Genomic Data Analysis Services Available for PL-Grid Users

Size: px
Start display at page:

Download "Genomic Data Analysis Services Available for PL-Grid Users"

Transcription

1 Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus Genomic Data Analysis Services Available for PL-Grid Users Tomasz Waller, Tomasz Gubała, Kazimierz Murzyn Academic Computer Centre Cyfronet AGH, cyfro.net Klaster LifeScience Kraków, lifescience.pl Klaster LifeScience Kraków, May 2014

2 ACC Cyfronet AGH and PL-Grid Infrastructure 2 Academic Computer Centre Cyfronet AGH Established in 1973 (40 years of experience) Main mission: to provide network, computational power and data storage capabilities for Polish science ~374 TFlops (145@top500), 2.5 PB (disks) and 3.5 PB (tapes) Regular and bigmem nodes, vsmp, GPGPU, FPGA, MPI over Infiniband Details: PL-Grid Infrastructure for Polish science Five computing centers with Cyfronet as the consortium leader Total: ~588 TFlops and ~5.6 PB (disks) Planned for 1Q2015: >900 TFlops, 8 PB Available free of charge to all Polish scientists and their foreign collaborators Details:

3 Using PL-Grid Infrastructure 3 Register at User verification process based on Polish OPI number Assistants and foreigners are confirmed by Polish PIs Variety of basic and higher level services available after login Local SSH access, cloud computing, middlewares Considerable library of installed applications GATK, MACS, SAMTools, Picard, TopHat, Bowtie, (p)bwa, R/Bioconductor, AutoDock/AutoGrid, BLAST, Clustal, CPMD, Gromacs, NAMD, Matlab, Mathematica Free to compile and install own applications using the shell login Possibility to use own commercial licenses on HPC resources Questions: or helpdesk@plgrid.pl

4 PLGrid PLUS: Domain-oriented Services, Resources and Tools 4 Preparation of specific computing environments, i.e., solutions, services and extended infrastructure tailored to the needs of different groups of scientists ( ) Life Science among 13 domains of science LS Domain Leader: Kraków LifeScience Klaster Tasks: Analysis of user needs Development of services Procurement and deployment of applications on HPC res. Continuous assistance for the Life Science community

5 DNA Microarray Integromics Analysis Platform (1/2) 5 For people who perform biological investigations using DNA microarrays Goal: help to analyze gene expression information and correlate it with other clinical data In development since 1Q2013, first version deployed Analyses available now: normalization, clustering, SAM, T- test, GO-based enrichment, ANNs, PCA, panel filtering Integromics analyses in preparation CCA, PLS (gene expression and lipidomics) Roleswitch, TargetScore (gene expression and mirna) Supported models: Affymetrix, Agilent (support for others is possible in case of demand)

6 DNA Microarray Integromics Analysis Platform (2/2) 6 Notable features Integration with EBI ArrayExpress (import, MIAME) Sharing experiments with others Importing own data for further analysis Supported languages: PL, EN Manual: Cooperation Jagiellonian University Medical Collage, Kraków Medical University of Silesia, Katowice Institute of Oncology, Gliwice

7 Galaxy NGS Server (1/2) 7 Galaxy is an open, web-based platform for data intensive biomedical research. Goal: deploy high-performance, high-throughput NGS data analysis solution on top of HPC resources for PL-Grid users Needs a lot of adjustments and in-house add-on development Work started , first version planned ~ Planned integrated tools (list not closed): GATK, SAMtools, Bowtie, TopHat, BWA, bedtools, Cufflinks, Picard, SnpEff/SnpSift, Flexbar, FastQC, MACS References: human, mouse, domestic animals Targeted platforms: Illumina *Seq, Roche 454, Ion Proton

8 Galaxy NGS Server (2/2) 8 Notable features Full integration with Zeus cluster and large disk arrays PBS and MQ system for effective job queuing and management Secured environment (open for all PL-Grid users, not public ) All major Galaxy features (history, sharing, viewers) enabled Well documented workflows designed by NGS experts Basics (alignment and quality control, trimming, filtering) DNA-Seq, RNA-Seq, variant calling, SNP calling, methylation, exome analysis with annotations Manual: (available when service goes production) Cooperation Institute of Pharmacology, Polish Academy of Sciences, Kraków Jagiellonian University Medical Collage, Kraków National Research Institute of Animal Production, Kraków-Balice

9 Agilent GeneSpring GX 9 RDP: genespring.plgrid.pl Used with Windows Remote Desktop Integrated with the DNA Integromics Platform for uniform microarray files management 5-year, single-seat license for all registered Polish scientists Manual:

10 PLGData Simple Service to Manage Files on Clusters 10 Simple file and folder management upload, delete, download, rename, change rights Integrated with Cyfronet s Zeus cluster, accessible for all users Uses GridFTP and HTTPS protocols for secure data transfer Access to group storage for team/project collaboration Manual:

11 Links, Contact, Partners 11 These resources, services and tools (and much more) are available after registering to PL-Grid PL-Grid User Manual (PL) (EN) Questions, problems, requests about PL-Grid or Contact for LifeScience domain services Collaborative effort Academic Computer Centre Cyfronet AGH, Kraków (project leader) Kraków LifeScience Klaster (Life Science domain services leader) 10 expert institutes/laboratories from Małopolska and Śląsk

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

A Virtual Machine to teach NGS data analysis. Andreas Gisel CNR - ITB Bari, Italy

A Virtual Machine to teach NGS data analysis. Andreas Gisel CNR - ITB Bari, Italy A Virtual Machine to teach NGS data analysis Andreas Gisel CNR - ITB Bari, Italy The Virtual Machine A virtual machine is a tightly isolated software container that can run its own operating systems and

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

CYFRONET SITE REPORT IMPROVING SLURM USABILITY AND MONITORING. M. Pawlik, J. Budzowski, L. Flis, P. Lasoń, M. Magryś

CYFRONET SITE REPORT IMPROVING SLURM USABILITY AND MONITORING. M. Pawlik, J. Budzowski, L. Flis, P. Lasoń, M. Magryś CYFRONET SITE REPORT IMPROVING SLURM USABILITY AND MONITORING M. Pawlik, J. Budzowski, L. Flis, P. Lasoń, M. Magryś Presentation plan 2 Cyfronet introduction System description SLURM modifications Job

More information

How to store and visualize RNA-seq data

How to store and visualize RNA-seq data How to store and visualize RNA-seq data Gabriella Rustici Functional Genomics Group gabry@ebi.ac.uk EBI is an Outstation of the European Molecular Biology Laboratory. Talk summary How do we archive RNA-seq

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

Analyzing ChIP- Seq Data in Galaxy

Analyzing ChIP- Seq Data in Galaxy Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...

More information

Using the Galaxy Local Bioinformatics Cloud at CARC

Using the Galaxy Local Bioinformatics Cloud at CARC Using the Galaxy Local Bioinformatics Cloud at CARC Lijing Bu Sr. Research Scientist Bioinformatics Specialist Center for Evolutionary and Theoretical Immunology (CETI) Department of Biology, University

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

CLC Server. End User USER MANUAL

CLC Server. End User USER MANUAL CLC Server End User USER MANUAL Manual for CLC Server 10.0.1 Windows, macos and Linux March 8, 2018 This software is for research purposes only. QIAGEN Aarhus Silkeborgvej 2 Prismet DK-8000 Aarhus C Denmark

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)

BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is

More information

Using Galaxy to provide a NGS Analysis Platform

Using Galaxy to provide a NGS Analysis Platform 11/15/11 Using Galaxy to provide a NGS Analysis Platform Friedrich Miescher Institute - part of the Novartis Research Foundation - affiliated institute of Basel University - member of Swiss Institute of

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Galaxy. Daniel Blankenberg The Galaxy Team

Galaxy. Daniel Blankenberg The Galaxy Team Galaxy Daniel Blankenberg The Galaxy Team http://galaxyproject.org Overview What is Galaxy? What you can do in Galaxy analysis interface, tools and datasources data libraries workflows visualization sharing

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Super-Fast Genome BWA-Bam-Sort on GLAD

Super-Fast Genome BWA-Bam-Sort on GLAD 1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM). Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Automated Bioinformatics Analysis System on Chip ABASOC. version 1.1

Automated Bioinformatics Analysis System on Chip ABASOC. version 1.1 Automated Bioinformatics Analysis System on Chip ABASOC version 1.1 Phillip Winston Miller, Priyam Patel, Daniel L. Johnson, PhD. University of Tennessee Health Science Center Office of Research Molecular

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

Research e-infrastructures in Czech Republic (e-infra CZ) for scientific computations, collaborative research & research support

Research e-infrastructures in Czech Republic (e-infra CZ) for scientific computations, collaborative research & research support Research e-infrastructures in Czech Republic (e-infra CZ) for scientific computations, collaborative research & research support Tomáš Rebok CERIT-SC, Institute of Computer Science MU MetaCentrum, CESNET

More information

Installing DNA-Seq Tools for Sequencher

Installing DNA-Seq Tools for Sequencher Installing DNA-Seq Tools for Sequencher 2017 Gene Codes Corporation Gene Codes Corporation 525 Avis Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax)

More information

de.nbi and its Galaxy interface for RNA-Seq

de.nbi and its Galaxy interface for RNA-Seq de.nbi and its Galaxy interface for RNA-Seq Jörg Fallmann Thanks to Björn Grüning (RBC-Freiburg) and Sarah Diehl (MPI-Freiburg) Institute for Bioinformatics University of Leipzig http://www.bioinf.uni-leipzig.de/

More information

Read mapping with BWA and BOWTIE

Read mapping with BWA and BOWTIE Read mapping with BWA and BOWTIE Before We Start In order to save a lot of typing, and to allow us some flexibility in designing these courses, we will establish a UNIX shell variable BASE to point to

More information

Advanced Supercomputing Hub for OMICS Knowledge in Agriculture. Step-wise Help to Access Bio-computing Portal. (

Advanced Supercomputing Hub for OMICS Knowledge in Agriculture. Step-wise Help to Access Bio-computing Portal. ( Advanced Supercomputing Hub for OMICS Knowledge in Agriculture Step-wise Help to Access Bio-computing Portal (http://webapp.cabgrid.res.in/biocomp/) Centre for Agricultural Bioinformatics ICAR - Indian

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Agilent Genomic Workbench Lite Edition 6.5

Agilent Genomic Workbench Lite Edition 6.5 Agilent Genomic Workbench Lite Edition 6.5 SureSelect Quality Analyzer User Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010

More information

Status and Plans The first functioning National Grid Initiative in Europe

Status and Plans The first functioning National Grid Initiative in Europe Polish Infrastructure for Supporting Computational Science in the European Research Space PL-Grid Status and Plans The first functioning National Grid Initiative in Europe www.plgrid.pl/en Marian Bubak,

More information

Chemistry at CSC CSC Computational Chemistry Spring School

Chemistry at CSC CSC Computational Chemistry Spring School Chemistry at CSC CSC Computational Chemistry Spring School 22.3.2013 Aim: you ll be aware of Lots of software for chemists Lots of computational resources for chemists Several ways to access CSC s resources

More information

Tutorial. Identification of Variants in a Tumor Sample. Sample to Insight. November 21, 2017

Tutorial. Identification of Variants in a Tumor Sample. Sample to Insight. November 21, 2017 Identification of Variants in a Tumor Sample November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain.

Centre (CNIO). 3rd Melchor Fernández Almagro St , Madrid, Spain. s/n, Universidad de Vigo, Ourense, Spain. O. Graña *a,b, M. Rubio-Camarillo a, F. Fdez-Riverola b, D.G. Pisano a and D. Glez-Peña b a Bioinformatics Unit, Structural Biology and BioComputing Programme, Spanish National Cancer Research Centre (CNIO).

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

Introduction to Galaxy

Introduction to Galaxy Introduction to Galaxy Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW Day 1 Thurs 28 th January 2016 Overview What is Galaxy? Description of

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

Galaxy. Data intensive biology for everyone. / #usegalaxy

Galaxy. Data intensive biology for everyone. / #usegalaxy Galaxy Data intensive biology for everyone. www.galaxyproject.org @jxtx / #usegalaxy Engineering Dannon Baker Dan Blankenberg Dave Bouvier Nate Coraor Carl Eberhard Jeremy Goecks Sam Guerler Greg von Kuster

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

Prof. Konstantinos Krampis Office: Rm. 467F Belfer Research Building Phone: (212) Fax: (212)

Prof. Konstantinos Krampis Office: Rm. 467F Belfer Research Building Phone: (212) Fax: (212) Director: Prof. Konstantinos Krampis agbiotec@gmail.com Office: Rm. 467F Belfer Research Building Phone: (212) 396-6930 Fax: (212) 650 3565 Facility Consultant:Carlos Lijeron 1/8 carlos@carotech.com Office:

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

VT EGI-ELIXIR : French node

VT EGI-ELIXIR : French node By Tiphaine Martin, CNRS-University of Cambridge Information provided by Thierry Meinnel, French observer for Elixir; Claudine Médigue, Coordinator of ReNaBi, Jean-Françcois Gibrat, Director of IFB, Genevieve

More information

The Cambridge Bio-Medical-Cloud An OpenStack platform for medical analytics and biomedical research

The Cambridge Bio-Medical-Cloud An OpenStack platform for medical analytics and biomedical research The Cambridge Bio-Medical-Cloud An OpenStack platform for medical analytics and biomedical research Dr Paul Calleja Director of Research Computing University of Cambridge Global leader in science & technology

More information

Our typical RNA quantification pipeline

Our typical RNA quantification pipeline RNA-Seq primer Our typical RNA quantification pipeline Upload your sequence data (fastq) Align to the ribosome (Bow>e) Align remaining reads to genome (TopHat) or transcriptome (RSEM) Make report of quality

More information

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014

Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Review of Recent NGS Short Reads Alignment Tools BMI-231 final project, Chenxi Chen Spring 2014 Deciphering the information contained in DNA sequences began decades ago since the time of Sanger sequencing.

More information

Agilent Genomic Workbench 6.5

Agilent Genomic Workbench 6.5 Agilent Genomic Workbench 6.5 Product Overview Guide For Research Use Only. Not for use in diagnostic procedures. Agilent Technologies Notices Agilent Technologies, Inc. 2010, 2015 No part of this manual

More information

Supercomputer and grid infrastructure! in Poland!

Supercomputer and grid infrastructure! in Poland! Supercomputer and grid infrastructure in Poland Franciszek Rakowski Interdisciplinary Centre for Mathematical and Computational Modelling 12th INCF Nodes Workshop, 16.04.2015 Warsaw, Nencki Institute.

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

InSilicoLab: A framework for domain-specific science gateways

InSilicoLab: A framework for domain-specific science gateways InSilicoLab: A framework for domain-specific science gateways Joanna Kocot, Mariusz Sterzel, Tomasz Szepieniec, Maciej Golik, Tomasz Grabarczyk, Michał Trzeciak, Tomasz Twaróg, Piotr Wójcik ACC CYFRONET

More information

TP RNA-seq : Differential expression analysis

TP RNA-seq : Differential expression analysis TP RNA-seq : Differential expression analysis Overview of RNA-seq analysis Fusion transcripts detection Differential expresssion Gene level RNA-seq Transcript level Transcripts and isoforms detection 2

More information

Flexible HPC for Bio-informatics. Peter Clapham

Flexible HPC for Bio-informatics. Peter Clapham Flexible HPC for Bio-informatics Peter Clapham Overview Overview of the Sanger Institute How our data flow works today New scientific demands Private cloud deployment Transitional and future challenges

More information

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017

Gene Expression Data Analysis. Qin Ma, Ph.D. December 10, 2017 1 Gene Expression Data Analysis Qin Ma, Ph.D. December 10, 2017 2 Bioinformatics Systems biology This interdisciplinary science is about providing computational support to studies on linking the behavior

More information

GenomeStudio Software Release Notes

GenomeStudio Software Release Notes GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

Discovery Net : A UK e-science Pilot Project for Grid-based Knowledge Discovery Services. Patrick Wendel Imperial College, London

Discovery Net : A UK e-science Pilot Project for Grid-based Knowledge Discovery Services. Patrick Wendel Imperial College, London Discovery Net : A UK e-science Pilot Project for Grid-based Knowledge Discovery Services Patrick Wendel Imperial College, London Data Mining and Exploration Middleware for Distributed and Grid Computing,

More information

CLC Genomics Server. Administrator Manual

CLC Genomics Server. Administrator Manual CLC Genomics Server Administrator Manual Administrator Manual for CLC Genomics Server 5.5 Windows, Mac OS X and Linux October 31, 2013 This software is for research purposes only. CLC bio Silkeborgvej

More information

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight

Resequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa

More information

DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure

DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure TM DRAGEN Bio-IT Platform Enabling the Global Genomic Infrastructure About DRAGEN Edico Genome s DRAGEN TM (Dynamic Read Analysis for GENomics) Bio-IT Platform provides ultra-rapid secondary analysis of

More information

Introduction to HPC Using zcluster at GACRC

Introduction to HPC Using zcluster at GACRC Introduction to HPC Using zcluster at GACRC Georgia Advanced Computing Resource Center University of Georgia Zhuofei Hou, HPC Trainer zhuofei@uga.edu Outline What is GACRC? What is HPC Concept? What is

More information

Using CLC Genomics Workbench on Turing

Using CLC Genomics Workbench on Turing Using CLC Genomics Workbench on Turing Table of Contents Introduction...2 Accessing CLC Genomics Workbench...2 Launching CLC Genomics Workbench from your workstation...2 Launching CLC Genomics Workbench

More information

Accessible, Transparent and Reproducible Analysis with Galaxy

Accessible, Transparent and Reproducible Analysis with Galaxy Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,

More information

The role of PIONIER network in long term preservation services for cultural heritage institutions in Poland

The role of PIONIER network in long term preservation services for cultural heritage institutions in Poland The role of PIONIER network in long term preservation services for cultural heritage institutions in Poland Marcin Werla (mwerla@man.poznan.pl) Poznań Supercomputing and Networking Center Poznań, POLAND

More information

QosCosGrid Middleware

QosCosGrid Middleware Domain-oriented services and resources of Polish Infrastructure for Supporting Computational Science in the European Research Space PLGrid Plus QosCosGrid Middleware Domain-oriented services and resources

More information

New High Performance Computing Cluster For Large Scale Multi-omics Data Analysis. 28 February 2018 (Wed) 2:30pm 3:30pm Seminar Room 1A, G/F

New High Performance Computing Cluster For Large Scale Multi-omics Data Analysis. 28 February 2018 (Wed) 2:30pm 3:30pm Seminar Room 1A, G/F New High Performance Computing Cluster For Large Scale Multi-omics Data Analysis 28 February 2018 (Wed) 2:30pm 3:30pm Seminar Room 1A, G/F The Team (Bioinformatics & Information Technology) Eunice Kelvin

More information

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012

David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012 David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide.

preparation methods and new bacterial strains. Parts of the pipeline that can be updated will be annotated in this guide. BacSeq Introduction The purpose of this guide is to aid current and future Whiteley Lab members and University of Texas microbiologists with bacterial RNA?Seq analysis. Once you have analyzed your data

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Sequencing Data. Paul Agapow 2011/02/03

Sequencing Data. Paul Agapow 2011/02/03 Webservices for Next Generation Sequencing Data Paul Agapow 2011/02/03 Aims Assumed parameters: Must have a system for non-technical users to browse and manipulate their Next Generation Sequencing (NGS)

More information

mirnet Tutorial Starting with expression data

mirnet Tutorial Starting with expression data mirnet Tutorial Starting with expression data Computer and Browser Requirements A modern web browser with Java Script enabled Chrome, Safari, Firefox, and Internet Explorer 9+ For best performance and

More information

Agilent GeneSpring Software

Agilent GeneSpring Software Agilent GeneSpring Software Installation Guide Quick Start Installation of Agilent GeneSpring 3 Detailed Instructions for Installing Agilent GeneSpring 5 Managing Licenses 19 Upgrading Agilent GeneSpring

More information

Technical Computing with MATLAB

Technical Computing with MATLAB Technical Computing with MATLAB University Of Bath Seminar th 19 th November 2010 Adrienne James (Application Engineering) 1 Agenda Introduction to MATLAB Importing, visualising and analysing data from

More information

Tutorial. Comparative Analysis of Three Bovine Genomes. Sample to Insight. November 21, 2017

Tutorial. Comparative Analysis of Three Bovine Genomes. Sample to Insight. November 21, 2017 Comparative Analysis of Three Bovine Genomes November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Introduction to Matlab. Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole

Introduction to Matlab. Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole Introduction to Matlab Sasha Lukyanov, 2018 Xenopus Bioinformatics Workshop, MBL, Woods Hole MATLAB Environment This image cannot currently be displayed. What do we use? Help? If you know the name of the

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data

Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification

More information

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6

Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis

More information

Exome sequencing. Jong Kyoung Kim

Exome sequencing. Jong Kyoung Kim Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic

More information

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing

A Hands-On Tutorial: RNA Sequencing Using High-Performance Computing A Hands-On Tutorial: RNA Sequencing Using Computing February 11th and 12th, 2016 1st session (Thursday) Preliminaries: Linux, HPC, command line interface Using HPC: modules, queuing system Presented by:

More information

m6aviewer Version Documentation

m6aviewer Version Documentation m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.

More information

Tutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017

Tutorial. Identification of Variants Using GATK. Sample to Insight. November 21, 2017 Identification of Variants Using GATK November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com AdvancedGenomicsSupport@qiagen.com

More information

Easy Access to Grid Infrastructures

Easy Access to Grid Infrastructures Easy Access to Grid Infrastructures Dr. Harald Kornmayer (NEC Laboratories Europe) On behalf of the g-eclipse consortium WP11 Grid Workshop Grenoble, France 09 th of December 2008 Background in astro particle

More information

Quantitative Biology Bootcamp Intro to RNA-seq

Quantitative Biology Bootcamp Intro to RNA-seq Quantitative Biology Bootcamp Intro to RNA-seq Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology 2 September 2014 RNA-seq Analysis Pipeline Quality

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors

More information

Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information)

Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) Categorized software tools: (this page is being updated and links will be restored ASAP. Click on one of the menu links for more information) 1 / 5 For array design, fabrication and maintaining a database

More information