Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University

Size: px
Start display at page:

Download "Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University"

Transcription

1 Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University

2 Overview of the Data Analysis Strategy

3 Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( ) 64-base sequence tag B73 < 450 bp Reduced genome representation; Reads can be aligned without reference genome;

4 Identification of markers with/without the reference genome B73 SNP and small INDELs Loss of cut site Mo17

5 Identification of Presence/Absence Variations (PAV) B73 Mo17

6 Reads -> Tags -> Aligned Tags -> SNPs/INDELs CAGCAAAAAAAAAAAAGAGGGATGGGGCGGCTTGCGTGCATGGGACACAAGCATGTAGACGGGC

7 Reads -> Tags -> Aligned Tags -> SNPs/INDELs Tag 1 Tag 2 Tag 3 CAGCAAAAAAAAAAAAGAGGGATGGGGCGGCTTGCGTGCATGGGACACAAGCATGTAGACGGGC.

8 Reads -> Tags -> Aligned Tags -> SNPs/INDELs Tag 1 Tag 2 Maize NAM population (5000 lines) 2.6 billion reads 6 million tags Tag 3 CAGCAAAAAAAAAAAAGAGGGATGGGGCGGCTTGCGTGCATGGGACACAAGCATGTAGACGGGC.

9 Reads -> Tags -> Aligned Tags -> SNPs/INDELs Two ways of alignments: a. Anchored to reference genome (regular pipeline) b. Pair-wise alignment between tags (UNEAK)

10 Reads -> Tags -> Aligned Tags -> ApeK I site SNPs/INDELs CAGCAAAAAAAAAAAAGAGGGATGGGGCGGCTTGCGTGCATGGGACACAAGCATGTAGACGGGC CAGCAAAAAAAAAAAAGAGGGATGGGGCGGCTTGCGTGCATGGGACACAAGCATGTAGACGGGC Reproducible sequencing errors

11 Summary of the GBS pipeline Tags Reads Aligned Tags Tags by Taxa SNP/INDEL HapMap Filtering

12 Summary of the GBS pipeline Reads Tags Aligned Tags Tags by Taxa All reads in the SNP/INDEL sequenced populations are merged to create HapMap Tag list. Filtering

13 Experimental Design 1. Depth of coverage 2. Choice of enzyme 3. Type of population

14 Depth of Coverage Whole Genome Shotgun GBS Sites Depths Tags Depths #Depth

15 Depth of coverage controled by multiplexing level and choice of enzyme Multiplexing level 48-plex, 96-plex, 384-plex Enzyme selection ApeKI GCWGC Expected size: 0.5 kb PstI CTGCAT Expected size: 4 kb

16 Population type determines method of filtering and imputation RIL population (used in exercise for this workshop) F1 hybrids of highly heterozygous parents Families with pedigree information

17 Pipeline Implementation

18 Three ways to access the software 1. Computers with GBS software pre-installed Cornell BioHPC Lab iplant Discovery Environment 2. Using pre-compiled Java code from Get the source code from sourceforge.net (Project name: TASSEL)

19 GBS Pipeline on Cornell BioHPC Lab (for both Cornell and external users only) Step 1: Reserve a machine

20 GBS Pipeline on Cornell BioHPC Lab Step 2: Upload files Fetch (mac), FileZilla (win) or WinSCP (win)

21 GBS Pipeline on Cornell BioHPC Lab Step 3: Type the command to run pipeline Mac: terminal window; PC: Putty tassel/run_pipeline.pl -fork1 -QseqToTagCountPlugin -i. -k rice.key -e apeki -endplugin -runfork1

22 Using iplant Two ways to upload files to iplant data store 1. Web interface 2. Command line tool: icommand

23 GBS on iplant Discovery Environment (Beta version now)

24 Set up the pre-compiled pipeline on your own computer A computer with at least 8GB or more RAM (Linux or Mac) Download TASSEL Standalone from maizegenetics.net Set up Java (64bit) BWA (for alignment to reference genome) Document for installation: Download the zip file: TASSEL_x.x _Standalone

25 Set up TASSEL source code in Netbeans (make user use 64-bit Java and Netbeans)

26 The intermediate files are compressed binary files BinaryToTextPlugin can be used to convert to text file Tag-Counts (TC): *.cnt.txt *.cnt Tag-by-taxa (TBT): *.tbt.txt *.tbt.bin Tags-on-physical-map (TOPM): *.topm.txt *.topm.bin Hapmap *.hmp.txt GDPDM blobs * 64 bp tags were represented as 2 long integers (8 bytes for long in Java).

27 1. Documentation of the tools Training project data is provided by Chih-Wei Tung & Susan McCouch.

Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University

Overview and Implementation of the GBS Pipeline. Qi Sun Computational Biology Service Unit Cornell University Overview and Implementation of the GBS Pipeline Qi Sun Computational Biology Service Unit Cornell University Overview of the Data Analysis Strategy Genotyping by Sequencing (GBS) ApeKI site (GCWGC) ( )

More information

Using the GBS Analysis Pipeline Tutorial

Using the GBS Analysis Pipeline Tutorial Using the GBS Analysis Pipeline Tutorial Cornell CBSU/IGD GBS Bioinformatics Workshop September 13 & 14 2012 Step 0: If one of the CBSU BioHPC Lab workstations was reserved for you, it will be listed on

More information

GBS Bioinformatics Pipeline(s) Overview

GBS Bioinformatics Pipeline(s) Overview GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from

More information

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection

CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for

More information

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing (GBS) Analysis User Manual (2016-January-12)

Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing (GBS) Analysis User Manual (2016-January-12) File S1 Haplotag: Software for Haplotype-Based Genotyping-by-Sequencing (GBS) Analysis User Manual (2016-January-12) Author: Nick Tinker (nick.tinker@agr.gc.ca) Citing Haplotag: Tinker, N.A., W.A. Bekele,

More information

TASSEL 3 Discovery pipeline and the CGRB GBS service. CGRB GBS Workshop Ma0hew Peterson

TASSEL 3 Discovery pipeline and the CGRB GBS service. CGRB GBS Workshop Ma0hew Peterson TASSEL 3 Discovery pipeline and the CGRB GBS service CGRB GBS Workshop Ma0hew Peterson ma0hew@cgrb.oregonstate.edu 2017-01-17 Overview TASSEL 3 Trait Analysis by associafon, EvoluFon and Linkage (TASSEL)

More information

Genome Assembly Using de Bruijn Graphs. Biostatistics 666

Genome Assembly Using de Bruijn Graphs. Biostatistics 666 Genome Assembly Using de Bruijn Graphs Biostatistics 666 Previously: Reference Based Analyses Individual short reads are aligned to reference Genotypes generated by examining reads overlapping each position

More information

BioHPC Lab at Cornell

BioHPC Lab at Cornell BioHPC Lab at Cornell Jaroslaw Pillardy CBSU, Life Sciences Core Laboratories Center Cornell University Practical exercises for the workshop will be carried out using CBSU BioHPC Lab Software used during

More information

BioHPC Lab at Cornell

BioHPC Lab at Cornell BioHPC Lab at Cornell Robert Bukowski (formerly: Computational Biology Service Unit) http://cbsu.tc.cornell.edu/lab/doc/biohpclabintro20130916.pdf (CBSU) Cornell Core Facility providing services for a

More information

Robert Bukowski Jaroslaw Pillardy 6/27/2011

Robert Bukowski Jaroslaw Pillardy 6/27/2011 COMPUTATIONAL BIOLOGY SERVICE UNIT, 3CPG RNA Seq CBSU Computational Resources for the Workshop Robert Bukowski (bukowski@cornell.edu); Jaroslaw Pillardy (jp86@cornell.edu) 6/27/2011 In this edition of

More information

Web service platform to provide access to maize diversity data

Web service platform to provide access to maize diversity data Graduate Theses and Dissertations Graduate College 2015 Web service platform to provide access to maize diversity data Abhinav Vinnakota Iowa State University Follow this and additional works at: http://lib.dr.iastate.edu/etd

More information

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline

Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,

More information

The Analysis of RAD-tag Data for Association Studies

The Analysis of RAD-tag Data for Association Studies EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to

More information

Linux for Biologists Part 2

Linux for Biologists Part 2 Linux for Biologists Part 2 Robert Bukowski Institute of Biotechnology Bioinformatics Facility (aka Computational Biology Service Unit - CBSU) http://cbsu.tc.cornell.edu/lab/doc/linux_workshop_part2.pdf

More information

Rice Imputation Server tutorial

Rice Imputation Server tutorial Rice Imputation Server tutorial Updated: March 30, 2018 Overview The Rice Imputation Server (RIS) takes in rice genomic datasets and imputes data out to >5.2M Single Nucleotide Polymorphisms (SNPs). It

More information

Practical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State

Practical Bioinformatics for Life Scientists. Week 4, Lecture 8. István Albert Bioinformatics Consulting Center Penn State Practical Bioinformatics for Life Scientists Week 4, Lecture 8 István Albert Bioinformatics Consulting Center Penn State Reminder Before any serious work re-check the documentation for small but essential

More information

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers

Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions

More information

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab

Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab The instruments, the runs, the QC metrics, and the output Peter Schweitzer, Director, DNA Sequencing and Genotyping Lab Overview Roche/454 GS-FLX 454 (GSRunbrowser information) Evaluating run results Errors

More information

Introduction to BioHPC Lab

Introduction to BioHPC Lab Introduction to BioHPC Lab BioHPC Lab Workshop Jaroslaw Pillardy Bioinformatics Facility Institute of Biotechnology Cornell University http://cbsu.tc.cornell.edu/lab/lab.aspx http://cbsu.tc.cornell.edu/lab/doc/introduction_to_biohpc_lab_v2.pdf

More information

Pre-Workshop Training materials to move you from Data to Discovery. Get Science Done. Reproducibly.

Pre-Workshop Training materials to move you from Data to Discovery. Get Science Done. Reproducibly. Pre-Workshop Packet Training materials to move you from Data to Discovery Get Science Done Reproducibly Productively @CyVerseOrg Introduction to CyVerse... 3 What is Cyberinfrastructure?... 3 What to do

More information

Maize genome sequence in FASTA format. Gene annotation file in gff format

Maize genome sequence in FASTA format. Gene annotation file in gff format Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise

More information

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.

Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your

More information

Network Based Models For Analysis of SNPs Yalta Opt

Network Based Models For Analysis of SNPs Yalta Opt Outline Network Based Models For Analysis of Yalta Optimization Conference 2010 Network Science Zeynep Ertem*, Sergiy Butenko*, Clare Gill** *Department of Industrial and Systems Engineering, **Department

More information

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis

de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics Next Generation Sequencing Analysis de novo assembly Simon Rasmussen 36626: Next Generation Sequencing analysis DTU Bioinformatics 27626 - Next Generation Sequencing Analysis Generalized NGS analysis Data size Application Assembly: Compare

More information

Galaxy Platform For NGS Data Analyses

Galaxy Platform For NGS Data Analyses Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account

More information

A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing

A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing A Fast Read Alignment Method based on Seed-and-Vote For Next GenerationSequencing Song Liu 1,2, Yi Wang 3, Fei Wang 1,2 * 1 Shanghai Key Lab of Intelligent Information Processing, Shanghai, China. 2 School

More information

CSE 530A. B+ Trees. Washington University Fall 2013

CSE 530A. B+ Trees. Washington University Fall 2013 CSE 530A B+ Trees Washington University Fall 2013 B Trees A B tree is an ordered (non-binary) tree where the internal nodes can have a varying number of child nodes (within some range) B Trees When a key

More information

Howdah. a flexible pipeline framework and applications to analyzing genomic data. Steven Lewis PhD

Howdah. a flexible pipeline framework and applications to analyzing genomic data. Steven Lewis PhD Howdah a flexible pipeline framework and applications to analyzing genomic data Steven Lewis PhD slewis@systemsbiology.org What is a Howdah? A howdah is a carrier for an elephant The idea is that multiple

More information

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts.

RPGC Manual. You will also need python 2.7 or above to run our home-brew python scripts. Introduction Here we present a new approach for producing de novo whole genome sequences--recombinant population genome construction (RPGC)--that solves many of the problems encountered in standard genome

More information

Sentieon Documentation

Sentieon Documentation Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................

More information

Genomics. Nolan C. Kane

Genomics. Nolan C. Kane Genomics Nolan C. Kane Nolan.Kane@Colorado.edu Course info http://nkane.weebly.com/genomics.html Emails let me know if you are not getting them! Email me at nolan.kane@colorado.edu Office hours by appointment

More information

replace my_user_id in the commands with your actual user ID

replace my_user_id in the commands with your actual user ID Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone

More information

Variant calling using SAMtools

Variant calling using SAMtools Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel

More information

Practical Linux Examples

Practical Linux Examples Practical Linux Examples Processing large text file Parallelization of independent tasks Qi Sun & Robert Bukowski Bioinformatics Facility Cornell University http://cbsu.tc.cornell.edu/lab/doc/linux_examples_slides.pdf

More information

Genetic type 1 Error Calculator (GEC)

Genetic type 1 Error Calculator (GEC) Genetic type 1 Error Calculator (GEC) (Version 0.2) User Manual Miao-Xin Li Department of Psychiatry and State Key Laboratory for Cognitive and Brain Sciences; the Centre for Reproduction, Development

More information

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu

GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics

More information

RAD Population Genomics Programs Paul Hohenlohe 6/2014

RAD Population Genomics Programs Paul Hohenlohe 6/2014 RAD Population Genomics Programs Paul Hohenlohe (hohenlohe@uidaho.edu) 6/2014 I. Overview These programs are designed to conduct population genomic analysis on RAD sequencing data. They were designed for

More information

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR

PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS

More information

SEASHORE / SARUMAN. Short Read Matching using GPU Programming. Tobias Jakobi

SEASHORE / SARUMAN. Short Read Matching using GPU Programming. Tobias Jakobi SEASHORE SARUMAN Summary 1 / 24 SEASHORE / SARUMAN Short Read Matching using GPU Programming Tobias Jakobi Center for Biotechnology (CeBiTec) Bioinformatics Resource Facility (BRF) Bielefeld University

More information

Variation among genomes

Variation among genomes Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant

More information

Limits of Jedox Software Components

Limits of Jedox Software Components Limits of Jedox Software Components In this article are listed the limits of Jedox In-Memory DB Server, Jedox Web, and Jedox Integrator. Limits of Jedox In-Memory DB Server The Jedox In-Memory DB Server

More information

SNP HiTLink Manual. Yoko Fukuda 1, Hiroki Adachi 2, Eiji Nakamura 2, and Shoji Tsuji 1

SNP HiTLink Manual. Yoko Fukuda 1, Hiroki Adachi 2, Eiji Nakamura 2, and Shoji Tsuji 1 SNP HiTLink Manual Yoko Fukuda 1, Hiroki Adachi 2, Eiji Nakamura 2, and Shoji Tsuji 1 1 Department of Neurology, Graduate School of Medicine, the University of Tokyo, Tokyo, Japan 2 Dynacom Co., Ltd, Kanagawa,

More information

Click on "+" button Select your VCF data files (see #Input Formats->1 above) Remove file from files list:

Click on + button Select your VCF data files (see #Input Formats->1 above) Remove file from files list: CircosVCF: CircosVCF is a web based visualization tool of genome-wide variant data described in VCF files using circos plots. The provided visualization capabilities, gives a broad overview of the genomic

More information

On enhancing variation detection through pan-genome indexing

On enhancing variation detection through pan-genome indexing Standard approach...t......t......t......acgatgctagtgcatgt......t......t......t... reference genome Variation graph reference SNP: A->T...ACGATGCTTGTGCATGT donor genome Can we boost variation detection

More information

NGS Data Analysis. Roberto Preste

NGS Data Analysis. Roberto Preste NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr

More information

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015

Introduction to Read Alignment. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 Introduction to Read Alignment UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 From reads to molecules Why align? Individual A Individual B ATGATAGCATCGTCGGGTGTCTGCTCAATAATAGTGCCGTATCATGCTGGTGTTATAATCGCCGCATGACATGATCAATGG

More information

AgroMarker Finder manual (1.1)

AgroMarker Finder manual (1.1) AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is

More information

Analysis of ChIP-seq data

Analysis of ChIP-seq data Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and

More information

Scalable RNA Sequencing on Clusters of Multicore Processors

Scalable RNA Sequencing on Clusters of Multicore Processors JOAQUÍN DOPAZO JOAQUÍN TARRAGA SERGIO BARRACHINA MARÍA ISABEL CASTILLO HÉCTOR MARTÍNEZ ENRIQUE S. QUINTANA ORTÍ IGNACIO MEDINA INTRODUCTION DNA Exon 0 Exon 1 Exon 2 Intron 0 Intron 1 Reads Sequencing RNA

More information

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010

Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010 Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings

More information

Terabases of long-read sequence data, analysed in real time

Terabases of long-read sequence data, analysed in real time Terabases of long-read sequence data, analysed in real time The PromethION is a real game changer. Combining ultra-long reads with high sequence output for the production of contiguous, highquality reference

More information

Importing and Merging Data Tutorial

Importing and Merging Data Tutorial Importing and Merging Data Tutorial Release 1.0 Golden Helix, Inc. February 17, 2012 Contents 1. Overview 2 2. Import Pedigree Data 4 3. Import Phenotypic Data 6 4. Import Genetic Data 8 5. Import and

More information

ChIP-Seq data analysis workshop

ChIP-Seq data analysis workshop ChIP-Seq data analysis workshop Exercise 1. ChIP-Seq peak calling 1. Using Putty (Windows) or Terminal (Mac) to connect to your assigned computer. Create a directory /workdir/myuserid (replace myuserid

More information

Sequence mapping and assembly. Alistair Ward - Boston College

Sequence mapping and assembly. Alistair Ward - Boston College Sequence mapping and assembly Alistair Ward - Boston College Sequenced a genome? Fragmented a genome -> DNA library PCR amplification Sequence reads (ends of DNA fragment for mate pairs) We no longer have

More information

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform

SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform SolexaLIMS: A Laboratory Information Management System for the Solexa Sequencing Platform Brian D. O Connor, 1, Jordan Mendler, 1, Ben Berman, 2, Stanley F. Nelson 1 1 Department of Human Genetics, David

More information

Introduction to GDS. Stephanie Gogarten. August 7, 2017

Introduction to GDS. Stephanie Gogarten. August 7, 2017 Introduction to GDS Stephanie Gogarten August 7, 2017 Genomic Data Structure Author: Xiuwen Zheng CoreArray (C++ library) designed for large-scale data management of genome-wide variants data format (GDS)

More information

RNA-seq. Manpreet S. Katari

RNA-seq. Manpreet S. Katari RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene

More information

CS 209 Sec. 52 Spring, 2006 Lab 4-A: Arrays Instructor: J.G. Neal Objectives: Lab Instructions: Obtain file ArrayDemoConsole.java

CS 209 Sec. 52 Spring, 2006 Lab 4-A: Arrays Instructor: J.G. Neal Objectives: Lab Instructions: Obtain file ArrayDemoConsole.java CS 209 Sec. 52 Spring, 2006 Lab 4-A: Arrays Instructor: J.G. Neal Objectives: To gain experience with: 1. The declaration, creation, and use of arrays. 2. Inserting/removing items into/from an array. 3.

More information

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018

ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 ELPREP PERFORMANCE ACROSS PROGRAMMING LANGUAGES PASCAL COSTANZA CHARLOTTE HERZEEL FOSDEM, BRUSSELS, BELGIUM, FEBRUARY 3, 2018 USA SAN FRANCISCO USA ORLANDO BELGIUM - HQ LEUVEN THE NETHERLANDS EINDHOVEN

More information

1 Mark Wright Hamilton 1, Marcelo Gonçalves Narciso 2, Genevieve DeClerk, Susan McCouch

1 Mark Wright Hamilton 1, Marcelo Gonçalves Narciso 2, Genevieve DeClerk, Susan McCouch Panati and webpanati Information Systems for SNPs Abstract 1 1 Mark Wright Hamilton 1, Marcelo Gonçalves Narciso 2, Genevieve DeClerk, Susan McCouch This paper describes two softwares: Panati and webpanati.

More information

The Programming Process Summer 2010 Margaret Reid-Miller

The Programming Process Summer 2010 Margaret Reid-Miller The Programming Process 15-110 Margaret Reid-Miller Hardware Components Central Processing Unit (CPU) Program control Arithmetic/logical operations Coordinates data movement between memory and registers

More information

Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture

Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture Accelerating InDel Detection on Modern Multi-Core SIMD CPU Architecture Da Zhang Collaborators: Hao Wang, Kaixi Hou, Jing Zhang Advisor: Wu-chun Feng Evolution of Genome Sequencing1 In 20032: 1 human genome

More information

Package saascnv. May 18, 2016

Package saascnv. May 18, 2016 Version 0.3.4 Date 2016-05-10 Package saascnv May 18, 2016 Title Somatic Copy Number Alteration Analysis Using Sequencing and SNP Array Data Author Zhongyang Zhang [aut, cre], Ke Hao [aut], Nancy R. Zhang

More information

INTRODUCTION AUX FORMATS DE FICHIERS

INTRODUCTION AUX FORMATS DE FICHIERS INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan

More information

PhD: a web database application for phenotype data management

PhD: a web database application for phenotype data management Bioinformatics Advance Access published June 28, 2005 The Author (2005). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oupjournals.org PhD:

More information

Intro to NGS Tutorial

Intro to NGS Tutorial Intro to NGS Tutorial Release 8.6.0 Golden Helix, Inc. October 31, 2016 Contents 1. Overview 2 2. Import Variants and Quality Fields 3 3. Quality Filters 10 Generate Alternate Read Ratio.........................................

More information

Variant Calling and Filtering for SNPs

Variant Calling and Filtering for SNPs Practical Introduction Variant Calling and Filtering for SNPs May 19, 2015 Mary Kate Wing Hyun Min Kang Goals of This Session Learn basics of Variant Call Format (VCF) Aligned sequences -> filtered snp

More information

Decrypting your genome data privately in the cloud

Decrypting your genome data privately in the cloud Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project

More information

Useful commands in Linux and other tools for quality control. Ignacio Aguilar INIA Uruguay

Useful commands in Linux and other tools for quality control. Ignacio Aguilar INIA Uruguay Useful commands in Linux and other tools for quality control Ignacio Aguilar INIA Uruguay 05-2018 Unix Basic Commands pwd ls ll mkdir d cd d show working directory list files in working directory as before

More information

NGS Data Visualization and Exploration Using IGV

NGS Data Visualization and Exploration Using IGV 1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians

More information

iloci software is used to calculate the gene-gene interactions from GWAS data. This software was implemented by the OpenCL framework.

iloci software is used to calculate the gene-gene interactions from GWAS data. This software was implemented by the OpenCL framework. iloci software iloci software is used to calculate the gene-gene interactions from GWAS data. This software was implemented by the OpenCL framework. Software requirements : 1. Linux or Mac operating system

More information

Introduction to GDS. Stephanie Gogarten. July 18, 2018

Introduction to GDS. Stephanie Gogarten. July 18, 2018 Introduction to GDS Stephanie Gogarten July 18, 2018 Genomic Data Structure CoreArray (C++ library) designed for large-scale data management of genome-wide variants data format (GDS) to store multiple

More information

Stats 300C project about HMM knockoffs Prepared by Matteo Sesia Due Friday May 11, 2018

Stats 300C project about HMM knockoffs Prepared by Matteo Sesia Due Friday May 11, 2018 Stats 300C project about HMM knockoffs Prepared by Matteo Sesia Due Friday May 11, 2018 Contents Foreword 1 Introduction 1 The hidden Markov model......................................... 2 Software requirements...........................................

More information

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files

Exercise 1. RNA-seq alignment and quantification. Part 1. Prepare the working directory. Part 2. Examine qualities of the RNA-seq data files Exercise 1. RNA-seq alignment and quantification Part 1. Prepare the working directory. 1. Connect to your assigned computer. If you do not know how, follow the instruction at http://cbsu.tc.cornell.edu/lab/doc/remote_access.pdf

More information

Kampala August, Agner Fog

Kampala August, Agner Fog Advanced microprocessor optimization Kampala August, 2007 Agner Fog www.agner.org Agenda Intel and AMD microprocessors Out Of Order execution Branch prediction Platform, 32 or 64 bits Choice of compiler

More information

Under the Hood of Alignment Algorithms for NGS Researchers

Under the Hood of Alignment Algorithms for NGS Researchers Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window

More information

Very large searches present a number of challenges. These are the topics we will cover during this presentation.

Very large searches present a number of challenges. These are the topics we will cover during this presentation. 1 Very large searches present a number of challenges. These are the topics we will cover during this presentation. 2 The smartest way to merge files, like fractions from a MudPIT run, is using Mascot Daemon.

More information

Chapter. Focus of the Course. Object-Oriented Software Development. program design, implementation, and testing

Chapter. Focus of the Course. Object-Oriented Software Development. program design, implementation, and testing Introduction 1 Chapter 5 TH EDITION Lewis & Loftus java Software Solutions Foundations of Program Design 2007 Pearson Addison-Wesley. All rights reserved Focus of the Course Object-Oriented Software Development

More information

Study of Data Localities in Suffix-Tree Based Genetic Algorithms

Study of Data Localities in Suffix-Tree Based Genetic Algorithms Study of Data Localities in Suffix-Tree Based Genetic Algorithms Carl I. Bergenhem, Michael T. Smith Abstract. This paper focuses on the study of cache localities of two genetic algorithms based on the

More information

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP

PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP PRACTICAL SESSION 8 SEQUENCE-BASED ASSOCIATION, INTERPRETATION, VISUALIZATION USING EPACTS JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR EPACTS ASSOCIATION ANALYSIS

More information

CSC116: Introduction to Computing - Java

CSC116: Introduction to Computing - Java CSC116: Introduction to Computing - Java Course Information Introductions Website Syllabus Schedule Computing Environment AFS (Andrew File System) Linux/Unix Commands Helpful Tricks Computers First Java

More information

Omega: an Overlap-graph de novo Assembler for Metagenomics

Omega: an Overlap-graph de novo Assembler for Metagenomics Omega: an Overlap-graph de novo Assembler for Metagenomics B a h l e l H a i d e r, Ta e - H y u k A h n, B r i a n B u s h n e l l, J u a n j u a n C h a i, A l e x C o p e l a n d, C h o n g l e Pa n

More information

lecture 18 cache 2 TLB miss TLB - TLB (hit and miss) - instruction or data cache - cache (hit and miss)

lecture 18 cache 2 TLB miss TLB - TLB (hit and miss) - instruction or data cache - cache (hit and miss) lecture 18 2 virtual physical virtual physical - TLB ( and ) - instruction or data - ( and ) Wed. March 16, 2016 Last lecture I discussed the TLB and how virtual es are translated to physical es. I only

More information

NA12878 Platinum Genome GENALICE MAP Analysis Report

NA12878 Platinum Genome GENALICE MAP Analysis Report NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD Jan-Jaap Wesselink, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5

More information

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V.

REPORT. NA12878 Platinum Genome. GENALICE MAP Analysis Report. Bas Tolhuis, PhD GENALICE B.V. REPORT NA12878 Platinum Genome GENALICE MAP Analysis Report Bas Tolhuis, PhD GENALICE B.V. INDEX EXECUTIVE SUMMARY...4 1. MATERIALS & METHODS...5 1.1 SEQUENCE DATA...5 1.2 WORKFLOWS......5 1.3 ACCURACY

More information

User s Guide. Version 2.2. Semex Alliance, Ontario and Centre for Genetic Improvement of Livestock University of Guelph, Ontario

User s Guide. Version 2.2. Semex Alliance, Ontario and Centre for Genetic Improvement of Livestock University of Guelph, Ontario User s Guide Version 2.2 Semex Alliance, Ontario and Centre for Genetic Improvement of Livestock University of Guelph, Ontario Mehdi Sargolzaei, Jacques Chesnais and Flavio Schenkel Jan 2014 Disclaimer

More information

MuleSoft.U Mule 4 for Mule 3 Users Setup Instructions

MuleSoft.U Mule 4 for Mule 3 Users Setup Instructions MuleSoft.U Mule 4 for Mule 3 Users Setup Instructions Note: If you need help with the setup instructions, use the MuleSoft Training forum at http://training.mulesoft.com/forums. Make sure your computer

More information

Calling variants in diploid or multiploid genomes

Calling variants in diploid or multiploid genomes Calling variants in diploid or multiploid genomes Diploid genomes The initial steps in calling variants for diploid or multi-ploid organisms with NGS data are the same as what we've already seen: 1. 2.

More information

Maximizing Public Data Sources for Sequencing and GWAS

Maximizing Public Data Sources for Sequencing and GWAS Maximizing Public Data Sources for Sequencing and GWAS February 4, 2014 G Bryce Christensen Director of Services Questions during the presentation Use the Questions pane in your GoToWebinar window Agenda

More information

Opera Web Browser Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space

Opera Web Browser Archive - FTP Site Statistics. Top 20 Directories Sorted by Disk Space Property Value FTP Server ftp.opera.com Description Opera Web Browser Archive Country United States Scan Date 04/Nov/2015 Total Dirs 1,557 Total Files 2,211 Total Data 43.83 GB Top 20 Directories Sorted

More information

see also:

see also: ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2014 UNIVERSITY OF KENTUCKY AGTC Class 3 Genome Assembly Newbler 2.9 Most assembly programs are run in a similar manner to one another. We will use the

More information

Performance analysis of parallel de novo genome assembly in shared memory system

Performance analysis of parallel de novo genome assembly in shared memory system IOP Conference Series: Earth and Environmental Science PAPER OPEN ACCESS Performance analysis of parallel de novo genome assembly in shared memory system To cite this article: Syam Budi Iryanto et al 2018

More information

Step-by-Step Guide to Relatedness and Association Mapping Contents

Step-by-Step Guide to Relatedness and Association Mapping Contents Step-by-Step Guide to Relatedness and Association Mapping Contents OBJECTIVES... 2 INTRODUCTION... 2 RELATEDNESS MEASURES... 2 POPULATION STRUCTURE... 6 Q-K ASSOCIATION ANALYSIS... 10 K MATRIX COMPRESSION...

More information

Applying Cortex to Phase Genomes data - the recipe. Zamin Iqbal

Applying Cortex to Phase Genomes data - the recipe. Zamin Iqbal Applying Cortex to Phase 3 1000Genomes data - the recipe Zamin Iqbal (zam@well.ox.ac.uk) 21 June 2013 - version 1 Contents 1 Overview 1 2 People 1 3 What has changed since version 0 of this document? 1

More information

SSAHA2 Manual. September 1, 2010 Version 0.3

SSAHA2 Manual. September 1, 2010 Version 0.3 SSAHA2 Manual September 1, 2010 Version 0.3 Abstract SSAHA2 maps DNA sequencing reads onto a genomic reference sequence using a combination of word hashing and dynamic programming. Reads from most types

More information

Main Memory and the CPU Cache

Main Memory and the CPU Cache Main Memory and the CPU Cache CPU cache Unrolled linked lists B Trees Our model of main memory and the cost of CPU operations has been intentionally simplistic The major focus has been on determining

More information

arxiv: v2 [q-bio.qm] 17 Nov 2013

arxiv: v2 [q-bio.qm] 17 Nov 2013 arxiv:1308.2150v2 [q-bio.qm] 17 Nov 2013 GeneZip: A software package for storage-efficient processing of genotype data Palmer, Cameron 1 and Pe er, Itsik 1 1 Center for Computational Biology and Bioinformatics,

More information

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM).

The software comes with 2 installers: (1) SureCall installer (2) GenAligners (contains BWA, BWA- MEM). Release Notes Agilent SureCall 4.0 Product Number G4980AA SureCall Client 6-month named license supports installation of one client and server (to host the SureCall database) on one machine. For additional

More information

SNP Calling. Tuesday 4/21/15

SNP Calling. Tuesday 4/21/15 SNP Calling Tuesday 4/21/15 Why Call SNPs? map mutations, ex: EMS, natural variation, introgressions associate with changes in expression develop markers for whole genome QTL analysis/ GWAS access diversity

More information

Chapter 1 Computer and Programming. By Zerihun Alemayehu

Chapter 1 Computer and Programming. By Zerihun Alemayehu Chapter 1 Computer and Programming By Zerihun Alemayehu What is computer? A device capable of performing computations and making logical decisions at speeds millions (even billions) of times faster than

More information