Selecting the Most Highly Correlated Pairs within a Large Vocabulary

Size: px
Start display at page:

Download "Selecting the Most Highly Correlated Pairs within a Large Vocabulary"

Transcription

1 Seleting the Most Highl Correlted Pirs within Lrge Voulr Koji Umemur Deprtment of Computer Siene Toohshi Universit of Tehnolog Astrt Ourene ptterns of words in douments n e epressed s inr vetors When two vetors re similr, the two words orresponding to the vetors m hve some impliit reltionship with eh other We ll these two words orrelted pir This report desries method for otining the most highl orrelted pirs of given sie In prtie, the method requires omputtion time, nd memor spe, where is the numer of douments or reords Sine this does not depend on the sie of the voulr under nlsis, it is possile to ompute orreltions etween ll the words in orpus 1 Introdution In order to find reltionships etween words in lrge orpus or etween lels in lrge dtse, we m use distne mesure etween the inr vetors of dimensions, where is the numer of douments or reords, nd the th element is 1 if the th doument/reord ontins the word or the lel, or otherwise There re severl distne mesures suitle for this purpose, suh s the mutul informtion(churh nd Hnks, 199), the die oeffiient(mnning nd Shueute 85, 1999), the phi oeffiient(mnning nd Shuete 5, 1999), the osine mesure(mnning nd Shueute 85, 1999) nd the onfidene(arrwl nd Sriknt, 1995) There re lso speil funtions for ertin pplitions, suh s then omplimentr similrit mesure (CSM)(Hgit nd Swki, 1995) whih is known s to e suitle for ses with nois pttern All of these five mesures n e otined from simple ontingen tle This tle hs four numers for eh word/lel nd word/lel The first numer is the numer of douments/reords tht hve oth nd We define this numer s The seond numer is the numer of do- uments/reords tht hve ut not We define this numer s The third numer is the numer of douments/reords tht do not hve ut do hve We define this numer s The fourth nd the lst numer is the numer of douments/reords tht hve neither nor We define this numer s An ovious method to otin the most highl relted pirs is to lulte!,,, for ll pirs of words/lels, ompute the similrit for ll pirs nd then selet pirs of the highest vlues Let " e the numer of possile words/lels, nd e the totl numer of douments/reords in orpus/dtse This method requires "# memor spe nd " #$ omputtion time However, its use is onl fesile if " is smller thn!( When " is lrger thn ten thousnd, eeution of this proedure eomes diffiult The method desried here is sed on the oservtion tht there is n upper oundr to the numer of different words in one doument The ssumption of suh oundr ould even mde of lrge sle

2 , orpus For emple, olletive orpus of newspper m eome lrger nd lrger, ut the length of eh rtile is stle It is not likel tht one rtile would ontin thousnds of different words In view of this oservtion nd the ssumption, this method is effetive for otining the most highl orrelted pirs in lrge orpus, nd uses memor spe, nd omputtion time 2 Nottions Severl nottions re introdued in this setion to desrie the method Assuming orpus C, whih is set of sets of words, vlues re ssigned s follows : douments (elements of the orpus),, : lel (elements of doument) : is pled fter in the lphetil order : the totl numer of douments : the numer of douments tht ontin : the numer of douments tht on- tin nd ontin tin ut not tins ut not : the numer of douments tht on- : the numer of douments tht one- tin neither nor : the numer of douments tht on- Prolem Definition When the orpus of set of sets of lels is provided, " nd the funtion! of pir of lels to the numer in the following form is lso provided, we will otin " : the set of pirs of given sie tht stisfies the following ondition # # # where # "%$ '& (& "%$) '&'(& The following re emples of -, / osine funtion 1 -,2 -,2 die oeffiient 4, -, ,52 onfidene,,2 pirwise mutul informtion, phi oeffiient 1 -,2 -,2, 87 -,2, -,2 +* 2 omplementr similrit mesure, ,2 2 # # 2

3 & "# Implementtion of progrm tht requires " # memor spe nd omputtion time is es A progrm of this tpe ould e used to lulte,,, nd for ll pirs of nd, nd ould then provide the most highl orrelted pirs However, ompution with this method is not fesile when " is lrge For emple, in order to lulte the most highl orrelted words within newspper over severl ers of pulition, " eomes roughl, nd eomes The mount of omputtion time is then inresed to 4 Approh In terms of the tul dt, the numer of orrelted pirs is usull muh smller thn the numer of unorrelted pirs Moreover, most of the unorrelted! pirs usull stisf the ondition: &, nd re not of interest This method tkes this ft into ount Moreover, it lso uses the reltionship etween nd to mke the omputtion fesile 5 Reltionship etween nd Proofs of the following equtions re provided elow 7 7! 7 7 '2 Proof: 1 " " is equivlent to " 2 B definition, the sum of,,, nd lws represents the totl numer of douments 2 2 '2 Similrl, the sum of tht ontin This equls nd is the numer of douments Similrl, the sum of tht ontin This equls nd is the numer of douments '2 2 5 These four equtions mke it possile to epress,, nd nd These formuls indite tht the numer of required two-dimensionl tles is not four, ut just one In other words, if we rete tle of nd one vrile for, we n otin,, nd 6 The memor requirement for Let e the mimum numer of different words/lels in one doument The following prop- ert eists in #,

4 The left side of the formul equls the totl numer of ll pirs of words/lels # This nnot eeed This reltionship indites tht if the tle is stored using tuples of where &, the required memor spe is Tuples where & re not neessr euse we know tht & when the tuple for does not eist in memor This estimtion is pessimisti The tul sie of # the tuples will e smller thn, sine not ll douments will hve different words/lels 7 Otining, nd, nd is strightforwrd First, the orpus must e trsformed into set of sets of words/lels Sine this is set form, there re no duplitions of the words/lels of one doument In the following progrm, the hshtle returns for non-eistent item The lgorithm to otin! (1) Let DFA e empt hshtle (2) Let DF e empt hshtle () Let N e The omputtion time for this progrm is less thn # Sine is independent from, the omputtion time is # Agin, is pessimisti estimtion, sine not ll douments will hve different words/lels 8 Seleting Pirs Even though,,, nd n e otined in onstnt time fter preproessing, there re " # vlues to onsider to otin the est N orrelted pirs Fortuntel, mn of the funtions tht re usle s inditors of orreltion nd, t lest, ll five funtions, return lower vlue thn the known threshold if & The osine mesure, the die oeffiient, nd pirwise mutul informtion hve propert 1 nd propert 2 s defined elow This implies tht the vlue for where & is tull the minimum vlue of ll Therefore, the first prt of the totl ordered sequene of is the sorted list of where & The rest is n ritr order of pirs where & Propert 1: the vlue is not negtive Propert 2: when &, the vlue is & The phi oeffiient nd the omplementr similrit mesure hve the following properties 1, 2 nd Therefore, the first prt of the totl ordered sequene where the vlue is positive, is equl to first prt of the sorted list where & nd the vlue is positive Moreover, this list ontins ll pirs tht hve positive orreltion This list is long enough for the tul pplition Propert 1: when! + &, the vlue is negtive Propert 2: when nd re not orrelted, the (4) For eh doument, ssign it to D estimted vlue is & (5) N = N + 1 (6) For eh word in D Propert : when nd tend to pper t the (7) ssign the word to X sme time, the estimted vlue is positive (8) For eh word in D (9) ssign the word to Y It should e relled tht the numer of pirs (1) DFA(X, Y)=DFA(X,Y)+1 where! # & is less thn The sorted (11) end of loop list is otined in # # om- (12) end of loop (1) end of loop puttion time, where is the mimum numer of different words/lels in one doument Sine is onstnt, it eomes, even if the sie ofvoulr is ver lrge It is true tht for the given some fied voulr of sie " #, might e lrger thn " # s we inrese the sie of orpus Fortuntel, the tul memor onsumption of this proedure lso hve the upper ound of " #, nd we will not loose n memor spe When " is not fied nd " m eome ver lrge ompre to # proper nouns, is smller thn " # s is the se for 9 Cse stud of Newspper Corpus The omputtion time of the seline sstem is " # where " is the distint numer of lels in the

5 % & time(se) speed(se/do) Tle 1: The tul eeution time shows liner reltionship to the sie of input dt orpus When we nled lels of nmes of ples in newspper over the ourse of one er, this orpus onsisted of out 6, douments The ple nmes totlled 192 fter morphologil nlsis The mimum numer of nmes in one doument ws 142, nd the verge in one doument ws 42 In this se, the method desried here, ws muh more effiient thn the seline sstem Tle 1 shows the tul eeution time of the progrm in the ppendi, hnging the length of the orpus This progrm omputes similrit vlues for ll pirs of words where & It indites tht the eeution time is liner Our oservtion shows tht even if the orpus were etended er er, whih is the mimum numer of different words in one doument is stle, even though the totl numer of words would inrese with the ongoing ddition of proper nouns nd new onepts 1 For lrge orpus Although the progrm in the ppendi nnot e pplied to orpus lrger thn memor sie, we n otin tle of using sequentil ess to file The progrm in the ppendi stores ever pir in # memor The spe requirement of m seem too gret to hold in memor However, sequentil file n e used to otin the tle, s follows Although the omputtion time for is rther thn, the totl omputtion time remins the sme euse omputtion of is required to selet pirs in oth Eh line orre- ses Consider the following dt sponds to one doument When the pirs of words in eh doument re reorded, the following file is otined Note tht sine!, it is not neessr to reord pirs where This redues the memor requirement Using the merge sort lgorithm whih n sort lrge file using sequentil ess onl, the file n e sorted in omputtion time After sorting in lphetil order, sme pirs ome together Then, the pirs n e ounted with sequentil ess, there providing the! tle An emple of this tle fllows: It should e noted tht the tle n e otined esil etrting lines in whih letter of the first olumn nd tht of the seond olumn re the sme, sine The tle n usull e stored in memor sine it is one dimensionl rr After storing in memor, similrit n e omputed line line The following emple uses the

6 phi oeffiient The first olumn is the oeffiient, followed,,,, nd Sine the phi oeffiient is refletive, the vlue where is not required When the funtion is not smmetri, nd n e ehnged t the sme time The ordered list n e otined sorting this tle with the first olumn This emple shows tht pirs where &, suh s or, do not dd n overhed to either memor or omputtion time 11 Comprison with Apriori There is well known lgorithm for forming list of relted items termed Apriori(Arrwl nd Sriknt, 1995) Apriori lists ll reltionship using onfidene, where is lrger thn speified vlue Using Apriori, the! threshold n e speified in order to redue omputtion, wheres with the proposed method, there is no w to djust this threshold This implies tht Apriori m e fster thn our lgorithm in terms of onfidene However, sine Apriori uses the propert of onfidene to redue omputtion, it nnot e used for other funtions, unlike the proposed method whih n emplo mn stndrd funtions, t lest the five mesures used here inluding onfidene 12 Correltion of All Sustrings When omputing orreltions of ll sustrings in Sine the orpus, " n e s lrge s 7 % memor spe requirement nd omputtion time does not depend on ", this method n e used to generte list of the most hightl orrelted sustrings of n length In ft, in some ses, m e too lrge to ompute Churh, 21) llows for the retion of The Ymmoto-Churh method(ymmoto nd tle using memor spe nd omputtion time, where represents ll sustrings in given orpus Ymmoto s method shows tht lthough there m e 7 % kinds of sustrings in orpus, there is ourene ptterns (or sets of sustrings whih hve sme ourene pttern) t most The omputtionl ost is gretl redued if we del with eh pttern insted of eh sustring Although the order of omputionl ompleit does not depend on ", differs whether the pttern is used or not We hve lso developed sstem using the pttern whih tull redues the ost of omputtion Although the numer of is still prolemti even using the Ymmoto- Churh method, nd lthough the omputtion ost is muh lrger thn using words, the progrm runs muh fster thn the simple method 1 Conlusion This pper desries method for seleting orrelted pirs in memor spe nd omputtion time, where is the numer of douments in orpus, provided tht there is n upper oundr in the numer of different words/lels in one doument/reord We hve oserved tht orpus usull hs this kind of upper oundr, nd hve shown tht we n uses sequentil file for most of our memor requirements This method is useful not onl for onfidene ut lso for other funtions whose vlues re deided,,, Emples of these funtions re mutul informtion, the die oeffiient, the onfidene mesure, the phi oeffiient nd the omplimentr similrit mesure Referenes K W Churh nd P Hnks 199 Word ssoition norms, mutul informtion nd leiogrph Computtionl Linguistis, 16(1):22 29 R Agrwl nd R Sriknt 1995 Mining of ssoition rules etween sets of items in lrge dtses In Proeedings of the ACM SIGMOD Conferene on Mngement of Dt:94 15 N Hgit nd M Swki: 1995 Roust reognition of degrded mhine-printedhrters using omplimentr similrit mesure nd error-orretion lerning Proeedings of the SPIE - The Interntionl Soiet for Optil Engineering 2442:24 244

7 U M Fd, G Pitetsk-Shpiro, nd P Smth The KDD Proess for Etrting Useful Knowledge from Volumes of Dt Communitions of the ACM, 9(11):27 4, Christopher D Mnning nd Hinrih Shuete, 1999 Chpter 85, Semnti Similrit Foundtions of sttistil nturl lnguge proessing:294, The MIT Press Christopher D Mnning nd Hinrih Shuete, 1999 Chpter 5, Person s hi-squre test Foundtions of sttistil nturl lnguge proessing: , The MIT Press Mikio Ymmoto nd Kenneth W Churh 21 Using Suffi Arrrs to Compute Term Frequen nd Doument Frequen for All Sustring in Corpus Computtionl Linguistis, 27(1):1, The MIT Press Appendi Smple of DATA Tkruk Toko Okinw Ytushiro Hiroshim Kurihr Onomihi Yokohm Toko Ihihr Toko Aiuwkmtu Fukushim Toko Mtumoto Shr Utsunomi Toko Aomori Shimokit Smple Progrm(smwk) 1 # Definition of similrit - 2 # Complimentr Similrit Mesure funtion f(,,, d) { 4 return ( * d - * ) / sqrt(( + ) * ( + d)); 5 } 6 # For eh line, ount up oth df() nd df(, ) 7 { for(i=2; i<= NF; i++) { 8 df[$i]++; 9 for(j=i;j<= NF; j++) { 1 df[$i, $j]++; 11 } 12 } 1 } 14 # For ll (, ) where df(, )<>, get the vlue 15 END{ 16 for(k in df) { 17 split(k,, SUBSEP); 18 if([1]!= [2]) { 19 = df[k]; 2 = df[[1]] - ; 21 = df[[2]] - ; 22 d = NR ; 2 r = f(,,, d); 24 printf("%16f\t%s\t%s\n", 25 r, [1], [2]); 26 r = f(,,, d); 27 printf("%16f\t%s\t%s\n", 28 r, [2], [1]); 29 } } 1 } Usge: $ wk -f smwk < mitt sort -nr hed -2

Duality in linear interval equations

Duality in linear interval equations Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

[SYLWAN., 158(6)]. ISI

[SYLWAN., 158(6)]. ISI The proposl of Improved Inext Isomorphi Grph Algorithm to Detet Design Ptterns Afnn Slem B-Brhem, M. Rizwn Jmeel Qureshi Fulty of Computing nd Informtion Tehnology, King Adulziz University, Jeddh, SAUDI

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Parallelization Optimization of System-Level Specification

Parallelization Optimization of System-Level Specification Prlleliztion Optimiztion of System-Level Speifition Luki i niel. Gjski enter for Emedded omputer Systems University of liforni Irvine, 92697, US {li, gjski} @es.ui.edu strt This pper introdues the prlleliztion

More information

Midterm Exam CSC October 2001

Midterm Exam CSC October 2001 Midterm Exm CSC 173 23 Otoer 2001 Diretions This exm hs 8 questions, severl of whih hve suprts. Eh question indites its point vlue. The totl is 100 points. Questions 5() nd 6() re optionl; they re not

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116 [Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Distance Computation between Non-convex Polyhedra at Short Range Based on Discrete Voronoi Regions

Distance Computation between Non-convex Polyhedra at Short Range Based on Discrete Voronoi Regions Distne Computtion etween Non-onvex Polyhedr t Short Rnge Bsed on Disrete Voronoi Regions Ktsuki Kwhi nd Hiroms Suzuki Deprtment of Preision Mhinery Engineering, The University of Tokyo 7-3-1 Hongo, Bunkyo-ku,

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Width and Bounding Box of Imprecise Points

Width and Bounding Box of Imprecise Points Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview

COSC 6374 Parallel Computation. Non-blocking Collective Operations. Edgar Gabriel Fall Overview COSC 6374 Prllel Computtion Non-loking Colletive Opertions Edgr Griel Fll 2014 Overview Impt of olletive ommunition opertions Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Type Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables

Type Checking. Roadmap (Where are we?) Last lecture Context-sensitive analysis. This lecture Type checking. Symbol tables Type Cheking Rodmp (Where re we?) Lst leture Contet-sensitie nlysis Motition Attriute grmmrs Ad ho Synt-direted trnsltion This leture Type heking Type systems Using synt direted trnsltion Symol tles Leil

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Containers: Queue and List

Containers: Queue and List Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of

More information

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model. Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Can Pythagoras Swim?

Can Pythagoras Swim? Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Additional Measurement Algorithms in the Overhauser Magnetometer POS-1

Additional Measurement Algorithms in the Overhauser Magnetometer POS-1 Additionl Mesurement Algorithms in the Overhuser Mgnetometer POS-1 O.V. Denisov, A.Y. Denisov, V.A. Spunov (QM Lortory of Url Stte Tehnil University, Mir 19, Ekterinurg, 620002, Russi) J.L. Rsson (Royl

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition

More information

Lecture 12 : Topological Spaces

Lecture 12 : Topological Spaces Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

Photovoltaic Panel Modelling Using a Stochastic Approach in MATLAB &Simulink

Photovoltaic Panel Modelling Using a Stochastic Approach in MATLAB &Simulink hotovolti nel Modelling Using Stohsti Approh in MATLAB &Simulink KAREL ZALATILEK, JAN LEUCHTER eprtment of Eletril Engineering University of efene Kouniov 65, 61 City of Brno CZECH REUBLIC krelzpltilek@unoz,

More information

A METHOD FOR CHARACTERIZATION OF THREE-PHASE UNBALANCED DIPS FROM RECORDED VOLTAGE WAVESHAPES

A METHOD FOR CHARACTERIZATION OF THREE-PHASE UNBALANCED DIPS FROM RECORDED VOLTAGE WAVESHAPES A METHOD FOR CHARACTERIZATION OF THREE-PHASE UNBALANCED DIPS FROM RECORDED OLTAGE WAESHAPES M.H.J. Bollen, L.D. Zhng Dept. Eletri Power Engineering Chlmers University of Tehnology, Gothenurg, Sweden Astrt:

More information

Section 5.3 : Finding Area Between Curves

Section 5.3 : Finding Area Between Curves MATH 9 Section 5. : Finding Are Between Curves Importnt: In this section we will lern just how to set up the integrls to find re etween curves. The finl nswer for ech emple in this hndout is given for

More information

Error Numbers of the Standard Function Block

Error Numbers of the Standard Function Block A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution

More information

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The

More information

Computational geometry

Computational geometry Leture 23 Computtionl geometry Supplementl reding in CLRS: Chpter 33 exept 33.3 There re mny importnt prolems in whih the reltionships we wish to nlyze hve geometri struture. For exmple, omputtionl geometry

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

Single-Layer Trunk Routing Using 45-Degree Lines within Critical Areas for PCB Routing

Single-Layer Trunk Routing Using 45-Degree Lines within Critical Areas for PCB Routing SASIMI 2010 Proeedings (R3-8) Single-Lyer Trunk Routing Using 45-Degree Lines within Critil Ares for PCB Routing Kyosuke SHINODA Yukihide KOHIRA Atsushi TAKAHASHI Tokyo Institute of Tehnology Dept. of

More information

SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS

SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS Progress In Eletromgnetis Reserh C, Vol. 3, 195 22, 28 SMALL SIZE EDGE-FED SIERPINSKI CARPET MICROSTRIP PATCH ANTENNAS W.-L. Chen nd G.-M. Wng Rdr Engineering Deprtment Missile Institute of Air Fore Engineering

More information

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page.

6.045J/18.400J: Automata, Computability and Complexity. Quiz 2: Solutions. Please write your name in the upper corner of each page. 6045J/18400J: Automt, Computbility nd Complexity Mrh 30, 2005 Quiz 2: Solutions Prof Nny Lynh Vinod Vikuntnthn Plese write your nme in the upper orner of eh pge Problem Sore 1 2 3 4 5 6 Totl Q2-1 Problem

More information

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the

this grammar generates the following language: Because this symbol will also be used in a later step, it receives the LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.

More information

Right Angled Trigonometry. Objective: To know and be able to use trigonometric ratios in rightangled

Right Angled Trigonometry. Objective: To know and be able to use trigonometric ratios in rightangled C2 Right Angled Trigonometry Ojetive: To know nd e le to use trigonometri rtios in rightngled tringles opposite C Definition Trigonometry ws developed s method of mesuring ngles without ngulr units suh

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

An Approach to Filter the Test Data for Killing Multiple Mutants in Different Locations

An Approach to Filter the Test Data for Killing Multiple Mutants in Different Locations Interntionl Journl of Computer Theory nd Engineering, Vol. 5, No. 2, April 2013 An Approh to Filter the Test Dt for Killing Multiple Mutnts in Different Lotions Ngendr Prtp Singh, Rishi Mishr, Silesh Tiwri,

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

Advanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs.

Advanced Programming Handout 5. Enter Okasaki. Persistent vs. Ephemeral. Functional Queues. Simple Example. Persistent vs. Avne Progrmming Hnout 5 Purel Funtionl Dt Strutures: A Cse Stu in Funtionl Progrmming Persistent vs. Ephemerl An ephemerl t struture is one for whih onl one version is ville t time: fter n upte opertion,

More information

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion

Shared Memory Architectures. Programming and Synchronization. Today s Outline. Page 1. Message passing review Cosmic Cube discussion Tody s Outline Arhitetures Progrmming nd Synhroniztion Disuss pper on Cosmi Cube (messge pssing) Messge pssing review Cosmi Cube disussion > Messge pssing mhine Shred memory model > Communition > Synhroniztion

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

String comparison by transposition networks

String comparison by transposition networks String omprison y trnsposition networks Alexnder Tiskin (Joint work with Peter Krushe) Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin (inludes n extended version of this

More information

Comparison between nmos Pass Transistor logic style vs. CMOS Complementary Cells*

Comparison between nmos Pass Transistor logic style vs. CMOS Complementary Cells* Comprison etween nmos Pss Trnsistor logi style vs. CMOS Complementry Cells* Rkesh Mehrotr, Mssoud Pedrm Xunwei Wu Dept. of E.E.-Systems Dept. of Eletroni Eng. University of Southern Cliforni Hngzhou University

More information

s 1 t 4 s 2 4 t 2 a b r 2 r 8 r10 g 4

s 1 t 4 s 2 4 t 2 a b r 2 r 8 r10 g 4 k-pirs Non-Crossing Shortest Pths in Simple Polgon Evnthi Ppdopoulou Northwestern Universit, Evnston, Illinois 60208, USA Astrt. This pper presents n O(n + k) time lgorithm to ompute the set of k non-rossing

More information

Fundamentals of Engineering Analysis ENGR Matrix Multiplication, Types

Fundamentals of Engineering Analysis ENGR Matrix Multiplication, Types Fundmentls of Engineering Anlysis ENGR - Mtri Multiplition, Types Spring Slide Mtri Multiplition Define Conformle To multiply A * B, the mtries must e onformle. Given mtries: A m n nd B n p The numer of

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Approximate Joins for Data Centric XML

Approximate Joins for Data Centric XML Approximte Joins for Dt Centri XML Nikolus Augsten 1, Mihel Böhlen 1, Curtis Dyreson, Johnn Gmper 1 1 Fulty of Computer Siene, Free University of Bozen-Bolzno Dominiknerpltz 3, Bozen, Itly {ugsten,oehlen,gmper}@inf.uniz.it

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

Tiling Triangular Meshes

Tiling Triangular Meshes Tiling Tringulr Meshes Ming-Yee Iu EPFL I&C 1 Introdution Astrt When modelling lrge grphis senes, rtists re not epeted to model minute nd repetitive fetures suh s grss or snd with individul piees of geometry

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

A distributed edit-compile workflow

A distributed edit-compile workflow Time Synhroniztion nd Logil Cloks Tody 1. The need for time synhroniztion 2. Wll lok time synhroniztion 3. Logil Time: Lmport Cloks COS 418: Distriuted Systems Leture 4 Kyle Jmieson 2 A distriuted edit-ompile

More information

4.3 Balanced Trees. let us assume that we can manipulate them conveniently and see how they can be put together to form trees.

4.3 Balanced Trees. let us assume that we can manipulate them conveniently and see how they can be put together to form trees. 428 T FOU 4.3 Blned Trees T BT GOIT IN T VIOU setion work well for wide vriety of pplitions, ut they hve poor worst-se performne. s we hve noted, files lredy in order, files in reverse order, files with

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

COSC 6374 Parallel Computation. Dense Matrix Operations

COSC 6374 Parallel Computation. Dense Matrix Operations COSC 6374 Prllel Computtion Dense Mtrix Opertions Edgr Griel Fll Edgr Griel Prllel Computtion Edgr Griel erminology Dense Mtrix: ll elements of the mtrix ontin relevnt vlues ypilly stored s 2-D rry, (e.g.

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

Inter-domain Routing

Inter-domain Routing COMP 631: NETWORKED & DISTRIBUTED SYSTEMS Inter-domin Routing Jsleen Kur Fll 2016 1 Internet-sle Routing: Approhes DV nd link-stte protools do not sle to glol Internet How to mke routing slle? Exploit

More information

)

) Chpter Five /SOLUTIONS Since the speed ws between nd mph during this five minute period, the fuel efficienc during this period is between 5 mpg nd 8 mpg. So the fuel used during this period is between

More information

Colour-texture analysis of paintings using ICA filter banks

Colour-texture analysis of paintings using ICA filter banks Colour-texture nlysis of pintings using ICA filter nks Nnne vn Noord Nnne@tilurguniversity.edu Tilurg University, Wrndeln 2, 5037 AB Tilurg, The Netherlnds Eri Postm E.O.Postm@tilurguniversity.edu Tilurg

More information

McAfee Web Gateway

McAfee Web Gateway Relese Notes Revision C MAfee We Gtewy 7.6.2.11 Contents Aout this relese Enhnement Resolved issues Instlltion instrutions Known issues Additionl informtion Find produt doumenttion Aout this relese This

More information

The Basic Properties of the Integral

The Basic Properties of the Integral The Bsic Properties of the Integrl When we compute the derivtive of complicted function, like + sin, we usull use differentition rules, like d [f()+g()] d f()+ d g(), to reduce the computtion d d d to

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

Triple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding

Triple/Quadruple Patterning Layout Decomposition via Novel Linear Programming and Iterative Rounding Triple/Qudruple Ptterning Lyout Deomposition vi Novel Liner Progrmming nd Itertive Rounding Yio Lin, Xioqing Xu, Bei Yu, Ross Bldik nd Dvid Z. Pn ECE Dept., University of Texs t Austin, Austin, TX USA

More information

Lily Yen and Mogens Hansen

Lily Yen and Mogens Hansen SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

Matrices and Systems of Equations

Matrices and Systems of Equations Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.

More information

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

6.3 Definite Integrals and Antiderivatives

6.3 Definite Integrals and Antiderivatives Section 6. Definite Integrls nd Antiderivtives 8 6. Definite Integrls nd Antiderivtives Wht ou will lern out... Properties of Definite Integrls Averge Vlue of Function Men Vlue Theorem for Definite Integrls

More information

COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE

COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE 24 th Interntionl Conferene on Eletriity Distriution Glsgow, 12-15 June 2017 Pper 0615 COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE Mihel SANKUR Dniel ARNOLD Lun SCHECTOR

More information

A decision support system prototype for fuzzy multiple objective optimization

A decision support system prototype for fuzzy multiple objective optimization EUSFLAT - LFA A eision support system prototype for fuzzy multiple ojetive optimiztion Fengjie Wu Jie Lu n Gungqun Zhng Fulty of Informtion Tehnology University of Tehnology Syney Austrli E-mil: {fengjiewjieluzhngg}@it.uts.eu.u

More information

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation

Package Contents. Wireless-G USB Network Adapter with SpeedBooster USB Cable Setup CD-ROM with User Guide (English only) Quick Installation A Division of Ciso Systems, In. Pkge Contents Wireless-G USB Network Adpter with SpeedBooster USB Cle Setup CD-ROM with User Guide (English only) Quik Instlltion 2,4 GHz 802.11g Wireless Model No. Model

More information

Incremental Mining of Partial Periodic Patterns in Time-series Databases

Incremental Mining of Partial Periodic Patterns in Time-series Databases CERIAS Teh Report 2000-03 Inremental Mining of Partial Periodi Patterns in Time-series Dataases Mohamed G. Elfeky Center for Eduation and Researh in Information Assurane and Seurity Purdue University,

More information

Summer Review Packet For Algebra 2 CP/Honors

Summer Review Packet For Algebra 2 CP/Honors Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

The notation y = f(x) gives a way to denote specific values of a function. The value of f at a can be written as f( a ), read f of a.

The notation y = f(x) gives a way to denote specific values of a function. The value of f at a can be written as f( a ), read f of a. Chpter Prerequisites for Clculus. Functions nd Grphs Wht ou will lern out... Functions Domins nd Rnges Viewing nd Interpreting Grphs Even Functions nd Odd Functions Smmetr Functions Defined in Pieces Asolute

More information