graphs Back to Longest Common Subsequence Problem Review: divide and conquer paradigm Reducing the space requirement of LCS
69 Divide & Conquer Algorithms
70 Divide and Conquer Algorithms Divide problem into sub-problems Conquer by solving sub-problems recursively. If the sub-problems are small enough, solve them in brute force fashion Combine the solutions of sub-problems into a solution of the original problem (tricky part)
71 Sorting Problem Revisited Given: an unsorted array Goal: sort it
72 Mergesort: Divide Step Step 1 Divide log(n) divisions to split an array of size n into single elements
73 Mergesort: Conquer Step Step 2 Conquer O(n) O(n) O(n) O(n) logn iterations, each iteration takes O(n) time. Total Time: O(n logn)
74 Mergesort: Combine Step Step 3 Combine arrays of size 1 can be easily merged to form a sorted array of size 2 2 sorted arrays of size n and m can be merged in O(n+m) time to form a sorted array of size n+m
75 Mergesort: Combine Step Combining 2 arrays of size Etcetera
76 Merge Algorithm 1. Merge(a,b) 2. n1 size of array a 3. n2 size of array b 4. a n a n i 1 7. j 1 8. for k 1 to n1 + n2 9. if a i < b j 10. c k a i 11. i i else 13. c k b j 14. j j return c
77 Mergesort: Example Divide Conquer
78 1. MergeSort(c) MergeSort Algorithm 2. n size of array c 3. if n = 1 4. return c 5. left list of first n/2 elements of c 6. right list of last n-n/2 elements of c 7. sortedleft MergeSort(left) 8. sortedright MergeSort(right) 9. sortedlist Merge(sortedLeft,sortedRight) 10. return sortedlist
79 MergeSort: Running Time The problem is simplified to baby steps for the i th merging iteration, the complexity of the problem is O(n) number of iterations is O(log n) running time: O(n logn)
80 Divide and Conquer Approach to LCS Path(source, sink) if(source & sink are in consecutive columns) output the longest path from source to sink else middle middle vertex between source & sink Path(source, middle) Path(middle, sink)
81 Divide and Conquer Approach to LCS Path(source, sink) if(source & sink are in consecutive columns) output the longest path from source to sink else middle middle vertex between source & sink Path(source, middle) Path(middle, sink) The only problem left is how to find this middle vertex!
82 Computing Alignment Path Requires Quadratic Memory Alignment Path Space complexity for computing alignment path for sequences of length n and m is O(nm) We need to keep all backtracking references in memory to reconstruct the path (backtracking) Note that the longest path itself is linear in size. n m
83 Crossing the Middle Line m/2 m We want to calculate the longest path from (0,0) to (n,m) that passes through (i,m/2) where i ranges from 0 to n and represents the i-th row n Prefix(i) Suffix(i) Define length(i) as the length of the longest path from (0,0) to (n,m) that passes through vertex (i, m/2)
84 Crossing the Middle Line m/2 m Prefix(i) n Suffix(i) Define (mid,m/2) as the vertex where the longest path crosses the middle column. length(mid, m/2) = optimal length = max 0 i n length(i)
85 Computing Prefix(i) prefix(i) is the length of the longest path from (0,0) to (i,m/2) Compute prefix(i) by dynamic programming in the left half of the matrix store prefix(i) column 0 m/2 m
86 Computing Suffix(i) suffix(i) is the length of the longest path from (i,m/2) to (n,m) suffix(i) is the length of the longest path from (n,m) to (i,m/2) with all edges reversed Compute suffix(i) by dynamic programming in the right half of the reversed matrix store suffix(i) column 0 m/2 m
87 Length(i) = Prefix(i) + Suffix(i) Add prefix(i) and suffix(i) to compute length(i): length(i)=prefix(i) + suffix(i) You now have a middle vertex of the maximum path (i,m/2) as maximum of length(i) 0 middle point found i 0 m/2 m
88 Finding the Middle Point 0 m/4 m/2 3m/4 m
89 Finding the Middle Point again 0 m/4 m/2 3m/4 m
90 And Again 0 m/8 m/4 3m/8 m/2 5m/8 3m/4 7m/8 m
91 Time = Area: First Pass On first pass, the algorithm covers the entire area Area = n m
92 Time = Area: First Pass On first pass, the algorithm covers the entire area Area = n m But according to this figure this computation seems to require O(m n) space! Computing prefix(i) Computing suffix(i) However, note that in each such DP step we only compute the Scores, note the paths
93 Computing Alignment Score with Linear Memory Alignment Score Space complexity of computing just the score itself is O(n) We only need the previous column to calculate the current column, and we can then throw away that previous column once we re done using it n n 2
94 Computing Alignment Score: Recycling Columns Only two columns of scores are saved at any given time memory for column 1 is used to calculate column 3 memory for column 2 is used to calculate column 4
95 Time = Area: First Pass On first pass, the algorithm covers the entire area Area = n m Space requirement: O(n)? (In addition to the two recycled columns used for the rectangle DP, we maintain an O(n) sized vector to store the accumulated mid points). Computing prefix(i) Computing suffix(i)
96 Time = Area: Second Pass On second pass, the algorithm covers only 1/2 of the area Area/2
97 Time = Area: Third Pass On third pass, only 1/4th is covered. Area/4
98 Geometric Reduction At Each Iteration 1 + ½ + ¼ (½) k 2 Runtime: O(Area) = O(nm) 5 th pass: 1/16 3 rd pass: 1/4 first pass: 1 4 th pass: 1/8 2 nd pass: 1/2
Finding sequence similarities with genes of known function is a common approach to infer a newly sequenced gene s function
Outline DNA Sequence Comparison: First Success Stories Change Problem Manhattan Tourist Problem Longest Paths in Graphs Sequence Alignment Edit Distance Longest Common Subsequence Problem Dot Matrices
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline MergeSort Finding the middle point in the alignment matrix in linear space Linear space sequence alignment Block Alignment Four-Russians speedup Constructing LCS in
More informationDynamic Programming: Edit Distance
Dynamic Programming: Edit Distance Outline. DNA Sequence Comparison and CF. Change Problem. Manhattan Tourist Problem. Longest Paths in Graphs. Sequence Alignment 6. Edit Distance Section : DNA Sequence
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline 1. MergeSort 2. Finding the middle vertex 3. Linear space sequence alignment 4. Block alignment 5. Four-Russians speedup 6. LCS in sub-quadratic time Section 1: MergeSort
More informationDynamic Programming: Sequence alignment. CS 466 Saurabh Sinha
Dynamic Programming: Sequence alignment CS 466 Saurabh Sinha DNA Sequence Comparison: First Success Story Finding sequence similarities with genes of known function is a common approach to infer a newly
More informationDivide & Conquer Algorithms
Divide & Conquer Algorithms Outline MergeSort Finding the middle point in the alignment matrix in linear space Linear space sequence alignment Block Alignment Four-Russians speedup Constructing LCS in
More informationLecture 12: Divide and Conquer Algorithms
Lecture 12: Divide and Conquer Algorithms Study Chapter 7.1 7.4 1 Divide and Conquer Algorithms Divide problem into sub-problems Conquer by solving sub-problems recursively. If the sub-problems are small
More informationDivide and Conquer. Bioinformatics: Issues and Algorithms. CSE Fall 2007 Lecture 12
Divide and Conquer Bioinformatics: Issues and Algorithms CSE 308-408 Fall 007 Lecture 1 Lopresti Fall 007 Lecture 1-1 - Outline MergeSort Finding mid-point in alignment matrix in linear space Linear space
More informationEECS 4425: Introductory Computational Bioinformatics Fall Suprakash Datta
EECS 4425: Introductory Computational Bioinformatics Fall 2018 Suprakash Datta datta [at] cse.yorku.ca Office: CSEB 3043 Phone: 416-736-2100 ext 77875 Course page: http://www.cse.yorku.ca/course/4425 Many
More informationDynamic Programming Part I: Examples. Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, / 77
Dynamic Programming Part I: Examples Bioinfo I (Institut Pasteur de Montevideo) Dynamic Programming -class4- July 25th, 2011 1 / 77 Dynamic Programming Recall: the Change Problem Other problems: Manhattan
More informationDivide and Conquer Algorithms. Problem Set #3 is graded Problem Set #4 due on Thursday
Divide and Conquer Algorithms Problem Set #3 is graded Problem Set #4 due on Thursday 1 The Essence of Divide and Conquer Divide problem into sub-problems Conquer by solving sub-problems recursively. If
More information1. Basic idea: Use smaller instances of the problem to find the solution of larger instances
Chapter 8. Dynamic Programming CmSc Intro to Algorithms. Basic idea: Use smaller instances of the problem to find the solution of larger instances Example : Fibonacci numbers F = F = F n = F n- + F n-
More information9/29/09 Comp /Comp Fall
9/29/9 Comp 9-9/Comp 79-9 Fall 29 1 So far we ve tried: A greedy algorithm that does not work for all inputs (it is incorrect) An exhaustive search algorithm that is correct, but can take a long time A
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 04: Variations of sequence alignments http://www.pitt.edu/~mcs2/teaching/biocomp/tutorials/global.html Slides adapted from Dr. Shaojie Zhang (University
More informationPairwise Sequence alignment Basic Algorithms
Pairwise Sequence alignment Basic Algorithms Agenda - Previous Lesson: Minhala - + Biological Story on Biomolecular Sequences - + General Overview of Problems in Computational Biology - Reminder: Dynamic
More information3/5/2018 Lecture15. Comparing Sequences. By Miguel Andrade at English Wikipedia.
3/5/2018 Lecture15 Comparing Sequences By Miguel Andrade at English Wikipedia 1 http://localhost:8888/notebooks/comp555s18/lecture15.ipynb# 1/1 Sequence Similarity A common problem in Biology Insulin Protein
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 2 Materials used from R. Shamir [2] and H.J. Hoogeboom [4]. 1 Molecular Biology Sequences DNA A, T, C, G RNA A, U, C, G Protein A, R, D, N, C E,
More informationDynamicProgramming. September 17, 2018
DynamicProgramming September 17, 2018 1 Lecture 11: Dynamic Programming CBIO (CSCI) 4835/6835: Introduction to Computational Biology 1.1 Overview and Objectives We ve so far discussed sequence alignment
More information6.1 The Power of DNA Sequence Comparison
6 Dynamic Programming Algorithms We introduced dynamic programming in chapter 2 with the Rocks problem. While the Rocks problem does not appear to be related to bioinformatics, the algorithm that we described
More informationQB LECTURE #1: Algorithms and Dynamic Programming
QB LECTURE #1: Algorithms and Dynamic Programming Adam Siepel Nov. 16, 2015 2 Plan for Today Introduction to algorithms Simple algorithms and running time Dynamic programming Soon: sequence alignment 3
More informationSubsequence Definition. CS 461, Lecture 8. Today s Outline. Example. Assume given sequence X = x 1, x 2,..., x m. Jared Saia University of New Mexico
Subsequence Definition CS 461, Lecture 8 Jared Saia University of New Mexico Assume given sequence X = x 1, x 2,..., x m Let Z = z 1, z 2,..., z l Then Z is a subsequence of X if there exists a strictly
More informationDynamic Programming. Lecture Overview Introduction
Lecture 12 Dynamic Programming 12.1 Overview Dynamic Programming is a powerful technique that allows one to solve many different types of problems in time O(n 2 ) or O(n 3 ) for which a naive approach
More informationDynamic Programming II
June 9, 214 DP: Longest common subsequence biologists often need to find out how similar are 2 DNA sequences DNA sequences are strings of bases: A, C, T and G how to define similarity? DP: Longest common
More informationComputational Genomics and Molecular Biology, Fall
Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the
More informationDynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014
Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into
More informationComputational Molecular Biology
Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive
More informationCSC Design and Analysis of Algorithms. Lecture 7. Transform and Conquer I Algorithm Design Technique. Transform and Conquer
// CSC - Design and Analysis of Algorithms Lecture 7 Transform and Conquer I Algorithm Design Technique Transform and Conquer This group of techniques solves a problem by a transformation to a simpler/more
More informationLongest Common Subsequence. Definitions
Longest Common Subsequence LCS is an interesting variation on the classical string matching problem: the task is that of finding the common portion of two strings (more precise definition in a couple of
More informationEfficient Sequential Algorithms, Comp309. Motivation. Longest Common Subsequence. Part 3. String Algorithms
Efficient Sequential Algorithms, Comp39 Part 3. String Algorithms University of Liverpool References: T. H. Cormen, C. E. Leiserson, R. L. Rivest Introduction to Algorithms, Second Edition. MIT Press (21).
More informationLecture 7. Transform-and-Conquer
Lecture 7 Transform-and-Conquer 6-1 Transform and Conquer This group of techniques solves a problem by a transformation to a simpler/more convenient instance of the same problem (instance simplification)
More informationCPS 616 TRANSFORM-AND-CONQUER 7-1
CPS 616 TRANSFORM-AND-CONQUER 7-1 TRANSFORM AND CONQUER Group of techniques to solve a problem by first transforming the problem into one of: 1. a simpler/more convenient instance of the same problem (instance
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 6: Alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationLecture 9: Core String Edits and Alignments
Biosequence Algorithms, Spring 2005 Lecture 9: Core String Edits and Alignments Pekka Kilpeläinen University of Kuopio Department of Computer Science BSA Lecture 9: String Edits and Alignments p.1/30 III:
More informationAnalysis of Algorithms. Unit 4 - Analysis of well known Algorithms
Analysis of Algorithms Unit 4 - Analysis of well known Algorithms 1 Analysis of well known Algorithms Brute Force Algorithms Greedy Algorithms Divide and Conquer Algorithms Decrease and Conquer Algorithms
More informationCSC Design and Analysis of Algorithms
CSC : Lecture 7 CSC - Design and Analysis of Algorithms Lecture 7 Transform and Conquer I Algorithm Design Technique CSC : Lecture 7 Transform and Conquer This group of techniques solves a problem by a
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 06: Multiple Sequence Alignment https://upload.wikimedia.org/wikipedia/commons/thumb/7/79/rplp0_90_clustalw_aln.gif/575px-rplp0_90_clustalw_aln.gif Slides
More informationData Mining Technologies for Bioinformatics Sequences
Data Mining Technologies for Bioinformatics Sequences Deepak Garg Computer Science and Engineering Department Thapar Institute of Engineering & Tecnology, Patiala Abstract Main tool used for sequence alignment
More informationCS 170 DISCUSSION 8 DYNAMIC PROGRAMMING. Raymond Chan raychan3.github.io/cs170/fa17.html UC Berkeley Fall 17
CS 170 DISCUSSION 8 DYNAMIC PROGRAMMING Raymond Chan raychan3.github.io/cs170/fa17.html UC Berkeley Fall 17 DYNAMIC PROGRAMMING Recursive problems uses the subproblem(s) solve the current one. Dynamic
More informationReminder: sequence alignment in sub-quadratic time
Reminder: sequence alignment in sub-quadratic time Last week: Sequence alignment in sub-quadratic time for unrestricted Scoring Schemes. ) utilize LZ78 parsing 2) utilize Total Monotonicity property of
More informationGlobal Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties
Global Alignment Scoring Matrices Local Alignment Alignment with Affine Gap Penalties From LCS to Alignment: Change the Scoring The Longest Common Subsequence (LCS) problem the simplest form of sequence
More informationLecture 3, Review of Algorithms. What is Algorithm?
BINF 336, Introduction to Computational Biology Lecture 3, Review of Algorithms Young-Rae Cho Associate Professor Department of Computer Science Baylor University What is Algorithm? Definition A process
More informationAnalysis of Algorithms Prof. Karen Daniels
UMass Lowell Computer Science 91.503 Analysis of Algorithms Prof. Karen Daniels Spring, 2010 Lecture 2 Tuesday, 2/2/10 Design Patterns for Optimization Problems Greedy Algorithms Algorithmic Paradigm Context
More information1 Dynamic Programming
CS161 Lecture 13 Dynamic Programming and Greedy Algorithms Scribe by: Eric Huang Date: May 13, 2015 1 Dynamic Programming The idea of dynamic programming is to have a table of solutions of subproblems
More information15.4 Longest common subsequence
15.4 Longest common subsequence Biological applications often need to compare the DNA of two (or more) different organisms A strand of DNA consists of a string of molecules called bases, where the possible
More informationData Structures and Algorithms Week 8
Data Structures and Algorithms Week 8 Dynamic programming Fibonacci numbers Optimization problems Matrix multiplication optimization Principles of dynamic programming Longest Common Subsequence Algorithm
More informationHomework3: Dynamic Programming - Answers
Most Exercises are from your textbook: Homework3: Dynamic Programming - Answers 1. For the Rod Cutting problem (covered in lecture) modify the given top-down memoized algorithm (includes two procedures)
More informationAlgorithm Design and Analysis
Algorithm Design and Analysis LECTURE 16 Dynamic Programming Least Common Subsequence Saving space Adam Smith Least Common Subsequence A.k.a. sequence alignment edit distance Longest Common Subsequence
More informationProgramming II (CS300)
1 Programming II (CS300) Chapter 12: Sorting Algorithms MOUNA KACEM mouna@cs.wisc.edu Spring 2018 Outline 2 Last week Implementation of the three tree depth-traversal algorithms Implementation of the BinarySearchTree
More informationDynamic Programming. An Enumeration Approach. Matrix Chain-Products. Matrix Chain-Products (not in book)
Matrix Chain-Products (not in book) is a general algorithm design paradigm. Rather than give the general structure, let us first give a motivating example: Matrix Chain-Products Review: Matrix Multiplication.
More informationCSE 417 Dynamic Programming (pt 5) Multiple Inputs
CSE 417 Dynamic Programming (pt 5) Multiple Inputs Reminders > HW5 due Wednesday Dynamic Programming Review > Apply the steps... optimal substructure: (small) set of solutions, constructed from solutions
More informationOPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT
OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT Asif Ali Khan*, Laiq Hassan*, Salim Ullah* ABSTRACT: In bioinformatics, sequence alignment is a common and insistent task. Biologists align
More informationElements of Dynamic Programming. COSC 3101A - Design and Analysis of Algorithms 8. Discovering Optimal Substructure. Optimal Substructure - Examples
Elements of Dynamic Programming COSC 3A - Design and Analysis of Algorithms 8 Elements of DP Memoization Longest Common Subsequence Greedy Algorithms Many of these slides are taken from Monica Nicolescu,
More informationAlgorithms IV. Dynamic Programming. Guoqiang Li. School of Software, Shanghai Jiao Tong University
Algorithms IV Dynamic Programming Guoqiang Li School of Software, Shanghai Jiao Tong University Dynamic Programming Shortest Paths in Dags, Revisited Shortest Paths in Dags, Revisited The special distinguishing
More informationA Revised Algorithm to find Longest Common Subsequence
A Revised Algorithm to find Longest Common Subsequence Deena Nath 1, Jitendra Kurmi 2, Deveki Nandan Shukla 3 1, 2, 3 Department of Computer Science, Babasaheb Bhimrao Ambedkar University Lucknow Abstract:
More information15-451/651: Design & Analysis of Algorithms January 26, 2015 Dynamic Programming I last changed: January 28, 2015
15-451/651: Design & Analysis of Algorithms January 26, 2015 Dynamic Programming I last changed: January 28, 2015 Dynamic Programming is a powerful technique that allows one to solve many different types
More informationAlgorithms for Data Science
Algorithms for Data Science CSOR W4246 Eleni Drinea Computer Science Department Columbia University Thursday, October 1, 2015 Outline 1 Recap 2 Shortest paths in graphs with non-negative edge weights (Dijkstra
More informationCPE702 Algorithm Analysis and Design Week 7 Algorithm Design Patterns
CPE702 Algorithm Analysis and Design Week 7 Algorithm Design Patterns Pruet Boonma pruet@eng.cmu.ac.th Department of Computer Engineering Faculty of Engineering, Chiang Mai University Based on Slides by
More informationHIDDEN MARKOV MODELS AND SEQUENCE ALIGNMENT
HIDDEN MARKOV MODELS AND SEQUENCE ALIGNMENT - Swarbhanu Chatterjee. Hidden Markov models are a sophisticated and flexible statistical tool for the study of protein models. Using HMMs to analyze proteins
More informationIN101: Algorithmic techniques Vladimir-Alexandru Paun ENSTA ParisTech
IN101: Algorithmic techniques Vladimir-Alexandru Paun ENSTA ParisTech License CC BY-NC-SA 2.0 http://creativecommons.org/licenses/by-nc-sa/2.0/fr/ Outline Previously on IN101 Python s anatomy Functions,
More informationChapter 3 Dynamic programming
Chapter 3 Dynamic programming 1 Dynamic programming also solve a problem by combining the solutions to subproblems. But dynamic programming considers the situation that some subproblems will be called
More informationIntroduction to Algorithms
Introduction to Algorithms Dynamic Programming Well known algorithm design techniques: Brute-Force (iterative) ti algorithms Divide-and-conquer algorithms Another strategy for designing algorithms is dynamic
More informationBiology 644: Bioinformatics
A statistical Markov model in which the system being modeled is assumed to be a Markov process with unobserved (hidden) states in the training data. First used in speech and handwriting recognition In
More informationPractice Problems for the Final
ECE-250 Algorithms and Data Structures (Winter 2012) Practice Problems for the Final Disclaimer: Please do keep in mind that this problem set does not reflect the exact topics or the fractions of each
More informationUnit-5 Dynamic Programming 2016
5 Dynamic programming Overview, Applications - shortest path in graph, matrix multiplication, travelling salesman problem, Fibonacci Series. 20% 12 Origin: Richard Bellman, 1957 Programming referred to
More informationChapter 3, Algorithms Algorithms
CSI 2350, Discrete Structures Chapter 3, Algorithms Young-Rae Cho Associate Professor Department of Computer Science Baylor University 3.1. Algorithms Definition A finite sequence of precise instructions
More informationBiology 644: Bioinformatics
Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find
More informationMemoization/Dynamic Programming. The String reconstruction problem. CS124 Lecture 11 Spring 2018
CS124 Lecture 11 Spring 2018 Memoization/Dynamic Programming Today s lecture discusses memoization, which is a method for speeding up algorithms based on recursion, by using additional memory to remember
More informationCSC Design and Analysis of Algorithms. Lecture 5. Decrease and Conquer Algorithm Design Technique. Decrease-and-Conquer
CSC 8301- Design and Analysis of Algorithms Lecture 5 Decrease and Conquer Algorithm Design Technique Decrease-and-Conquer This algorithm design technique is based on exploiting a relationship between
More informationAlgorithm Design Paradigms
CmSc250 Intro to Algorithms Algorithm Design Paradigms Algorithm Design Paradigms: General approaches to the construction of efficient solutions to problems. Such methods are of interest because: They
More informationChapter 3:- Divide and Conquer. Compiled By:- Sanjay Patel Assistant Professor, SVBIT.
Chapter 3:- Divide and Conquer Compiled By:- Assistant Professor, SVBIT. Outline Introduction Multiplying large Integers Problem Problem Solving using divide and conquer algorithm - Binary Search Sorting
More informationLecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:
Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating
More informationFastA & the chaining problem
FastA & the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 1 Sources for this lecture: Lectures by Volker Heun, Daniel Huson and Knut Reinert,
More informationProgramming II (CS300)
1 Programming II (CS300) Chapter 12: Sorting Algorithms MOUNA KACEM mouna@cs.wisc.edu Spring 2018 Outline 2 Last week Implementation of the three tree depth-traversal algorithms Implementation of the BinarySearchTree
More informationCSci 231 Final Review
CSci 231 Final Review Here is a list of topics for the final. Generally you are responsible for anything discussed in class (except topics that appear italicized), and anything appearing on the homeworks.
More informationDynamic Programming Course: A structure based flexible search method for motifs in RNA. By: Veksler, I., Ziv-Ukelson, M., Barash, D.
Dynamic Programming Course: A structure based flexible search method for motifs in RNA By: Veksler, I., Ziv-Ukelson, M., Barash, D., Kedem, K Outline Background Motivation RNA s structure representations
More informationIntroduction to Algorithms
Introduction to Algorithms 6.046J/18.401J LECTURE 12 Dynamic programming Longest common subsequence Optimal substructure Overlapping subproblems Prof. Charles E. Leiserson Dynamic programming Design technique,
More informationDynamic Programming part 2
Dynamic Programming part 2 Week 7 Objectives More dynamic programming examples - Matrix Multiplication Parenthesis - Longest Common Subsequence Subproblem Optimal structure Defining the dynamic recurrence
More informationFastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:
FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:56 4001 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem
More informationCMSC Introduction to Algorithms Spring 2012 Lecture 16
CMSC 351 - Introduction to Algorithms Spring 2012 Lecture 16 Instructor: MohammadTaghi Hajiaghayi Scribe: Rajesh Chitnis 1 Introduction In this lecture we will look at Greedy Algorithms and Dynamic Programming.
More informationLongest Common Subsequence, Knapsack, Independent Set Scribe: Wilbur Yang (2016), Mary Wootters (2017) Date: November 6, 2017
CS161 Lecture 13 Longest Common Subsequence, Knapsack, Independent Set Scribe: Wilbur Yang (2016), Mary Wootters (2017) Date: November 6, 2017 1 Overview Last lecture, we talked about dynamic programming
More informationDNA Alignment With Affine Gap Penalties
DNA Alignment With Affine Gap Penalties Laurel Schuster Why Use Affine Gap Penalties? When aligning two DNA sequences, one goal may be to infer the mutations that made them different. Though it s impossible
More informationEvolutionary tree reconstruction (Chapter 10)
Evolutionary tree reconstruction (Chapter 10) Early Evolutionary Studies Anatomical features were the dominant criteria used to derive evolutionary relationships between species since Darwin till early
More information15.4 Longest common subsequence
15.4 Longest common subsequence Biological applications often need to compare the DNA of two (or more) different organisms A strand of DNA consists of a string of molecules called bases, where the possible
More informationCS473-Algorithms I. Lecture 10. Dynamic Programming. Cevdet Aykanat - Bilkent University Computer Engineering Department
CS473-Algorithms I Lecture 1 Dynamic Programming 1 Introduction An algorithm design paradigm like divide-and-conquer Programming : A tabular method (not writing computer code) Divide-and-Conquer (DAC):
More informationCMSC 451: Lecture 10 Dynamic Programming: Weighted Interval Scheduling Tuesday, Oct 3, 2017
CMSC 45 CMSC 45: Lecture Dynamic Programming: Weighted Interval Scheduling Tuesday, Oct, Reading: Section. in KT. Dynamic Programming: In this lecture we begin our coverage of an important algorithm design
More informationLectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures
4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 4.1 Sources for this lecture Lectures by Volker Heun, Daniel Huson and Knut
More informationCSED233: Data Structures (2017F) Lecture12: Strings and Dynamic Programming
(2017F) Lecture12: Strings and Dynamic Programming Daijin Kim CSE, POSTECH dkim@postech.ac.kr Strings A string is a sequence of characters Examples of strings: Python program HTML document DNA sequence
More informationLecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD
Lecture 2 Pairwise sequence alignment. Principles Computational Biology Teresa Przytycka, PhD Assumptions: Biological sequences evolved by evolution. Micro scale changes: For short sequences (e.g. one
More informationCMSC 451: Lecture 11 Dynamic Programming: Longest Common Subsequence Thursday, Oct 5, 2017
CMSC 451: Lecture 11 Dynamic Programming: Longest Common Subsequence Thursday, Oct 5, 217 Reading: This algorithm is not covered in KT or DPV. It is closely related to the Sequence lignment problem of
More informationWe ve done. Now. Next
We ve done Matroid Theory Task scheduling problem (another matroid example) Dijkstra s algorithm (another greedy example) Dynamic Programming Now Matrix Chain Multiplication Longest Common Subsequence
More informationRecap: Hash Tables. Recap : Open hash. Recap: Illustration of ChainedHash. Key features. Key components. Probing strategies.
Recap: Hash Tables Biostatistics 5/85 Lecture : Dynamic Programming Hyun Min Kang February 3rd, 2 Hyun Min Kang Biostatistics 5/85 - Lecture February 3rd, 2 / 3 Key features Θ() complexity for Insert,
More informationCSE 101- Winter 18 Discussion Section Week 2
S 101- Winter 18 iscussion Section Week 2 Topics Topological ordering Strongly connected components Binary search ntroduction to ivide and onquer algorithms Topological ordering Topological ordering =>
More informationCSC Design and Analysis of Algorithms. Lecture 5. Decrease and Conquer Algorithm Design Technique. Decrease-and-Conquer
CSC 8301- Design and Analysis of Algorithms Lecture 5 Decrease and Conuer Algorithm Design Techniue Decrease-and-Conuer This algorithm design techniue is based on exploiting a relationship between a solution
More informationAlgorithms. Lecture Notes 5
Algorithms. Lecture Notes 5 Dynamic Programming for Sequence Comparison The linear structure of the Sequence Comparison problem immediately suggests a dynamic programming approach. Naturally, our sub-instances
More informationSpecial course in Computer Science: Advanced Text Algorithms
Special course in Computer Science: Advanced Text Algorithms Lecture 8: Multiple alignments Elena Czeizler and Ion Petre Department of IT, Abo Akademi Computational Biomodelling Laboratory http://www.users.abo.fi/ipetre/textalg
More informationCSC Design and Analysis of Algorithms. Lecture 7. Transform and Conquer I Algorithm Design Technique. Transform and Conquer
CSC 83- Design and Analysis of Algorithms Lecture 7 Transform and Conuer I Algorithm Design Techniue Transform and Conuer This group of techniues solves a problem by a transformation to a simpler/more
More informationMachine Learning. Computational biology: Sequence alignment and profile HMMs
10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth
More informationSequence Alignment & Search
Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating the first version
More informationCOMP 251 Winter 2017 Online quizzes with answers
COMP 251 Winter 2017 Online quizzes with answers Open Addressing (2) Which of the following assertions are true about open address tables? A. You cannot store more records than the total number of slots
More informationDynamic Programming. CIS 110, Fall University of Pennsylvania
Dynamic Programming CIS 110, Fall 2012 University of Pennsylvania Dynamic Programming Dynamic programming records saves computation for reuse later. Programming: in the optimization sense ( Linear Programming
More information