DNA / RNA sequencing

Size: px
Start display at page:

Download "DNA / RNA sequencing"

Transcription

1

2 Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using Unix to look at large files Manipulating large files in Unix

3

4

5 DNA / RNA sequencing Sanger Long reads (800 bp), high quality targeted (primers), slow, expensive, hard to automate 454 Long reads ( bp), fairly high quality Insertions/deletions, library prep is expensive, not cheap Illumina Many, many reads, high quality Short(ish) 100bp-250bp Ion torrent error rates, throughput PacBio high error rates (10-15% errors) but very long reads (up to 100kb) Oxford nanopore

6 DNA / RNA sequencing Sanger Long reads (800 bp), high quality targeted (primers), slow, expensive, hard to automate 454 Long reads ( bp), fairly high quality Insertions/deletions, library prep is expensive, not cheap Illumina Many, many reads, high quality Short(ish) 100bp-250bp Ion torrent error rates, throughput PacBio high error rates (10-15% errors) but very long reads (up to 100kb) Oxford nanopore

7

8 DNA / RNA sequencing Sanger Long reads (800 bp), high quality targeted (primers), slow, expensive, hard to automate 454 Long reads ( bp), fairly high quality Insertions/deletions, library prep is expensive, not cheap Illumina Many, many reads, high quality Short(ish) 100bp-250bp Ion torrent high error rates, throughput PacBio high error rates (10-15% errors) but very long reads (up to 100kb) Oxford nanopore

9

10 DNA / RNA sequencing Sanger Long reads (800 bp), high quality targeted (primers), slow, expensive, hard to automate 454 Long reads ( bp), fairly high quality Insertions/deletions, library prep is expensive, not cheap Illumina Many, many reads, high quality Short(ish) 100bp-250bp Ion torrent error rates, throughput PacBio high error rates (10-15% errors) but very long reads (up to 100kb) Oxford nanopore

11 /next-gen-fieldguide-2014/

12

13 Illumina library prep Shear the DNA to specific fragment length Ligate on adaptors and barcodes

14

15

16 Illumina sequencing

17 Illumina sequencing

18

19 Illumina sequencing

20

21 Data formats Fasta Fastq.fastq.fq.fq.txt.fastq.txt SAM BAM

22 Basic Unix Unix tutorial Standard commands: pwd print working directory ls list contents of working directory cd change working directory less look at a text file man read the manual how to use a command wget get a file from another machine

23

24

25

26 An example dataset These files are already on Reference genome Arabidopsis mitochondrion wget ftp://ftp.arabidopsis.org/home/tair/sequences/mitochondrial/mitochondrial_genomic_sequence Illumina sequence for another genotype (you may have to uncompress this file)

27 Data formats Fasta Fastq.fastq.fq.fq.txt.fastq.txt SAM BAM

28 Fasta format

29 Fasta format First line: a > symbol, and a sequence name After that 1 or more lines of sequence data May have another header and other sequence after that or many headers and sequences >Cannabis sativa CBDAS mrna for cannabidiolic acid synthase, complete cds ATGAAGTGCTCAACATTCTCCTTTTGGTTTGTTTGCAAGATAATATTTTTCTTTTTCTCATTCAATATCC AAACTTCCATTGCTAATCCTCGAGAAAACTTCCTTAAATGCTTCTCGCAATATATTCCCAATAATGCAAC AAATCTAAAACTCGTATACACTCAAAACAACCCATTGTATATGTCTGTCCTAAATTCGACAATACACAAT CTTAGATTCACCTCTGACACAACCCCAAAACCACTTGTTATCGTCACTCCTTCACATGTCTCTCATATCC AAGGCACTATTCTATGCTCCAAGAAAGTTGGCTTGCAGATTCGAACTCGAAGTGGTGGTCATGATTCTGA GGGCATGTCCTACATATCTCAAGTCCCATTTGTTATAGTAGACTTGAGAAACATGCGTTCAATCAAAATA GATGTTCATAGCCAAACTGCATGGGTTGAAGCCGGAGCTACCCTTGGAGAAGTTTATTATTGGGTTAATG AGAAAAATGAGAATCTTAGTTTGGCGGCTGGGTATTGCCCTACTGTTTGCGCAGGTGGACACTTTGGTGG AGGAGGCTATGGACCATTGATGAGAAACTATGGCCTCGCGGCTGATAATATCATTGATGCACACTTAGTC

30 Now, look at the file mt.fa How do we look at this sequence? What do we know about this sequence? How do you know?

31 Data formats Fasta Fastq.fastq.fq.fq.txt.fastq.txt SAM BAM

32 Fastq format 4 line repeating pattern: 1. Header line, starting 2. DNA sequence (ATGCN) 3. spacer line, starting with + 4. Sequence quality scores

33 Looking at a fastq file using less

34 Fastq ASCII quality scores

35 Illumina quality scores Sanger format 0 to 93 using ASCII 33 to 126 Solexa/Illumina 1.0 format -5 to 62 using ASCII 59 to 126 Illumina 1.3+ format 0 to 62 using ASCII 64 to 126 Illumina and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a Read Segment Quality Control Indicator [6].

36 Fastq ASCII quality scores

37 Looking at a fastq file using less

38 Examining the data Look at the fastq file - Less SRR fastq Please work in groups of 2-4 again, and figure out which quality score type is this?

39 Illumina quality scores Sanger format 0 to 93 using ASCII 33 to 126 Solexa/Illumina 1.0 format -5 to 62 using ASCII 59 to 126 Illumina 1.3+ format 0 to 62 using ASCII 64 to 126 Illumina and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a Read Segment Quality Control Indicator [6].

40

41 Evaluating quality Fastqc - a good program for quality metrics fastqc sra_data.fastq

42 For Thursday Do modules 3-4 in the tutorial Read up on fastq files:

43

44

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF

RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

RNA-seq Data Analysis

RNA-seq Data Analysis Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها

More information

Understanding and Pre-processing Raw Illumina Data

Understanding and Pre-processing Raw Illumina Data Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

NGS : reads quality control

NGS : reads quality control NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq

More information

Sequence Data Quality Assessment Exercises and Solutions.

Sequence Data Quality Assessment Exercises and Solutions. Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors

More information

Copyright 2014 Regents of the University of Minnesota

Copyright 2014 Regents of the University of Minnesota Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................

More information

Trimming and quality control ( )

Trimming and quality control ( ) Trimming and quality control (2015-06-03) Alexander Jueterbock, Martin Jakt PhD course: High throughput sequencing of non-model organisms Contents 1 Overview of sequence lengths 2 2 Quality control 3 3

More information

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.

These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi

Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise

More information

Genomics AGRY Michael Gribskov Hock 331

Genomics AGRY Michael Gribskov Hock 331 Genomics AGRY 60000 Michael Gribskov gribskov@purdue.edu Hock 331 Computing Essentials Resources In this course we will assemble and annotate both genomic and transcriptomic sequence assemblies We will

More information

BIT 815: Analysis of Deep DNA Sequencing Data

BIT 815: Analysis of Deep DNA Sequencing Data BIT 815: Analysis of Deep DNA Sequencing Data Overview: This course covers methods for analysis of data from high-throughput DNA sequencing, with or without a reference genome sequence, using free and

More information

NGS NEXT GENERATION SEQUENCING

NGS NEXT GENERATION SEQUENCING NGS NEXT GENERATION SEQUENCING Paestum (Sa) 15-16 -17 maggio 2014 Relatore Dr Cataldo Senatore Dr.ssa Emilia Vaccaro Sanger Sequencing Reactions For given template DNA, it s like PCR except: Uses only

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

DNA Sequencing analysis on Artemis

DNA Sequencing analysis on Artemis DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer

More information

NGS Analysis Using Galaxy

NGS Analysis Using Galaxy NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises

More information

Importing your Exeter NGS data into Galaxy:

Importing your Exeter NGS data into Galaxy: Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina

More information

An Introduction to Linux and Bowtie

An Introduction to Linux and Bowtie An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use

More information

MetaPhyler Usage Manual

MetaPhyler Usage Manual MetaPhyler Usage Manual Bo Liu boliu@umiacs.umd.edu March 13, 2012 Contents 1 What is MetaPhyler 1 2 Installation 1 3 Quick Start 2 3.1 Taxonomic profiling for metagenomic sequences.............. 2 3.2

More information

Package Rsubread. July 21, 2013

Package Rsubread. July 21, 2013 Package Rsubread July 21, 2013 Type Package Title Rsubread: an R package for the alignment, summarization and analyses of next-generation sequencing data Version 1.10.5 Author Wei Shi and Yang Liao with

More information

Contact: Raymond Hovey Genomics Center - SFS

Contact: Raymond Hovey Genomics Center - SFS Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon. 20-30 minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad

More information

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab

NGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control

More information

README _EPGV_DataTransfer_Illumina Sequencing

README _EPGV_DataTransfer_Illumina Sequencing README _EPGV_DataTransfer_Illumina Sequencing I. Delivered files / Paired-ends (PE) sequences... 2 II. Flowcell (FC) Nomenclature... 2 III. Quality Control Process and EPGV Cleaning Version 1.7... 4 A.

More information

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS

More information

Galaxy workshop at the Winter School Igor Makunin

Galaxy workshop at the Winter School Igor Makunin Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis

More information

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare

More information

ASAP - Allele-specific alignment pipeline

ASAP - Allele-specific alignment pipeline ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your

More information

High-throughout sequencing and using short-read aligners. Simon Anders

High-throughout sequencing and using short-read aligners. Simon Anders High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel

More information

Lecture 8. Sequence alignments

Lecture 8. Sequence alignments Lecture 8 Sequence alignments DATA FORMATS bioawk bioawk is a program that extends awk s powerful processing of tabular data to processing tasks involving common bioinformatics formats like FASTA/FASTQ,

More information

Sep. Guide. Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037

Sep. Guide.  Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Sep 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Corp. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated

More information

1. Download the data from ENA and QC it:

1. Download the data from ENA and QC it: GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You

More information

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis

Data Preprocessing : Next Generation Sequencing analysis CBS - DTU Next Generation Sequencing Analysis Data Preprocessing 27626: Next Generation Sequencing analysis CBS - DTU Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

Data Preprocessing. Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis Data Preprocessing Next Generation Sequencing analysis DTU Bioinformatics Generalized NGS analysis Data size Application Assembly: Compare Raw Pre- specific: Question Alignment / samples / Answer? reads

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

Quality assessment of NGS data

Quality assessment of NGS data Quality assessment of NGS data Ines de Santiago July 27, 2015 Contents 1 Introduction 1 2 Checking read quality with FASTQC 1 3 Preprocessing with FASTX-Toolkit 2 3.1 Preprocessing with FASTX-Toolkit:

More information

Nevada Genomics Center

Nevada Genomics Center Nevada Genomics Center These are general instructions on how to use dnatools to submit next generation sequencing samples to be run on either the Ion Torrent Proton or the Illumina NextSeq500. We here

More information

Quantitative Biology Bootcamp Intro to Unix: Command Line Interface

Quantitative Biology Bootcamp Intro to Unix: Command Line Interface Quantitative Biology Bootcamp Intro to Unix: Command Line Interface Frederick J Tan Bioinformatics Research Faculty Carnegie Institution of Washington, Department of Embryology 2 September 2014 Running

More information

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory

Pre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw

More information

Rsubread package: high-performance read alignment, quantification and mutation discovery

Rsubread package: high-performance read alignment, quantification and mutation discovery Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For

More information

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1

EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on

More information

The Analysis of RAD-tag Data for Association Studies

The Analysis of RAD-tag Data for Association Studies EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to

More information

2015 Workshop on Genomics. Genomics Laboratory

2015 Workshop on Genomics. Genomics Laboratory 2015 Workshop on Genomics Genomics Laboratory Instructors: Konrad Paszkiewicz k.h.paszkiewicz@exeter.ac.uk Objectives: By the end of the lab you will be expected to: Understand how short reads are generated.

More information

Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018)

Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Darwin: A Genomic Co-processor gives up to 15,000X speedup on long read assembly (To appear in ASPLOS 2018) Yatish Turakhia EE PhD candidate Stanford University Prof. Bill Dally (Electrical Engineering

More information

Mar. Guide. Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037

Mar. Guide.  Edico Genome Inc North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Mar 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Inc. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual

RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual July 02, 2015 1 Index 1. System requirement and how to download RASER source code...3 2. Installation...3 3. Making index files...3

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,

More information

Genomic Files. University of Massachusetts Medical School. October, 2014

Genomic Files. University of Massachusetts Medical School. October, 2014 .. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Ensembl RNASeq Practical. Overview

Ensembl RNASeq Practical. Overview Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted

More information

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg

High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,

More information

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013

ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were

More information

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013

RNAseq analysis: SNP calling. BTI bioinformatics course, spring 2013 RNAseq analysis: SNP calling BTI bioinformatics course, spring 2013 RNAseq overview RNAseq overview Choose technology 454 Illumina SOLiD 3 rd generation (Ion Torrent, PacBio) Library types Single reads

More information

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux

User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux User's Guide to DNASTAR SeqMan NGen 12.0 For Windows, Macintosh and Linux DNASTAR, Inc. 2014 Contents SeqMan NGen Overview...7 Wizard Navigation...8 Non-English Keyboards...8 Before You Begin...9 The

More information

Sentieon Documentation

Sentieon Documentation Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Illumina Next Generation Sequencing Data analysis

Illumina Next Generation Sequencing Data analysis Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,

More information

Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)

Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only

More information

Single/paired-end RNAseq analysis with Galaxy

Single/paired-end RNAseq analysis with Galaxy October 016 Single/paired-end RNAseq analysis with Galaxy Contents: 1. Introduction. Quality control 3. Alignment 4. Normalization and read counts 5. Workflow overview 6. Sample data set to test the paired-end

More information

Genome 373: Mapping Short Sequence Reads III. Doug Fowler

Genome 373: Mapping Short Sequence Reads III. Doug Fowler Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related

More information

Fusion Detection Using QIAseq RNAscan Panels

Fusion Detection Using QIAseq RNAscan Panels Fusion Detection Using QIAseq RNAscan Panels June 11, 2018 Sample to Insight QIAGEN Aarhus Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.qiagenbioinformatics.com ts-bioinformatics@qiagen.com

More information

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.

SAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional. Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference

More information

ls /data/atrnaseq/ egrep "(fastq fasta fq fa)\.gz" ls /data/atrnaseq/ egrep "(cn ts)[1-3]ln[^3a-za-z]\."

ls /data/atrnaseq/ egrep (fastq fasta fq fa)\.gz ls /data/atrnaseq/ egrep (cn ts)[1-3]ln[^3a-za-z]\. Command line tools - bash, awk and sed We can only explore a small fraction of the capabilities of the bash shell and command-line utilities in Linux during this course. An entire course could be taught

More information

SMRT-Portal Exercises. J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015

SMRT-Portal Exercises. J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015 SMRT-Portal Exercises J Fass UCD Genome Center Bioinformatics Core Thursday April 16, 2015 Running SMRT-Portal in AWS see PacBio documentation We ll be running a virtual machine (VM) in the Amazon Web

More information

Mapping reads to a reference genome

Mapping reads to a reference genome Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture

More information

GALAXY BIOINFORMATICS WORKFLOW ENVIRONMENT. Rutger Vos, 3 April 2012

GALAXY BIOINFORMATICS WORKFLOW ENVIRONMENT. Rutger Vos, 3 April 2012 GALAXY BIOINFORMATICS WORKFLOW ENVIRONMENT Rutger Vos, 3 April 2012 Overview Informatics in the post-genomic era The past (?) Analyses glued together using scripting languages, directly on the CLI or in

More information

2013 Workshop on Genomics, Cesky Krumlov

2013 Workshop on Genomics, Cesky Krumlov 2013 Workshop on Genomics, Cesky Krumlov Instructors: Part 1: Short read genomics: Remapping Konrad Paszkiewicz k.h.paszkiewicz at exeter ac uk Objectives: By the end of the workshop you will be expected

More information

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.

ChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute. ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing

More information

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata

Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis

More information

ChIP-seq hands-on practical using Galaxy

ChIP-seq hands-on practical using Galaxy ChIP-seq hands-on practical using Galaxy In this exercise we will cover some of the basic NGS analysis steps for ChIP-seq using the Galaxy framework: Quality control Mapping of reads using Bowtie2 Peak-calling

More information

Helpful Galaxy screencasts are available at:

Helpful Galaxy screencasts are available at: This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and

More information

Subread/Rsubread Users Guide

Subread/Rsubread Users Guide Subread/Rsubread Users Guide Rsubread v1.32.3/subread v1.6.3 25 February 2019 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne

More information

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima

ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis

More information

Functional Genomics Research Stream. Computational Meeting: March 29, 2012 RNA-seq Analysis Pipeline

Functional Genomics Research Stream. Computational Meeting: March 29, 2012 RNA-seq Analysis Pipeline Functional Genomics Research Stream Computational Meeting: March 29, 2012 RNA-seq Analysis Pipeline CHAPTER 2 Prepare Whole Transcriptome Libraries Fragment the whole transcriptome RNA 100 500 µg poly(a)

More information

Integrative Genomics Viewer. Prat Thiru

Integrative Genomics Viewer. Prat Thiru Integrative Genomics Viewer Prat Thiru 1 Overview User Interface Basics Browsing the Data Data Formats IGV Tools Demo Outline Based on ISMB 2010 Tutorial by Robinson and Thorvaldsdottir 2 Why IGV? IGV

More information

de.nbi Nanopore Training Course Documentation Release latest

de.nbi Nanopore Training Course Documentation Release latest de.nbi Nanopore Training Course Documentation Release latest Sep 21, 2018 Contents 1 The Tutorial Data Set 3 2 Basecalling 5 2.1 Basecalling with Albacore........................................ 5 2.2

More information

Sequence Analysis Pipeline

Sequence Analysis Pipeline Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Introduction to UNIX command-line II

Introduction to UNIX command-line II Introduction to UNIX command-line II Boyce Thompson Institute 2017 Prashant Hosmani Class Content Terminal file system navigation Wildcards, shortcuts and special characters File permissions Compression

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

Genomic Files. University of Massachusetts Medical School. October, 2015

Genomic Files. University of Massachusetts Medical School. October, 2015 .. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further

More information

Quality Control of Sequencing Data

Quality Control of Sequencing Data Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY ss2489@cornell.edu // Twitter:@SahaSurya BTI Plant Bioinformatics Course 2017 3/27/2017 BTI

More information

QIAseq DNA V3 Panel Analysis Plugin USER MANUAL

QIAseq DNA V3 Panel Analysis Plugin USER MANUAL QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus

More information

GBS Bioinformatics Pipeline(s) Overview

GBS Bioinformatics Pipeline(s) Overview GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from

More information

Using the GBS Analysis Pipeline Tutorial

Using the GBS Analysis Pipeline Tutorial Using the GBS Analysis Pipeline Tutorial Cornell CBSU/IGD GBS Bioinformatics Workshop September 13 & 14 2012 Step 0: If one of the CBSU BioHPC Lab workstations was reserved for you, it will be listed on

More information

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits

Run Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

For Research Use Only. Not for use in diagnostic procedures.

For Research Use Only. Not for use in diagnostic procedures. For Research Use Only. Not for use in diagnostic procedures. P/N 101-039-100 Version 06 (October 2018) Copyright 2017-2018, Pacific Biosciences of California, Inc. All rights reserved. Information in this

More information

USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)

USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012) USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are

More information

Mapping NGS reads for genomics studies

Mapping NGS reads for genomics studies Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization

More information

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching

SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching SlopMap: a software application tool for quick and flexible identification of similar sequences using exact k-mer matching Ilya Y. Zhbannikov 1, Samuel S. Hunter 1,2, Matthew L. Settles 1,2, and James

More information

Briefly: Bioinformatics File Formats. J Fass September 2018

Briefly: Bioinformatics File Formats. J Fass September 2018 Briefly: Bioinformatics File Formats J Fass September 2018 Overview ASCII Text Sequence Fasta, Fastq ~Annotation TSV, CSV, BED, GFF, GTF, VCF, SAM Binary (Data, Compressed, Executable) Data HDF5 BAM /

More information

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment:

Cyverse tutorial 1 Logging in to Cyverse and data management. Open an Internet browser window and navigate to the Cyverse discovery environment: Cyverse tutorial 1 Logging in to Cyverse and data management Open an Internet browser window and navigate to the Cyverse discovery environment: https://de.cyverse.org/de/ Click Log in with your CyVerse

More information

Package Rsubread. June 29, 2018

Package Rsubread. June 29, 2018 Version 1.30.4 Date 2018-06-22 Package Rsubread June 29, 2018 Title Subread sequence alignment and counting for R Author Wei Shi and Yang Liao with contributions from Gordon K Smyth, Jenny Dai and Timothy

More information

HMPL User Manual. Shuying Sun or Texas State University

HMPL User Manual. Shuying Sun or Texas State University HMPL User Manual Shuying Sun (ssun5211@yahoo.com or s_s355@txstate.edu), Texas State University Peng Li (pxl119@case.edu), Case Western Reserve University June 18, 2015 Contents 1. General Overview and

More information