RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual
|
|
|
- Jordan Knight
- 5 years ago
- Views:
Transcription
1 RASER: Reads Aligner for SNPs and Editing sites of RNA (version 0.51) Manual July 02,
2 Index 1. System requirement and how to download RASER source code Installation Making index files...3 1) Downloading pre-built index files...3 2) Generating an index file Aligning...5 1) Basic usage...5 2) Optional parameters Output: JSAM specification Contact Reference...6 2
3 1. System requirement and how to download RASER source code Currently RASER supports Linux 64bit (Ubuntu, Red Hat, SUSE and others) system. Download raser_v0.51.tar.gz from /releases/tag/v0.5.1 or 2. Installation 'g++' and 'make' are required to compile RASER. (1) Uncompress raser_v0.51.tar.gz (2) Go to uncompressed raser directory, and compile it by running./make (3) If successfully compiled, you can find two binary files, 'raser' and 'raseridx'. Note: If the size of your genome is above 4.2 Gb (=2 32 ), run './make MODE=-DS64' instead. Please refer to to get the size of your genome. 3. Making index files Before you running RASER, you should generate an index file using 'raseridx', or download pre-built index file. 1) Downloading pre-built index files You can download pre-built index files for human from (1) hg19.ridx an index file for hg19 only (2) hg19_ensembl.ridx an index file for both hg19 and ensembl transcriptome Note: if you compiled raser using -DS64 option, do not use above index files (you should generate a new index file using raseridx compailed with -DS64 option) 2) Generating an index file (1) Using only genome sequences./raseridx -r GENOME_FASTA_FILE [-x YOUR_INDEX_NAME] [optional parameters] GENOME_FASTA_FILE : Genome sequence in FASTA format YOUR_INDEX_NAME : Name of the index file. If not set, the name is set to default = 'a.ridx'. optional parameters : Refer to following 3-2)-(4) optional parameters 3
4 (2) Using only transcriptome sequences./raseridx -r mrna_fasta_file -l ANNOTATION_FILE [-p mrna_name_prefix] [-x YOUR_INDEX_NAME] [optional parameters] mrna_fasta_file : transcriptome sequences in FASTA format. Its format is like below: >ENST range=chr1: 'pad=0 3'pad=0 strand=+ repeatmasking=none ATGATGGAAGGATTGAAAAAACGTACAAGGAAGGCCTTTGGAATACGGAA GAAAGAAAAGGACACTGATTCTACAGGTTCACCAGATAGAGATGGAATTC AGGGGAAAAAAAAGACCCAGAAGACTCAGCTTCTCCTCACCTCTTGCTTC ANNOTATION_FILE : annotation table which is downloadable from UCSC genome browser. Its format is like below: #bin name chrom strand txstart txend cdsstart cdsend exoncount exonstarts exonends score name2 cdsstartstat cdsendstat exonframes 0 ENST chr , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , 0 ENSG cmpl cmpl -1,0,1,2,0,0,0,1,0,0,0,1,2,1,1,1,1,1,0,1,1,2,2,0,2,1,1, 0 ENST chr , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , 0 ENSG cmpl cmpl - 1,0,1,2,0,0,1,0,1,2,1,1,1,0,1,1,2,2,0,2,1,1,... mrna_name_prefix : if mrna names in ANNOTATION_FILE and mrna_fasta_file are different, mrna_name_prefix should be set. For example, mrna names in ANNOTATION_FILE and mrna_fasta_file are 'ENSMUST ' and 'mm10_ensgene_ensmust ' respectively, mrna_name_prefix is 'ENSMUST'. YOUR_INDEX_NAME : Name of the index file. If not set, the name is set to default = 'a.ridx'. optional parameters : Refer to following 3-2)-(4) optional parameters (3) Using both genome and transcriptome sequences./raseridx -r GENOME_FASTA_FILE mrna_fasta_file -l ANNOTATION_FILE [-p mrna_name_prefix] [-x YOUR_INDEX_NAME] [optional parameters] GENOME_FASTA_FILE : Genome sequence in FASTA format mrna_fasta_file : transcriptome sequences in FASTA format (its format is explained in 2.2) ANNOTATION_FILE : annotation table downloaded from UCSC genome browser (its format is explained in 2.2) mrna_name_prefix : explained in 2.2 YOUR_INDEX_NAME : Name of the index file. If not set, the name is set to default = 'a.ridx'. optional parameters : Refer to following 3-2)-(4) optional parameters (4) Optional parameters -k <int> : RASER indexes reference sequence of length (s + 16) at every k steps. Smaller k leads to larger index but may enable more complete mapping. Default value is 4, but you can try smaller k if too many reads are unmapped. -s <int> : Minimum size of sequence indexed. For most eukaryote genomes, s = 8 (default value) is enough. For smaller 4
5 genomes, smaller value should be used. Recommended value of s is as follows: Genome size (bps) s 5,000,000,000 ~ 9 800,000,000 ~ 5,000,000,000 8 (default) 100,000,000 ~ 800,000, ,000,000 ~ 100,000, ,500,000 ~ 15,000, ,000 ~ 2,500,000 4 ~ 400, h : prints out help page -v : prints out version of raseridx 4. Aligning 1) Basic usage./raser [-x index] {-i read -i1 read_end1 -i2 read_end2} [-o result] [optional parameters] Parameter name Description Default value index (optional) Name of index file a.ridx read Name of read file in FASTQ or FASTA format (single end) N/A read_end1/2 Read pair end1/2 file in FASTQ or FASTA format (paired end) N/A result (optional) Result file in SAM format a.sam optional parameters Refer to following 4-2) optional parameters N/A 2) Optional parameters (options in bolds are important ones) Parameter name Description Default value -m <float> maximum ratio of mismatches (including indels) p <int> Reports <int> number of good alignments. Set 0 to get all good alignments. Set 1 for best alignments -l <int> maximum length of insertion (usually equal to maximum intron length) d <float> Set this to apply double filtering. Double filtering is mapping scheme that a read (pair) should be uniquely mapped with less than -m <float> threshold, and not mapped to anywhere with more than -d <float> threshold (refer to Bahn et al., 2012). It aims to predict SNP or RNA editing sites accurately, by minimizing false positives. Recommended value is 0.09, and should be in (m, 0.3). If -d is set, RASER reports best (unique) result (ignoring -p <int>). -b <float> (highly recommended to set for SNP or editing site detection) Set this to finds the obviously best mapping of a read (pair), whose mismatch score is less than -m <float>, and also less than mismatch scores of all other mappings by -b <float>. It aims to maximize the mapping rate, as well as to minimize the false positive rate. Recommended value is 0.03, and should be in (0, 0.2) (Refer to Ahn et al., 2015). If -b is set, RASER reports best (unique) result (ignoring -p <int>). 0 5
6 -g Don't map spliced reads --sanger If read quality scores are based on Illumina v1.7 or less, this option will convert quality score to Sanger format (=Illumina v1.8 format) -s <float> allows <float> * read_length of soft-clipping. We recommend to use smaller s for shorter read (e.g. 0.1 for 36 bp reads) -t <int> Number of thread to use. Set 1 for no multi-processing 8 --idop Indel open penalty 3 --idep Indel extend penalty 1 --nxm Don't add XM/XJ fields to output SAM files. Refer to 5. Output for details of XM/XJ fields nxt Don't add XT field to output SAM files. Refer to 5. Output for details of XT field -h prints out help page N/A -v prints out version of RASER N/A 5. Output If successfully finished, RASER will generate SAM and log files. SAM file includes following extra fields (if options '--nxm' and/or '--nxt' are not set). Column Tag Format Description 16 XJ:Z: chr,{start:end} : start and end are 1-base loci. If a read is spliced, there can be multiple 'start:end' separated by comma 17 XM:Z: {ref_loc-read_loc-abc} : ref_loc is a reference locus of a mismatch (1-base). read_loc is a read position of a mismatch (1-base). A is a reference base of a mismatch. B is a read base of a mismatch. C is a read quality of a mismatch. For easier parsing of read mapping positions within the reference For easier parsing of mismatch information 18 XT:Z: Transcript names separated by comma Includes transcript names to which a read is mapped, if a transcriptome was indexed 6. Contact Bug reporting, questions or any suggestions are highly appreciated. Jaegyoon (Jay) Ahn (jgahn AT ucla.edu) Xinshu (Grace) Xiao (gxxiao AT ucla.edu) 7. Reference J. Bahn, J. Lee, G. Li et al., Accurate identification of A-to-I RNA editing in human by transcriptome sequencing, Genome Research, Vol.22, 2012 J. Ahn and X. Xiao, RASER: Reads aligner for SNPs and editing sites of RNA, under review,
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
Identiyfing splice junctions from RNA-Seq data
Identiyfing splice junctions from RNA-Seq data Joseph K. Pickrell pickrell@uchicago.edu October 4, 2010 Contents 1 Motivation 2 2 Identification of potential junction-spanning reads 2 3 Calling splice
Ensembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
Bioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
Benchmarking of RNA-seq aligners
Lecture 17 RNA-seq Alignment STAR Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Benchmarking of RNA-seq aligners Based on this analysis the most reliable
RNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
all M 2M_gt_15 2M_8_15 2M_1_7 gt_2m TopHat2
Pairs processed per second 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 6, 4, 2, 72,318 418 1,666 49,495 21,123 69,984 35,694 1,9 71,538 3,5 17,381 61,223 69,39 55 19,579 44,79 65,126 96 5,115 33,6 61,787
Sequencing. Short Read Alignment. Sequencing. Paired-End Sequencing 6/10/2010. Tobias Rausch 7 th June 2010 WGS. ChIP-Seq. Applied Biosystems.
Sequencing Short Alignment Tobias Rausch 7 th June 2010 WGS RNA-Seq Exon Capture ChIP-Seq Sequencing Paired-End Sequencing Target genome Fragments Roche GS FLX Titanium Illumina Applied Biosystems SOLiD
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
INTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
Rsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
USING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)
USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are
SPAR outputs and report page
SPAR outputs and report page Landing results page (full view) Landing results / outputs page (top) Input files are listed Job id is shown Download all tables, figures, tracks as zip Percentage of reads
Package Rsubread. July 21, 2013
Package Rsubread July 21, 2013 Type Package Title Rsubread: an R package for the alignment, summarization and analyses of next-generation sequencing data Version 1.10.5 Author Wei Shi and Yang Liao with
Standard output. Some of the output files can be redirected into the standard output, which may facilitate in creating the pipelines:
Lecture 18 RNA-seq Alignment Standard output Some of the output files can be redirected into the standard output, which may facilitate in creating the pipelines: Filtering of the alignments STAR performs
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6
Mapping RNA sequence data (Part 1: using pathogen portal s RNAseq pipeline) Exercise 6 The goal of this exercise is to retrieve an RNA-seq dataset in FASTQ format and run it through an RNA-sequence analysis
Tiling Assembly for Annotation-independent Novel Gene Discovery
Tiling Assembly for Annotation-independent Novel Gene Discovery By Jennifer Lopez and Kenneth Watanabe Last edited on September 7, 2015 by Kenneth Watanabe The following procedure explains how to run the
ASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
SMALT Manual. December 9, 2010 Version 0.4.2
SMALT Manual December 9, 2010 Version 0.4.2 Abstract SMALT is a pairwise sequence alignment program for the efficient mapping of DNA sequencing reads onto genomic reference sequences. It uses a combination
Package Rbowtie. January 21, 2019
Type Package Title R bowtie wrapper Version 1.23.1 Date 2019-01-17 Package Rbowtie January 21, 2019 Author Florian Hahne, Anita Lerch, Michael B Stadler Maintainer Michael Stadler
Goal: Learn how to use various tool to extract information from RNAseq reads.
ESSENTIALS OF NEXT GENERATION SEQUENCING WORKSHOP 2017 Class 4 RNAseq Goal: Learn how to use various tool to extract information from RNAseq reads. Input(s): Output(s): magnaporthe_oryzae_70-15_8_supercontigs.fasta
Under the Hood of Alignment Algorithms for NGS Researchers
Under the Hood of Alignment Algorithms for NGS Researchers April 16, 2014 Gabe Rudy VP of Product Development Golden Helix Questions during the presentation Use the Questions pane in your GoToWebinar window
Genome Browsers - The UCSC Genome Browser
Genome Browsers - The UCSC Genome Browser Background The UCSC Genome Browser is a well-curated site that provides users with a view of gene or sequence information in genomic context for a specific species,
Rsubread package: high-performance read alignment, quantification and mutation discovery
Rsubread package: high-performance read alignment, quantification and mutation discovery Wei Shi 14 September 2015 1 Introduction This vignette provides a brief description to the Rsubread package. For
NGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
User Manual of ChIP-BIT 2.0
User Manual of ChIP-BIT 2.0 Xi Chen September 16, 2015 Introduction Bayesian Inference of Target genes using ChIP-seq profiles (ChIP-BIT) is developed to reliably detect TFBSs and their target genes by
DNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
ChIP-seq practical: peak detection and peak annotation. Mali Salmon-Divon Remco Loos Myrto Kostadima
ChIP-seq practical: peak detection and peak annotation Mali Salmon-Divon Remco Loos Myrto Kostadima March 2012 Introduction The goal of this hands-on session is to perform some basic tasks in the analysis
Genome-wide analysis of degradome data using PAREsnip2
Genome-wide analysis of degradome data using PAREsnip2 24/01/2018 User Guide A tool for high-throughput prediction of small RNA targets from degradome sequencing data using configurable targeting rules
Genome-wide analysis of degradome data using PAREsnip2
Genome-wide analysis of degradome data using PAREsnip2 07/06/2018 User Guide A tool for high-throughput prediction of small RNA targets from degradome sequencing data using configurable targeting rules
High-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
NGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
High-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL
QIAseq DNA V3 Panel Analysis Plugin USER MANUAL User manual for QIAseq DNA V3 Panel Analysis 1.0.1 Windows, Mac OS X and Linux January 25, 2018 This software is for research purposes only. QIAGEN Aarhus
RNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
Advanced UCSC Browser Functions
Advanced UCSC Browser Functions Dr. Thomas Randall tarandal@email.unc.edu bioinformatics.unc.edu UCSC Browser: genome.ucsc.edu Overview Custom Tracks adding your own datasets Utilities custom tools for
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping. Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September
MIRING: Minimum Information for Reporting Immunogenomic NGS Genotyping Data Standards Hackathon for NGS HACKATHON 1.0 Bethesda, MD September 27 2014 Static Dynamic Static Minimum Information for Reporting
NGS FASTQ file format
NGS FASTQ file format Line1: Begins with @ and followed by a sequence idenefier and opeonal descripeon Line2: Raw sequence leiers Line3: + Line4: Encodes the quality values for the sequence in Line2 (see
Lecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu
GSNAP: Fast and SNP-tolerant detection of complex variants and splicing in short reads by Thomas D. Wu and Serban Nacu Matt Huska Freie Universität Berlin Computational Methods for High-Throughput Omics
Sequence Analysis Pipeline
Sequence Analysis Pipeline Transcript fragments 1. PREPROCESSING 2. ASSEMBLY (today) Removal of contaminants, vector, adaptors, etc Put overlapping sequence together and calculate bigger sequences 3. Analysis/Annotation
Getting Started. April Strand Life Sciences, Inc All rights reserved.
Getting Started April 2015 Strand Life Sciences, Inc. 2015. All rights reserved. Contents Aim... 3 Demo Project and User Interface... 3 Downloading Annotations... 4 Project and Experiment Creation... 6
Mapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
Eval: A Gene Set Comparison System
Masters Project Report Eval: A Gene Set Comparison System Evan Keibler evan@cse.wustl.edu Table of Contents Table of Contents... - 2 - Chapter 1: Introduction... - 5-1.1 Gene Structure... - 5-1.2 Gene
Galaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
Part 1: How to use IGV to visualize variants
Using IGV to identify true somatic variants from the false variants http://www.broadinstitute.org/igv A FAQ, sample files and a user guide are available on IGV website If you use IGV in your publication:
Read Naming Format Specification
Read Naming Format Specification Karel Břinda Valentina Boeva Gregory Kucherov Version 0.1.3 (4 August 2015) Abstract This document provides a standard for naming simulated Next-Generation Sequencing (Ngs)
Genetics 211 Genomics Winter 2014 Problem Set 4
Genomics - Part 1 due Friday, 2/21/2014 by 9:00am Part 2 due Friday, 3/7/2014 by 9:00am For this problem set, we re going to use real data from a high-throughput sequencing project to look for differential
RNA-Seq data analysis software. User Guide 023UG050V0200
RNA-Seq data analysis software User Guide 023UG050V0200 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen
Next Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
Introduction to Genome Browsers
Introduction to Genome Browsers Rolando Garcia-Milian, MLS, AHIP (Rolando.milian@ufl.edu) Department of Biomedical and Health Information Services Health Sciences Center Libraries, University of Florida
Long Read RNA-seq Mapper
UNIVERSITY OF ZAGREB FACULTY OF ELECTRICAL ENGENEERING AND COMPUTING MASTER THESIS no. 1005 Long Read RNA-seq Mapper Josip Marić Zagreb, February 2015. Table of Contents 1. Introduction... 1 2. RNA Sequencing...
Illumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
m6aviewer Version Documentation
m6aviewer Version 1.6.0 Documentation Contents 1. About 2. Requirements 3. Launching m6aviewer 4. Running Time Estimates 5. Basic Peak Calling 6. Running Modes 7. Multiple Samples/Sample Replicates 8.
UCSC Genome Browser ASHG 2014 Workshop
UCSC Genome Browser ASHG 2014 Workshop We will be using human assembly hg19. Some steps may seem a bit cryptic or truncated. That is by design, so you will think about things as you go. In this document,
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
HMPL User Manual. Shuying Sun or Texas State University
HMPL User Manual Shuying Sun (ssun5211@yahoo.com or s_s355@txstate.edu), Texas State University Peng Li (pxl119@case.edu), Case Western Reserve University June 18, 2015 Contents 1. General Overview and
Importing your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
Exercise 2: Browser-Based Annotation and RNA-Seq Data
Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence
RNA-Seq data analysis software. User Guide 023UG050V0100
RNA-Seq data analysis software User Guide 023UG050V0100 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen
Accessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
Omixon PreciseAlign CLC Genomics Workbench plug-in
Omixon PreciseAlign CLC Genomics Workbench plug-in User Manual User manual for Omixon PreciseAlign plug-in CLC Genomics Workbench plug-in (all platforms) CLC Genomics Server plug-in (all platforms) January
Genome Browser. Background and Strategy
Genome Browser Background and Strategy Contents What is a genome browser? Purpose of a genome browser Examples Structure Extra Features Contents What is a genome browser? Purpose of a genome browser Examples
Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.
Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains
GBS Bioinformatics Pipeline(s) Overview
GBS Bioinformatics Pipeline(s) Overview Getting from sequence files to genotypes. Pipeline Coding: Ed Buckler Jeff Glaubitz James Harriman Presentation: Terry Casstevens With supporting information from
Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
File Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
Supplementary Information. Detecting and annotating genetic variations using the HugeSeq pipeline
Supplementary Information Detecting and annotating genetic variations using the HugeSeq pipeline Hugo Y. K. Lam 1,#, Cuiping Pan 1, Michael J. Clark 1, Phil Lacroute 1, Rui Chen 1, Rajini Haraksingh 1,
User's guide to ChIP-Seq applications: command-line usage and option summary
User's guide to ChIP-Seq applications: command-line usage and option summary 1. Basics about the ChIP-Seq Tools The ChIP-Seq software provides a set of tools performing common genome-wide ChIPseq analysis
Sep. Guide. Edico Genome Corp North Torrey Pines Court, Plaza Level, La Jolla, CA 92037
Sep 2017 DRAGEN TM Quick Start Guide www.edicogenome.com info@edicogenome.com Edico Genome Corp. 3344 North Torrey Pines Court, Plaza Level, La Jolla, CA 92037 Notice Contents of this document and associated
Overview. Dataset: testpos DNA: CCCATGGTCGGGGGGGGGGAGTCCATAACCC Num exons: 2 strand: + RNA (from file): AUGGUCAGUCCAUAA peptide (from file): MVSP*
Overview In this homework, we will write a program that will print the peptide (a string of amino acids) from four pieces of information: A DNA sequence (a string). The strand the gene appears on (a string).
ChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
RNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
Circ-Seq User Guide. A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data
Circ-Seq User Guide A comprehensive bioinformatics workflow for circular RNA detection from transcriptome sequencing data 02/03/2016 Table of Contents Introduction... 2 Local Installation to your system...
David Crossman, Ph.D. UAB Heflin Center for Genomic Science. GCC2012 Wednesday, July 25, 2012
David Crossman, Ph.D. UAB Heflin Center for Genomic Science GCC2012 Wednesday, July 25, 2012 Galaxy Splash Page Colors Random Galaxy icons/colors Queued Running Completed Download/Save Failed Icons Display
Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
RNA-Seq data analysis software. User Guide 023UG050V0210
RNA-Seq data analysis software User Guide 023UG050V0210 FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE. INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen
The Analysis of RAD-tag Data for Association Studies
EDEN Exchange Participant Name: Layla Freeborn Host Lab: The Kronforst Lab, The University of Chicago Dates of visit: February 15, 2013 - April 15, 2013 Title of Protocol: Rationale and Background: to
Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST
A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/
Identify differential APA usage from RNA-seq alignments
Identify differential APA usage from RNA-seq alignments Elena Grassi Department of Molecular Biotechnologies and Health Sciences, MBC, University of Turin, Italy roar version 1.16.0 (Last revision 2014-09-24)
Genome Browsers Guide
Genome Browsers Guide Take a Class This guide supports the Galter Library class called Genome Browsers. See our Classes schedule for the next available offering. If this class is not on our upcoming schedule,
Helpful Galaxy screencasts are available at:
This user guide serves as a simplified, graphic version of the CloudMap paper for applicationoriented end-users. For more details, please see the CloudMap paper. Video versions of these user guides and
protrac version Documentation -
protrac version 2.4.0 - Documentation - 1. Scope and prerequisites 1.1 Introduction protrac predicts and analyzes genomic pirna clusters based on mapped pirna sequence reads. protrac applies a sliding
SSAHA2 Manual. September 1, 2010 Version 0.3
SSAHA2 Manual September 1, 2010 Version 0.3 Abstract SSAHA2 maps DNA sequencing reads onto a genomic reference sequence using a combination of word hashing and dynamic programming. Reads from most types
Short Read Alignment. Mapping Reads to a Reference
Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements
protrac version Documentation -
protrac version 2.2.0 - Documentation - 1. Scope and prerequisites 1.1 Introduction protrac predicts and analyzes genomic pirna clusters based on mapped pirna sequence reads. protrac applies a sliding
Tutorial 1: Exploring the UCSC Genome Browser
Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.
AgroMarker Finder manual (1.1)
AgroMarker Finder manual (1.1) 1. Introduction 2. Installation 3. How to run? 4. How to use? 5. Java program for calculating of restriction enzyme sites (TaqαI). 1. Introduction AgroMarker Finder (AMF)is
Genomics 92 (2008) Contents lists available at ScienceDirect. Genomics. journal homepage:
Genomics 92 (2008) 75 84 Contents lists available at ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Review UCSC genome browser tutorial Ann S. Zweig a,, Donna Karolchik a, Robert
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010
Atlas-SNP2 DOCUMENTATION V1.1 April 26, 2010 Contact: Jin Yu (jy2@bcm.tmc.edu), and Fuli Yu (fyu@bcm.tmc.edu) Human Genome Sequencing Center (HGSC) at Baylor College of Medicine (BCM) Houston TX, USA 1
Maize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment
An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi
Analyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
GenomeStudio Software Release Notes
GenomeStudio Software 2009.2 Release Notes 1. GenomeStudio Software 2009.2 Framework... 1 2. Illumina Genome Viewer v1.5...2 3. Genotyping Module v1.5... 4 4. Gene Expression Module v1.5... 6 5. Methylation
User's Guide to DNASTAR SeqMan NGen For Windows, Macintosh and Linux
User's Guide to DNASTAR SeqMan NGen 12.0 For Windows, Macintosh and Linux DNASTAR, Inc. 2014 Contents SeqMan NGen Overview...7 Wizard Navigation...8 Non-English Keyboards...8 Before You Begin...9 The
Using Pipeline Output Data for Whole Genome Alignment
Using Pipeline Output Data for Whole Genome Alignment FOR RESEARCH ONLY Topics 4 Introduction 4 Pipeline 4 Maq 4 GBrowse 4 Hardware Requirements 5 Workflow 6 Preparing to Run Maq 6 UNIX/Linux Environment
Services Performed. The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples.
Services Performed The following checklist confirms the steps of the RNA-Seq Service that were performed on your samples. SERVICE Sample Received Sample Quality Evaluated Sample Prepared for Sequencing
Manual of SOAPdenovo-Trans-v1.03. Yinlong Xie, Gengxiong Wu, Jingbo Tang,
Manual of SOAPdenovo-Trans-v1.03 Yinlong Xie, 2013-07-19 Gengxiong Wu, 2013-07-19 Jingbo Tang, 2013-07-19 ********** Introduction SOAPdenovo-Trans is a de novo transcriptome assembler basing on the SOAPdenovo
Subread/Rsubread Users Guide
Subread/Rsubread Users Guide Subread v1.4.6-p3/rsubread v1.18.0 15 May 2015 Wei Shi and Yang Liao Bioinformatics Division The Walter and Eliza Hall Institute of Medical Research The University of Melbourne
KisSplice. Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data. 29th may 2013
Identifying and Quantifying SNPs, indels and Alternative Splicing Events from RNA-seq data 29th may 2013 Next Generation Sequencing A sequencing experiment now produces millions of short reads ( 100 nt)