MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam
|
|
- Lorin Powers
- 5 years ago
- Views:
Transcription
1 Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy
2 Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2... s n vn 0. (0,0,) (0,,) Ientify susets of linerly inepenent vetors. MERL mm//yy 2
3 Grph Theory MITSUBISHI ELECTRIC RESEARCH LABORATORIES Choose susets of eges without yles (lso known s forests olletion of trees). MERL mm//yy 3
4 Assignment of Jos Person tkes Jo. Every jo hs only opening. 2 3 Applints Jos Ientify possile ssignments etween pplints n jos D E D E D E MERL mm//yy 4
5 Buget onstrints E { } E {,, }. 2 2 Ientify susets of the set E (,,, ) suh tht mximum of element is tken from suset E { } n mximum of 2 elements re tken from suset E {,, } MERL mm//yy 5
6 Vertex isjoint pths S T Fin ll vertex isjoint pths from verties in S to verties in T. S T S T S T MERL mm//yy 6
7 Common properties All five prolems hve the sme solutions.,,,,,,,,,,, The size of the lrgest set: 3 The empty set is lwys solution. All susets of given solution is lso solution. All these senrios n e represente using mtrois! MERL mm//yy 7
8 Mtrois re everywhere, if only we knew how to look. MERL mm//yy 8
9 Mtroi Definition (introue y Whitney in 935) A mtroi is pir (E,Ι ) where E is finite set. Ι is fmily of susets of E suh tht: (I) Ι (I2) If A B n B Ι then A Ι. (I3) If A, B Ι n A B, then there exists e B suh tht ( A e) I. E is lle the groun set n olletion of inepenent sets. Ι is referre to s the MERL mm//yy 9
10 Grphi Mtroi Let G ( V, E ) e grph n let Ι e olletion of ege sets (susets of E) without yles, then (E,Ι ) is mtroi. E {,,, } Inepenent sets MERL
11 Mtroi Definition (using n Exmple) (I) is n inepenent set. (2) Sine is inepenent, then ll its suset {,,,,,, } re lso inepenent. (I3) If I, J Ι n I J there exists, e J suh tht ( I e) I.,,,,,,,,,, MERL mm//yy
12 Liner Mtroi Let E e finite set of vetors in vetor spe V n let Ι e the olletion of linerly epenent sets in E then (E,Ι ) is mtroi. (,0,0) (0,,0) (0,,) (0,0,) E {,,, } MERL
13 Prtition Mtroi Let E e finite set of vetors n let E, E2,..., E N e isjoint susets of E. Given N positive integers k,..., k, let Ι e the olletion of susets of eh suset hs tmost from (E,Ι ) is mtroi. N E k. i E i E, k E 2, k2 2 Inepenent sets MERL
14 Trnsversl Mtroi Let G e iprtite grph with iprtition ( D, E). Let Ι e the olletion of susets of E whih n e mthe to (E,Ι ) D. is mtroi. 2 3 D E D E D E D E MERL mm//yy 4
15 Bsis of Mtroi MITSUBISHI ELECTRIC RESEARCH LABORATORIES A sis of mtroi is mximl inepenent set. Exmple: Bses:,, All the ses of mtroi hve the sme size. MERL mm//yy 5
16 Rnk Let (E,Ι ) e mtroi. The rnk of suset of E is given y the size of the lrgest inepenent set ontine in it. The rnk of set A, A E : rnk(a) rgmx B A,B I B rnk({, rnk({,,,}) }) 2 3 rnk({,,}) 2 MERL mm//yy 6
17 Dul of mtroi is mtroi If the ul mtroi of M (E,Ι ) * * * is M ( E,Ι ) n A Ι then E A hs se of M (E,Ι ). M (E,Ι ), * M ( E,Ι ) *,,,,,,,,,,,,,,, MERL mm//yy 7
18 Greey Algorithm Given mtroi (E,Ι ) n weights w : E R, fin sis of minimum weight.. Strt with A {}. 2. A to A the smllest e s.t A e I. 3. Repet until you hve sis. (Greey lgorithm gurntees n optiml soln.) (The unerlying struture is mtroi) MERL mm//yy 8
19 Greey Algorithm Given mtroi (E,Ι ) n weights w : E R, fin sis of minimum weight. min A E s. t. e A i A A I, M w e i i rnk( E) p ( E, I) Miniml spnning lgorithm is very simple n useful! MERL mm//yy 9
20 Mtrois in other omins physil relizility They lso pper in severl geometry prolems: rrngements of hyperplnes, onfigurtions of points, et. Sugihr s pproh lifts line rwings to 3D spe for triherl rwings. Chek whether line rwing is physilly relizle or not. The lifting proeure where the 3D points re ompute on the projetion rys stisfying ll the onstrints from projetions n line lels. For generl line rwings, Whiteley extene Sugihr s work using mtrois in 989. MERL mm//yy 20
21 Line-Lifting Given single imge pture y your moile phone or other evies: Imge Re, Blue n Green enote lines in orthogonl iretions VRML moel of the line reonstrution [Rmlingm n Brn, 203] MERL mm//yy 2
22 Our Min Ie G H C F D Orthogonl input lines from rel imge B E A 9 intersetions y onneting nery lines. H is wrong intersetion All intersetions n not simultneously stisfy mer projetion, orthogonlity n prllelism onstrints F E G D A 7 intersetions when we remove H B C F E Only 6 intersetions when we inlue H Our min ssumption is tht the mximum rinlity suset tht stisfies ll the onstrints will onsist of orret intersetions. MERL mm//yy 22 D A H B F E G D A H B C
23 Miniml Spnning Tree (MST) for line-lifting ll intersetions Intersetions in the MST Two perspetive views of the line reonstrution Using gp etween the line segments s the ege osts, we ompute MST to ientify the lest numer of onstrints to lift the lines to 3D spe. MERL mm//yy 23
24 Qulittive Evlution imge etete lines Two perspetive views of the line reonstrution MERL mm//yy 24
25 Greey Algorithms for sumoulr ojetive funtions uner mtroi onstrint We n lso fin suset tht mximizes sumoulr funtion uner the onstrint tht the suset is n inepenent set of mtroi. The solution omes with some optimlity gurntees. sumoulr [Nemhuser, Fisher & Wolsey 78] MERL mm//yy 25
26 Mximize monotoni sumoulr funtions uner one or more mtrois Theorem: For monotoni sumoulr funtions, greey lgorithm gives onstnt ftor pproximtion ( p ) F( A ) 2 F( greey A opt Greey gives over intersetion of p mtrois. ) MERL [Nemhuser, Fisher & Wolsey 78] 26
27 Exmple: Cmer network Groun set Configurtion: Sensing qulity moel Configurtion is fesile if no mer is pointe in two iretions t one MERL Slie ourtesy: Kruse 27
28 Exmple: Cmer network Groun set Configurtion: Sensing qulity moel Configurtion is fesile if no mer is pointe in two iretions t one This is prtition mtroi: Inepenene: MERL Slie ourtesy: Kruse 28
29 Greey lgorithm for mtrois: Given: finite set V Wnt: suh tht Greey lgorithm: Strt with While MERL Slie ourtesy: Kruse 29
30 Superpixel Segmenttion Pixel representtion Superpixel representtion Suset Seletion Prolem n optimiztion prolem on grph topology mx F( A ) sujet to n A results in K lusters Proues stte-of-the-rt results in superpixel segmenttion n lustering tsets. [Liu et l. 20, 203] MERL mm//yy 30
31 Referenes Oxley, Mtroi Theory, 20 (possily the est mteril, ut time-onsuming). The Coming of the Mtrois", Willim Cunninghm, 202. Welsh, Mtroi Theory, 975. Slies n Vieos: Jeff Bilmes, Sumoulr Funtions, Optimiztion, n Applitions to Mhine Lerning, 204. Feerio Aril, Mtroi Theory, MERL mm//yy 3
Greedy Algorithm. Algorithm Fall Semester
Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion
More informationChapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.
Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationV = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)
Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from
More informationIntroduction. Example
OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining
More informationWidth and Bounding Box of Imprecise Points
Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,
More informationLecture 13: Graphs I: Breadth First Search
Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry
More informationGraph theory Route problems
Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re
More informationLecture 12 : Topological Spaces
Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationChapter 4 Fuzzy Graph and Relation
Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :
More informationOutline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals
Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs
More informationInternet Routing. Reminder: Routing. CPSC Network Programming
PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet
More informationLesson 4.4. Euler Circuits and Paths. Explore This
Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different
More informationSection 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that
Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationWORKSHOP 9 HEX MESH USING SWEEP VECTOR
WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationLecture 8: Graph-theoretic problems (again)
COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V
More informationInternet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationDuality in linear interval equations
Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny
More informationCOMP108 Algorithmic Foundations
Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationA dual of the rectangle-segmentation problem for binary matrices
A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationFEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.
Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions
More informationGraph Contraction and Connectivity
Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others
More informationUTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS
UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-
More informationDoubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral
Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut
More information3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull
Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron
More informationCooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks
oopertive Routing in Multi-Soure Multi-estintion Multi-hop Wireless Networks Jin Zhng Qin Zhng eprtment of omputer Siene n ngineering Hong Kong University of Siene n Tehnology, HongKong {zjzj, qinzh}@se.ust.hk
More informationA matching algorithm for measuring the structural similarity between an XML document and a DTD and its applications $
Informtion Systems 29 (2004) 23 46 A mthing lgorithm for mesuring the struturl similrity etween n XML oument n DTD n its pplitions $ Elis Bertino, Giovnn Guerrini, Mro Mesiti, * Diprtimento i Informti
More informationBayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs
Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:
More informationContainers: Queue and List
Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of
More information12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler
CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt
More informationAdjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.
Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood
More informationWORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS
WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WS19-1 WS19-2 Prolem Desription This exerise is use to emonstrte how to mp isplement results from the nlysis of glol(overll) moel onto the perimeter of
More informationCS553 Lecture Introduction to Data-flow Analysis 1
! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow
More informationConvex Hull Algorithms. Convex hull: basic facts
CG Leture D Conve Hull Algorithms Bsi fts Algorithms: Nïve, Gift wrpping, Grhm sn, Quik hull, Divide-nd-onquer Lower ound 3D Bsi fts Algorithms: Gift wrpping, Divide nd onquer, inrementl Conve hulls in
More informationTight triangulations: a link between combinatorics and topology
Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited
More informationStructure in solution spaces: Three lessons from Jean-Claude
Struture in solution spes: Three lessons from Jen-Clue Dvi Eppstein Computer Siene Deprtment, Univ. of Cliforni, Irvine Conferene on Meningfulness n Lerning Spes: A Triute to the Work of Jen-Clue Flmgne
More information[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116
[Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationDistributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems
Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,
More informationParadigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms
Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS453 INTRODUCTION TO DATAFLOW ANALYSIS
CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationClass Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414
Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationCalculus Differentiation
//007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationCOMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.
COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationCOMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE
24 th Interntionl Conferene on Eletriity Distriution Glsgow, 12-15 June 2017 Pper 0615 COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE Mihel SANKUR Dniel ARNOLD Lun SCHECTOR
More informationComparison-based Choices
Comprison-se Choies John Ugner Mngement Siene & Engineering Stnfor University Joint work with: Jon Kleinerg (Cornell) Senhil Mullinthn (Hrvr) EC 17 Boston June 28, 2017 Preiting isrete hoies Clssi prolem:
More information1 Disjoint-set data structure.
CS 124 Setion #4 Union-Fin, Greey Algorithms 2/20/17 1 Disjoint-set ata struture. 1.1 Operations Disjoint-set ata struture enale us to effiiently perform operations suh as plaing elements into sets, querying
More informationProblem Final Exam Set 2 Solutions
CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationTable-driven look-ahead lexical analysis
Tle-riven look-he lexil nlysis WUU YANG Computer n Informtion Siene Deprtment Ntionl Chio-Tung University, HsinChu, Tiwn, R.O.C. Astrt. Moern progrmming lnguges use regulr expressions to efine vli tokens.
More informationWORKSHOP 8B TENSION COUPON
WORKSHOP 8B TENSION COUPON WS8B-2 Workshop Ojetives Prtie reting n eiting geometry Prtie mesh seeing n iso meshing tehniques. WS8B-3 Suggeste Exerise Steps 1. Crete new tse. 2. Crete geometry moel of the
More informationAn Efficient Algorithm for the Physical Mapping of Clustered Task Graphs onto Multiprocessor Architectures
An Effiient Algorithm for the Physil Mpping of Clustere Tsk Grphs onto Multiproessor Arhitetures Netrios Koziris Pnyiotis Tsnks Mihel Romesis George Ppkonstntinou Ntionl Tehnil University of Athens Dept.
More informationFinal Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book
inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationLesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs
Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationWORKSHOP 8A TENSION COUPON
WORKSHOP 8A TENSION COUPON WS8A-2 Workshop Ojetives Buil the tension oupon geometry Control the mesh y using tehniques isusse in lss Compre FEA stress results to theoretil results From Stress Conentrtion
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationGENG2140 Modelling and Computer Analysis for Engineers
GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points
More informationQuadrilateral and Tetrahedral Mesh Stripification Using 2-Factor Partitioning of the Dual Graph
The Visul omputer mnusript No. (will e inserted y the editor) Plo Diz-Gutierrez M. Gopi Qudrilterl nd Tetrhedrl Mesh Stripifition Using 2-Ftor Prtitioning of the Dul Grph strt In order to find 2-ftor of
More informationThe Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline
CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More informations 1 t 4 s 2 4 t 2 a b r 2 r 8 r10 g 4
k-pirs Non-Crossing Shortest Pths in Simple Polgon Evnthi Ppdopoulou Northwestern Universit, Evnston, Illinois 60208, USA Astrt. This pper presents n O(n + k) time lgorithm to ompute the set of k non-rossing
More informationAutomatic Morphological Reconstruction of Neurons from Multiphoton and Confocal Microscopy Images Using 3D Tubular Models
Neuroinform (2015) 13:297 320 DOI 10.1007/s12021-014-9253-2 ORIGINAL ARTICLE Automti Morphologil Reonstrution of Neurons from Multiphoton n Confol Mirosopy Imges Using 3D Tuulr Moels Alerto Sntmrí-Png
More informationPattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions
Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its
More information1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?
1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection
More information5 ANGLES AND POLYGONS
5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationConsistent Mesh Parameterizations
Sumitted for pulition, Jnury 2001 Consistent Mesh Prmeteriztions Emil Prun Prineton Wim Sweldens Bell Ls Peter Shröder Bell Ls + + + + + + + = Figure 1: When given set of hed models n ovious shpe to ompute
More informationPROBLEM OF APOLLONIUS
PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles
More informationDesign Space Exploration for Massively Parallel Processor Arrays
In Proeedings of the Sixth Interntionl Conferene on Prllel Computing Tehnologies (PCT-2001), Novosiirsk, Russi, Septemer 3-7, 2001. Volume 2127 of Leture Notes in Computer Siene (LNCS), pp. 51-65, Springer-Verlg,
More informationMATH 25 CLASS 5 NOTES, SEP
MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid
More informationTracking Hidden Agents Through Shadow Information Spaces
Trking Hidden Agents Through Shdow Informtion Spes Jingjin Yu Steven M. LVlle jyu@uiu.edu lvlle@uiu.edu Deprtment of Computer Siene University of Illinois Urn, IL 601 USA Astrt This pper ddresses prolems
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationGraph Searching & Perfect Graphs
Grph Serhing & Perfet Grphs Lll Moutdid University of Toronto Astrt Perfet grphs, y definition, hve nie struture, tht grph serhing seems to extrt in, often non-inexpensive, mnner. We srth the surfe of
More informationCS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over
More informationError Numbers of the Standard Function Block
A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More information