Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Size: px
Start display at page:

Download "Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors."

Transcription

1 6/9/ Abstrction, List, & Cons CS6A Lecture Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK! Hppier Code (define (totl hnd) (if (empty? hnd) (+ (rnk (one-d hnd)) (totl (remining-ds hnd) )))) (define (rnk d) (butlst d)) (define (suit d) (lst d)) Selectors (define suit lst) (define (one-d hnd) (lst hnd)) (define (remining-ds hnd) (bl hnd)) Gols To tlk bout things using mening not how it is represented in the computer To be ble to chnge how it is represented in the computer without people who use our progrm ing Invented by: Turing Awrd Winner: Brbr Liskov Constructors GOAL: To tlk bout things using mening not how it is represented in the computer You still hve STk> (totl (h c d)) ; to tech STk> (totl people to use (mke-hnd your progrm (mke-d hert) (mke-d club) (mke-d dimond))) Constructors STk> (totl (mke-hnd (mke-d hert) (mke-d club) (mke-d dimond))) (define (mke-d rnk suit) (word rnk (first suit))) (define mke-hnd se) Constructors

2 6/9/ Dt Abstrction (define (totl hnd) (if (empty? hnd) (+ (rnk (one-d hnd)) (totl (remining-ds hnd) )))) (define (rnk d) (define (mke-d rnk suit) (butlst d)) (word rnk (first suit))) (define (suit d) (define mke-hnd se) (lst d)) (define (one-d hnd) (lst hnd)) (define (remining-ds hnd) (bl hnd)) Try It! Rewrite wht you need to: Crds re represented s numbers - - is A-K of Herts -6 is A-K of Spdes 7-9 is A-K of Dimonds - is A-K of Clubs Runtimes Continued Exponentil Runtime n brnches = cll brnches = brnches = 7 brnches = b brnches = b+ - clls 6 Fiboncci fib n = fib n- + fib n- ~6 ~ n brnches = n+ - clls

3 6/9/ Number Guessing Gme Logrithmic Runtime Log (N) I m thinking of number between nd How mny possible guesses could it tke you? (WORST CASE) Between nd? How mny possible guesses could it tke you? (WORST CASE) b brnches = b+ - clls n possible numbers & h clls n= h+ - Divide nd Conquer If we cn divide the problem up in hlf ech time like the number guessing gme How mny recursive clls will it tke? n is the originl problem size if h clls then: n= h+ - // Tke the log of both sides // Remember: Log (N) When we re ble to keep dividing the problem in hlf (or thirds etc.) Looking through phone book

4 6/9/ Asymptotic Cost We wnt to express the speed of n lgorithm independently of specific implementtion on specific mchine. Asymptotic Cost Which one is fstest? We exmine the cost of the lgorithms for lrge input sets i.e. the symptotic cost. In lter clsses (CS7/CS7) you ll do this in more detil Woh! One of these is WAY better fter this point. Let s cll tht point N Subset of Importnt Big-Oh Sets Function Common Nme O() Constnt O(log n) Logrithmic O( log n) Log-squred O( n ) Root-n O(n) Liner O(n log n) n log n O(n ) Qudrtic O(n ) Cubic O(n ) Qurtic O( n ) Exponentil O(e n ) Bigger exponentil Which is fstest fter some vlue N? Forml definition T( n) O( f ( n)) WAIT who es? These re ll proportionl! Sometimes we do e, but for simplicity we ignore constnts if nd only if T( n) c* f ( n) for ll n > N

5 6/9/ Simplifying stuff is importnt Cons nd Lists DEMO cons / STk> (cons ) (. ) STk> (define (cons )) STk> (define b (cons hi bye)) b STk> b (hi. bye) STk> ( ) STk> ( ) STk> ( b) hi STk> ( b) bye Pirs Dt Abstrction Points Uses of Pir from textbook X Y Intervls Frctions Complex # low high Selectors Constructors num den rel compl cons Lines X Y X Y

6 6/9/ list Lists Demo STk> (list ) ( ) STk> (list ) () STk> (list) () STk> (list +) (#[closure rglist=rgs 7ffde]) Lists re mde with pirs! STk> (define (list )) STk> (define b (list )) b The Empty List STk> (cons ()) () How cn you mke the list ( )? )(define (cons ())) b)(define (cons (cons ))) c)(define (cons (cons ()))) d)(define (cons (cons ()) ))) e)??? How mny clls to cons re mde? STk> (define (list )) A) B) C) D) E) 6 6

7 6/9/ How mny clls to cons re mde? STk> (define (list (list ) )) Accessing Elements Using nd A) B) C) D) E) 6 The Empty List w/ & How do you get the? STk> (define x (cons ()) x STk> x () x STk> ( x) STk> ( x) () STk> (define (list )) A) ( ( )) B) ( ( )) C) ( ( ( ))) D) ( ( ( ))) E) ( ( ( ))) How do you get the? Cons mkes pir STk> (define (list (list ) )) (cons b) A) ( ( ( ( )))) B) ( ( ( ( )))) C) ( ( ( ( )))) D) ( ( ( ( )))) E)??? A B 7

8 6/9/ Dots Demo STk> (cons ) (. ) Dots STk> (cons ()) () STk> (cons ()) (.( )) Dots CONSTRUCTOR SOLUTION STk> (cons ()) (. ()) () STk> (cons (cons ())) (. (.( ))) ( ) (define (mke-d rnk suit) (cond ((equl? suit 'hert) rnk) ((equl? suit 'spde) (+ rnk )) ((equl? suit 'dimond) (+ rnk 6)) ((equl? suit 'club) (+ rnk 9)) (else (error "sy wht?")) )) SELECTOR SOLUTION (define (d-rnk d) (reminder d )) (define (suit d) (cond ((> d) 'hert) ((> 7 d) 'spde) ((> d) 'dimond) (else 'club))) How mny clls to cons re mde? STk> (define (list (list ) )) A) B) C) D) E) 6 Solution: (cons (cons (cons (cons (cons ())) (cons ())))))

O(1) How long does a function take to run? CS61A Lecture 6

O(1) How long does a function take to run? CS61A Lecture 6 How long does a function take to run? It depends on what computer it is run on! CS6A Lecture 6 20-06-28 Colleen Lewis Assumptions We want something independent of the speed of the computer We typically

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Math 142, Exam 1 Information.

Math 142, Exam 1 Information. Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam. 15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

11/28/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Announcements. Announcements. Announcements

11/28/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Announcements. Announcements. Announcements Fiboncci (Leonrdo Pisno) 0-0? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS0 Fll 08 Announcements A: NO LATE DAYS. No need to put in time nd comments. We hve to grde quickly. No

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures

Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam. 15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Functor (1A) Young Won Lim 10/5/17

Functor (1A) Young Won Lim 10/5/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins. Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)

More information

Assignment 11 (The Last One) Due Date for Programs: December 13, 2016

Assignment 11 (The Last One) Due Date for Programs: December 13, 2016 Jonn Klukowsk jonnkl@cs.nyu.edu Due Dte for Progrms: December 13, 2016 Problem 1 (10 points): Wht does this code do? Tke look t code below nd output tht it produces. Try to figure out exctly wht is going

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

The Reciprocal Function Family. Objectives To graph reciprocal functions To graph translations of reciprocal functions

The Reciprocal Function Family. Objectives To graph reciprocal functions To graph translations of reciprocal functions - The Reciprocl Function Fmil Objectives To grph reciprocl functions To grph trnsltions of reciprocl functions Content Stndrds F.BF.3 Identif the effect on the grph of replcing f () b f() k, kf(), f(k),

More information

Mathematics Interventi. and Focused Mathematics Booster Packs Alignment to Eureka Math and Common Core State Standards

Mathematics Interventi. and Focused Mathematics Booster Packs Alignment to Eureka Math and Common Core State Standards Focused Mthemtics Intervention nd Focused Mthemtics Booster Pcks lignment to Eurek Mth nd Common Core Stte Stndrds Grdes K Finding Fctor Pirs Independent Prctice Lerning Obje ctives Write number tht is

More information

Summer Review Packet For Algebra 2 CP/Honors

Summer Review Packet For Algebra 2 CP/Honors Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES

UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS 1 COMPUTATION & LOGIC INSTRUCTIONS TO CANDIDATES UNIVERSITY OF EDINBURGH COLLEGE OF SCIENCE AND ENGINEERING SCHOOL OF INFORMATICS INFORMATICS COMPUTATION & LOGIC Sturdy st April 7 : to : INSTRUCTIONS TO CANDIDATES This is tke-home exercise. It will not

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Angle properties of lines and polygons

Angle properties of lines and polygons chievement Stndrd 91031 pply geometric resoning in solving problems Copy correctly Up to 3% of workbook Copying or scnning from ES workbooks is subject to the NZ Copyright ct which limits copying to 3%

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

EXPONENT RULES Add Multiply Subtraction Flip

EXPONENT RULES Add Multiply Subtraction Flip Algebr II Finl Em Review Nme Chpter 7 REVIEW: EXPONENT RULES Add Multiply Subtrction Flip Simplify the epression using the properties of eponents. Assume ll vribles re positive. 4 4. 8 8.. 4. 5. 9 9 5

More information

3 FRACTIONS. Before you start. Objectives

3 FRACTIONS. Before you start. Objectives FRATIONS Only one eighth of n iceberg shows bove the surfce of the wter, which leves most of it hidden. The lrgest northern hemisphere iceberg ws encountered ner Bffin Islnd in nd in 1. It ws 1 km long,

More information

Functor (1A) Young Won Lim 8/2/17

Functor (1A) Young Won Lim 8/2/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Reducing Costs with Duck Typing. Structural

Reducing Costs with Duck Typing. Structural Reducing Costs with Duck Typing Structurl 1 Duck Typing In computer progrmming with object-oriented progrmming lnguges, duck typing is lyer of progrmming lnguge nd design rules on top of typing. Typing

More information

Approximate computations

Approximate computations Living with floting-point numers Stndrd normlized representtion (sign + frction + exponent): Approximte computtions Rnges of vlues: Representtions for:, +, +0, 0, NN (not numer) Jordi Cortdell Deprtment

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012

Uninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012 1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras CS 3 : Computer Systems - II Shnkr Blchndrn (shnkr@cse.iitm.c.in) Dept. of Computer Science & Engineering IIT Mdrs Recp Differentite Between s nd s Truth Tbles b AND b OR NOT September 4, 27 Introduction

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

Context-Free Grammars

Context-Free Grammars Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

Lesson 11 MA Nick Egbert

Lesson 11 MA Nick Egbert Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

Study Guide for Exam 3

Study Guide for Exam 3 Mth 05 Elementry Algebr Fll 00 Study Guide for Em Em is scheduled for Thursdy, November 8 th nd ill cover chpters 5 nd. You my use "5" note crd (both sides) nd scientific clcultor. You re epected to no

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

Virtual Machine (Part I)

Virtual Machine (Part I) Hrvrd University CS Fll 2, Shimon Schocken Virtul Mchine (Prt I) Elements of Computing Systems Virtul Mchine I (Ch. 7) Motivtion clss clss Min Min sttic sttic x; x; function function void void min() min()

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

Solutions to Math 41 Final Exam December 12, 2011

Solutions to Math 41 Final Exam December 12, 2011 Solutions to Mth Finl Em December,. ( points) Find ech of the following its, with justifiction. If there is n infinite it, then eplin whether it is or. ( ) / ln() () (5 points) First we compute the it:

More information