GBS Bioinformatics Pipeline(s) Overview
|
|
- Hilda McDowell
- 6 years ago
- Views:
Transcription
1 GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from the coders.
2 Three Pipelines Discovery Pipeline Requires a reference genome Multiple steps to get to genotypes Hands on tutorial is based on this pipeline Production Pipeline Uses information from Discovery Pipeline One step from sequence to genotypes UNEAK Pipeline For species without a reference genome Fei Lu will present this tomorrow at 9:30
3 Vocabulary Sequence File Text file containing DNA sequence reads and supplemental information from the Illumina Platform. Taxa An individual sample GBS Bar Code A short known sequence of DNA used to assign a GBS Tag to its original Taxa Key File Text file used to assign a GBS Bar Code to a Taxa GBS Tag DNA sequence consisting of a cut site remnant and additional sequence. Plugin Tassel pipeline module that performs specific task
4 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
5 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
6 Raw Sequence (Qseq) HWI-ST GTCGATTCTGCTGACTTCATGGCTTCTGTTGACG HWI-ST GAGAATCAGCTTTTCCAACACCTTGAGTTTGAGT HWI-ST ATGTACTGCACCGTTGCAAGCGAGCACCACCAA HWI-ST CCAGCTCAGCCTGCATTCTTTCAAAAACTTCCAA HWI-ST GATTTTACTGCACATCGGTCTTGTCACACCAGCT HWI-ST TCACCCAGCATCACGCCCCTTCACATCCAGTAAA HWI-ST CTTGACTGCCACCATGAATATGTGTTCCAAGTGC HWI-ST CCACAACTGCTCCATCTTTTCCATGAGACATTGC HWI-ST GTATTCTGCACACGAATCAGCTGAGACACCAATT HWI-ST AATATGCCAGCAGTTAAGAGAGTTCAAGATCCAG HWI-ST CTCCCTGCGGGTGCGCGCGACCCATCTTCAGTT HWI-ST TGGTACGTCTGCGGAATGGCGTTTTTTATGCCTT HWI-ST GGACCTACTGCCCAAGAACGGCTCACCCATCAT HWI-ST GAGAATCAGCGTGTACGGGGCACGGGGTGACT HWI-ST TTCTCCAGCCGCATGGGCCGGAGACCAGAGAG HWI-ST GCGTCAGCAAATGCCCCAACAGCCAAGTCAGCA HWI-ST TAGGCCATCAGCTGACTTCCCGGGTGTGGAGAA HWI-ST GGACCTACTGCCGGCGGGACGAAAGCGGTTGT HWI-ST CTCCCTGTTGAAGCATGTGCAAAAGAGCTTGTTC HWI-ST CGCCTTATCTGCCCTCGCCGGTCATGGGGAGTG
7 Raw Sequence (Qseq) HWI-ST GTCGATTCTGCTGACTTCATGGCTTCTGTTGACG HWI-ST GAGAATCAGCTTTTCCAACACCTTGAGTTTGAGT HWI-ST ATGTACTGCACCGTTGCAAGCGAGCACCACCAA HWI-ST CCAGCTCAGCCTGCATTCTTTCAAAAACTTCCAA HWI-ST GATTTTACTGCACATCGGTCTTGTCACACCAGCT HWI-ST TCACCCAGCATCACGCCCCTTCACATCCAGTAAA HWI-ST CTTGACTGCCACCATGAATATGTGTTCCAAGTGC HWI-ST CCACAACTGCTCCATCTTTTCCATGAGACATTGC HWI-ST GTATTCTGCACACGAATCAGCTGAGACACCAATT HWI-ST AATATGCCAGCAGTTAAGAGAGTTCAAGATCCAG HWI-ST CTCCCTGCGGGTGCGCGCGACCCATCTTCAGTT HWI-ST TGGTACGTCTGCGGAATGGCGTTTTTTATGCCTT HWI-ST GGACCTACTGCCCAAGAACGGCTCACCCATCAT HWI-ST GAGAATCAGCGTGTACGGGGCACGGGGTGACT HWI-ST TTCTCCAGCCGCATGGGCCGGAGACCAGAGAG HWI-ST GCGTCAGCAAATGCCCCAACAGCCAAGTCAGCA HWI-ST TAGGCCATCAGCTGACTTCCCGGGTGTGGAGAA HWI-ST GGACCTACTGCCGGCGGGACGAAAGCGGTTGT HWI-ST CTCCCTGTTGAAGCATGTGCAAAAGAGCTTGTT HWI-ST CGCCTTATCTGCCCTCGCCGGTCATGGGGAGTG
8 Key File
9 Fragment from GBS library: GBS Tags Barcode adapter Cut site Insert Cut site Common adapter Good reads: (only the first 64 bases after the barcode are kept) typical read: Barcode Cut site Insert (first 64 bases) short fragment: Barcode Cut site Insert (<64bp) Cut site Common adapter chimera or partial digestion: Barcode Cut site Insert (<64bp) Cut site 2 nd Insert
10 Fragment from GBS library: GBS Tags Barcode adapter Cut site Insert Cut site Common adapter Good reads: (only the first 64 bases after the barcode are kept) typical read: Barcode Cut site Insert (first 64 bases) short fragment: Barcode Cut site Insert (<64bp) Cut site chimera or partial digestion: Barcode Cut site Insert (<64bp) Cut site
11 Fragment from GBS library: GBS Tags Barcode adapter Cut site Insert Cut site Common adapter Good reads: (only the first 64 bases after the barcode are kept) typical read: Barcode Cut site Insert (first 64 bases) short fragment: Barcode Cut site Insert (<64bp) Cut site chimera or partial digestion: Barcode Cut site Insert (<64bp) Cut site Rejected reads: Barcode Cut site Common adapter Not matching barcode and cut site remnant Contains N in first 64 bases after the barcode adapter dimer
12 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
13 Tag Counts With information from the key file, each sequence file is processed, tags are identified and counted. If a tag is shorter than 64 bases it is padded. The tags and counts are put into a tag count file for each sequence file. QseqToTagCountsPlugin / FastqToTagCountsPlugin
14 Master Tag Counts The individual tag count files are merged into a master tag count file. A minimum count is specified at the merge stage to exclude tags with low counts (likely sequencing errors). MergeMultipleTagCountsPlugin
15 Conversion of Tags to Fastq Sequence aligners do not work with the tag count file format. In preparation for the alignment step, the Master Tag Count file is converted to fastq format. TagCountsToFastqPlugin
16 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
17 Tag Alignment / TOPM The GBS pipeline uses an external aligner to do the initial alignment. The current version uses bowtie2 which produces the alignment in the SAM format. bowtie2 We convert the SAM file into our tags on physical map format (TOPM) SAMConverterPlugin
18 TOPM
19 So Far We Have Identified and counted GBS tags. Converted tag counts file to fastq. Aligned the tags to a reference. Converted the alignment to TOPM.
20 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
21 Tags by Taxa In this step we identify which tags are present in which taxa. Original Sequence Files Key File Master Tag Count File Recently migrated to HDF5 file format. Efficient storage Large data sets SeqToTBTHDF5Plugin
22 Tags By Taxa Additional Operations If many TBTs have been created they are merged into 1 TBT. Taxa that were sequenced multiple times are merged. The TBT table is pivoted in preparation for SNP calling. ModifyTBTHDF5Plugin
23 GBS Discovery Pipeline Discovery Sequence Tags by Taxa Tag Counts TOPM SNP Caller
24 SNP Calling Files used in SNP Calling TOPM TBT Pedigree File (optional) Some Key Settings mnf MinimumF (inbreeding coefficient) mnmaf Minimum Minor Allele Frequency mnmac Minimum Minor Allele Count mnlcov Minimum Locus Coverage TagsToSNPByAlignmentPlugin
25 HapMap rs# alleles chrom pos strand SgSBRIL067:633Y5AAXX:2:C9 SgSBRIL019:633Y5AAXX:2:C3 S1_2100 A/G N N N N N N N R N A N S1_2163 T/C N N N N N N T C T T N S1_13837 T/G N N N N N N N G N N T S1_14606 C/T N N C N N N T T T T C S1_2061 T/A T N N N N N N A N N N S1_68332 C/T N N N N N N N N N N N S1_68596 A/T A N N N N N N N N A N S1_69309 G/A N G N N N N N A N N N S1_79955 T/G N T G T T N T T N N N S1_79961 T/G N T T T T N T T N N N S1_80584 G N N N N N N N N N N G S1_80647 C/T N N N N N N N C N N C S1_81274 T/G N N N N N N T G N N N S1_ G/A N N N N N N N N N N N S1_ T/G N N N N N N K T N N N S1_ C/T N N N N N N T C N T S1_ T/C N N N N N N N C N N N S1_ G/A G G A N N G G G G N S1_ T/G N N T N N N T T N N T S1_ A/G N A G N N N G A N N N S1_ C/T N N N N C N N C N N N S1_ T/C N T N N N N
26 Discovery Fastq GBS Discovery pipeline Tags by Taxa Tag Counts TOPM SNP Caller
27 Discovery Fastq GBS Discovery pipeline Tags by Taxa Tag Counts TOPM SNP Caller Filtered
28 Production Pipeline
29 Why another pipeline? The last maize build (30000 taxa) with the discovery pipeline took weeks. Most common alleles have been identified after the first few discovery builds. Use the information from the discovery pipeline to call SNPs in new runs quickly. Improve efficiency and automate.
30 GBS Bioinformatics Pipelines Discovery Production Fastq Fastq Tags by Taxa Tag Counts TOPM SNP Caller
31 Discovery Fastq Production Fastq Tags by Taxa Tag Counts TOPM TagsOnPhysicalMap (TOPM) SNP Caller
32 GBS Bioinformatics Pipelines Discovery Production Fastq Fastq Tags by Taxa Tag Counts TOPM SNP Caller Filtered
33 GBS Bioinformatics Pipelines Discovery Production Fastq Fastq Tags by Taxa Tag Counts TOPM TOPM SNP Caller Filtered
34 GBS Bioinformatics Pipelines Discovery Production Fastq Fastq Tags by Taxa Tag Counts TOPM TOPM SNP Caller Filtered
35 GBS Bioinformatics Pipelines Discovery Production Fastq Fastq Tags by Taxa Tag Counts TOPM TOPM SNP Caller Filtered
36 Running the Production Pipeline Required Files: Sequence file (fastq or qseq) Key file Production TOPM TASSEL 3 Standalone & RawReadsToHapMapPlugin Running the Pipeline: One lane processed at a time HapMap files by chromosome ~40 minutes
37 Testing Production Pipeline Compared HapMap files produced by Discovery Pipeline and Production Pipeline Site Comparison: Discovery 48,139 Production 47,676 Difference due to maximum 8 alleles 99.98% correlation of genetic distance matrices
38 Next Steps In Pipeline Development Hierarchical Data Format supports very large data sets and complex data structures. Working to fuse TOPM, TBT, Keyfile, and Pedigree File into one HDF5 repository. Continued improvements to SNP caller. Ability to use tags not present in the reference.
Using the GBS Analysis Pipeline Tutorial
Using the GBS Analysis Pipeline Tutorial Cornell CBSU/IGD GBS Bioinformatics Workshop September 13 & 14 2012 Step 0: If one of the CBSU BioHPC Lab workstations was reserved for you, it will be listed on
More informationTASSEL 3 Discovery pipeline and the CGRB GBS service. CGRB GBS Workshop Ma0hew Peterson
TASSEL 3 Discovery pipeline and the CGRB GBS service CGRB GBS Workshop Ma0hew Peterson ma0hew@cgrb.oregonstate.edu 2017-01-17 Overview TASSEL 3 Trait Analysis by associafon, EvoluFon and Linkage (TASSEL)
More informationOverview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University
Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )
More informationOverview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University
Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationHaplotag: Software for Haplotype-Based Genotyping-by-Sequencing (GBS) Analysis User Manual (2016-January-12)
File S1 Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing (GBS) Analysis User Manual (2016-January-12) Author: Nick Tinker (nick.tinker@agr.gc.ca) Citing Haplotag: Tinker, N.A., W.A. Bekele,
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More informationIdentiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationv0.2.0 XX:Z:UA - Unassigned XX:Z:G1 - Genome 1-specific XX:Z:G2 - Genome 2-specific XX:Z:CF - Conflicting
October 08, 2015 v0.2.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationWeb service platform to provide access to maize diversity data
Graduate Theses and Dissertations Graduate College 2015 Web service platform to provide access to maize diversity data Abhinav Vinnakota Iowa State University Follow this and additional works at: http://lib.dr.iastate.edu/etd
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationQIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
More informationv0.3.0 May 18, 2016 SNPsplit operates in two stages:
May 18, 2016 v0.3.0 SNPsplit is an allele-specific alignment sorter which is designed to read alignment files in SAM/ BAM format and determine the allelic origin of reads that cover known SNP positions.
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationfreebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger of Iowa May 19, 2015
freebayes in depth: model, filtering, and walkthrough Erik Garrison Wellcome Trust Sanger Institute @University of Iowa May 19, 2015 Overview 1. Primary filtering: Bayesian callers 2. Post-call filtering:
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationEpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationSupplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
More informationBGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14)
BGGN-213: FOUNDATIONS OF BIOINFORMATICS (Lecture 14) Genome Informatics (Part 1) https://bioboot.github.io/bggn213_f17/lectures/#14 Dr. Barry Grant Nov 2017 Overview: The purpose of this lab session is
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationPractical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State
Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationNetwork Based Models For Analysis of SNPs Yalta Opt
Outline Network Based Models For Analysis of Yalta Optimization Conference 2010 Network Science Zeynep Ertem*, Sergiy Butenko*, Clare Gill** *Department of Industrial and Systems Engineering, **Department
More informationPackage SimGbyE. July 20, 2009
Package SimGbyE July 20, 2009 Type Package Title Simulated case/control or survival data sets with genetic and environmental interactions. Author Melanie Wilson Maintainer Melanie
More informationHandling sam and vcf data, quality control
Handling sam and vcf data, quality control We continue with the earlier analyses and get some new data: cd ~/session_3 wget http://wasabiapp.org/vbox/data/session_4/file3.tgz tar xzf file3.tgz wget http://wasabiapp.org/vbox/data/session_4/file4.tgz
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationAgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
More informationMaximizing Public Data Sources for Sequencing and GWAS
Maximizing Public Data Sources for Sequencing and GWAS February 4, 2014 G Bryce Christensen Director of Services Questions during the presentation Use the Questions pane in your GoToWebinar window Agenda
More informationMiSeq Reporter TruSight Tumor 15 Workflow Guide
MiSeq Reporter TruSight Tumor 15 Workflow Guide For Research Use Only. Not for use in diagnostic procedures. Introduction 3 TruSight Tumor 15 Workflow Overview 4 Reports 8 Analysis Output Files 9 Manifest
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationGSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
More informationSupplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).
Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationGenomeStudio Software Release Notes
GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation
More informationRAD Population Genomics Programs Paul Hohenlohe 6/2014
RAD Population Genomics Programs Paul Hohenlohe (hohenlohe@uidaho.edu) 6/2014 I. Overview These programs are designed to conduct population genomic analysis on RAD sequencing data. They were designed for
More informationGenetic type 1 Error Calculator (GEC)
Genetic type 1 Error Calculator (GEC) (Version 0.2) User Manual Miao-Xin Li Department of Psychiatry and State Key Laboratory for Cognitive and Brain Sciences; the Centre for Reproduction, Development
More informationThe Analysis of RAD-tag Data for Association Studies
EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to
More informationProtocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data
Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification data Table of Contents Protocol: peak-calling for ChIP-seq data / segmentation analysis for histone modification
More informationde novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare
More informationUnder the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
More informationUSING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)
USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are
More informationdbcamplicons pipeline Bioinformatics
dbcamplicons pipeline Bioinformatics Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Workshop dataset: Slashpile
More informationNGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea
NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama
More informationImporting and Merging Data Tutorial
Importing and Merging Data Tutorial Release 1.0 Golden Helix, Inc. February 17, 2012 Contents 1. Overview 2 2. Import Pedigree Data 4 3. Import Phenotypic Data 6 4. Import Genetic Data 8 5. Import and
More informationREADME _EPGV_DataTransfer_Illumina Sequencing
README _EPGV_DataTransfer_Illumina Sequencing I. Delivered files / Paired-ends (PE) sequences... 2 II. Flowcell (FC) Nomenclature... 2 III. Quality Control Process and EPGV Cleaning Version 1.7... 4 A.
More informationSequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
More informationGenome Assembly Using de Bruijn Graphs. Biostatistics 666
Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position
More informationAtlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
More informationForensic Resource/Reference On Genetics knowledge base: FROG-kb User s Manual. Updated June, 2017
Forensic Resource/Reference On Genetics knowledge base: FROG-kb User s Manual Updated June, 2017 Table of Contents 1. Introduction... 1 2. Accessing FROG-kb Home Page and Features... 1 3. Home Page and
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationRunning SNAP. The SNAP Team February 2012
Running SNAP The SNAP Team February 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More
More informationRASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual
RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual July 02, 2015 1 Index 1. System requirement and how to download RASER source code...3 2. Installation...3 3. Making index files...3
More informationSAM / BAM Tutorial. EMBL Heidelberg. Course Materials. Tobias Rausch September 2012
SAM / BAM Tutorial EMBL Heidelberg Course Materials Tobias Rausch September 2012 Contents 1 SAM / BAM 3 1.1 Introduction................................... 3 1.2 Tasks.......................................
More informationMPG NGS workshop I: Quality assessment of SNP calls
MPG NGS workshop I: Quality assessment of SNP calls Kiran V Garimella (kiran@broadinstitute.org) Genome Sequencing and Analysis Medical and Population Genetics February 4, 2010 SNP calling workflow Filesize*
More informationPeter Schweitzer, Director, DNA Sequencing and Genotyping Lab
The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors
More information4.1. Access the internet and log on to the UCSC Genome Bioinformatics Web Page (Figure 1-
1. PURPOSE To provide instructions for finding rs Numbers (SNP database ID numbers) and increasing sequence length by utilizing the UCSC Genome Bioinformatics Database. 2. MATERIALS 2.1. Sequence Information
More informationExome sequencing. Jong Kyoung Kim
Exome sequencing Jong Kyoung Kim Genome Analysis Toolkit The GATK is the industry standard for identifying SNPs and indels in germline DNA and RNAseq data. Its scope is now expanding to include somatic
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationMapping, Alignment and SNP Calling
Mapping, Alignment and SNP Calling Heng Li Broad Institute MPG Next Gen Workshop 2011 Heng Li (Broad Institute) Mapping, alignment and SNP calling 17 February 2011 1 / 19 Outline 1 Mapping Messages from
More informationMinimum Information for Reporting Immunogenomic NGS Genotyping (MIRING)
Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) Reporting guideline statement for HLA and KIR genotyping data generated via Next Generation Sequencing (NGS) technologies and analysis
More informationHIPPIE User Manual. (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu)
HIPPIE User Manual (v0.0.2-beta, 2015/4/26, Yih-Chii Hwang, yihhwang [at] mail.med.upenn.edu) OVERVIEW OF HIPPIE o Flowchart of HIPPIE o Requirements PREPARE DIRECTORY STRUCTURE FOR HIPPIE EXECUTION o
More informationData Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis
Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads
More informationPerl for Biologists. Practical example. Session 14 June 3, Robert Bukowski. Session 14: Practical example Perl for Biologists 1.
Perl for Biologists Session 14 June 3, 2015 Practical example Robert Bukowski Session 14: Practical example Perl for Biologists 1.2 1 Session 13 review Process is an object of UNIX (Linux) kernel identified
More informationMIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
More informationSAMtools. SAM BAM. mapping. BAM sort & indexing (ex: IGV) SNP call
SAMtools http://samtools.sourceforge.net/ SAM/BAM mapping BAM SAM BAM BAM sort & indexing (ex: IGV) mapping SNP call SAMtools NGS Program: samtools (Tools for alignments in the SAM format) Version: 0.1.19
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationAxiom Analysis Suite Release Notes (For research use only. Not for use in diagnostic procedures.)
Axiom Analysis Suite 4.0.1 Release Notes (For research use only. Not for use in diagnostic procedures.) Axiom Analysis Suite 4.0.1 includes the following changes/updates: 1. For library packages that support
More informationClick on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:
CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationTutorial. Find Very Low Frequency Variants With QIAGEN GeneRead Panels. Sample to Insight. November 21, 2017
Find Very Low Frequency Variants With QIAGEN GeneRead Panels November 21, 2017 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com
More informationOmixon PreciseAlign CLC Genomics Workbench plug-in
Omixon PreciseAlign CLC Genomics Workbench plug-in User Manual User manual for Omixon PreciseAlign plug-in CLC Genomics Workbench plug-in (all platforms) CLC Genomics Server plug-in (all platforms) January
More informationRunning SNAP. The SNAP Team October 2012
Running SNAP The SNAP Team October 2012 1 Introduction SNAP is a tool that is intended to serve as the read aligner in a gene sequencing pipeline. Its theory of operation is described in Faster and More
More informationStep-by-Step Guide to Relatedness and Association Mapping Contents
Step-by-Step Guide to Relatedness and Association Mapping Contents OBJECTIVES... 2 INTRODUCTION... 2 RELATEDNESS MEASURES... 2 POPULATION STRUCTURE... 6 Q-K ASSOCIATION ANALYSIS... 10 K MATRIX COMPRESSION...
More informationOmega: an Overlap-graph de novo Assembler for Metagenomics
Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n
More informationUser's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
More informationChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationSAM and VCF formats. UCD Genome Center Bioinformatics Core Tuesday 14 June 2016
SAM and VCF formats UCD Genome Center Bioinformatics Core Tuesday 14 June 2016 File Format: SAM / BAM / CRAM! NEW http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationDeltaGen: Quick start manual
1 DeltaGen: Quick start manual Dr. Zulfi Jahufer & Dr. Dongwen Luo CONTENTS Page Main operations tab commands 2 Uploading a data file 3 Matching variable identifiers 4 Data check 5 Univariate analysis
More informationTaller práctico sobre uso, manejo y gestión de recursos genómicos de abril de 2013 Assembling long-read Transcriptomics
Taller práctico sobre uso, manejo y gestión de recursos genómicos 22-24 de abril de 2013 Assembling long-read Transcriptomics Rocío Bautista Outline Introduction How assembly Tools assembling long-read
More informationApplications of a generic model of genomic variations functional analysis
Applications of a generic model of genomic variations functional analysis Sarah N. Mapelli, Uberto Pozzoli data annotations variations FUNCTION The tools developer point of view: a general analysis flow
More informationCover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/32015 holds various files of this Leiden University dissertation. Author: Akker, Erik Ben van den Title: Computational biology in human aging : an omics
More informationUsing Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
More informationThe software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA-MEM).
Release Notes Agilent SureCall 3.5 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional
More informationAnalysis of RAD-seq data for InterSpecific phylogeny
Analysis of RAD-seq data for InterSpecific phylogeny Astrid Cruaud 1, Mathieu Gautier 12, Jean-Pierre Rossi 1, Jean-Yves Rasplus 1, Jérôme Gouzy 34 1 INRA, UMR1062 CBGP, F-34988 Montferrier-sur-Lez, France
More informationSpotter Documentation Version 0.5, Released 4/12/2010
Spotter Documentation Version 0.5, Released 4/12/2010 Purpose Spotter is a program for delineating an association signal from a genome wide association study using features such as recombination rates,
More information