MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

Size: px
Start display at page:

Download "MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam"

Transcription

1 Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy

2 Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2... s n vn 0. (0,0,) (0,,) Ientify susets of linerly inepenent vetors. MERL mm//yy 2

3 Grph Theory MITSUBISHI ELECTRIC RESEARCH LABORATORIES Choose susets of eges without yles (lso known s forests olletion of trees). MERL mm//yy 3

4 Assignment of Jos Person tkes Jo. Every jo hs only opening. 2 3 Applints Jos Ientify possile ssignments etween pplints n jos D E D E D E MERL mm//yy 4

5 Buget onstrints E { } E {,, }. 2 2 Ientify susets of the set E (,,, ) suh tht mximum of element is tken from suset E { } n mximum of 2 elements re tken from suset E {,, } MERL mm//yy 5

6 Vertex isjoint pths S T Fin ll vertex isjoint pths from verties in S to verties in T. S T S T S T MERL mm//yy 6

7 Common properties All five prolems hve the sme solutions.,,,,,,,,,,, The size of the lrgest set: 3 The empty set is lwys solution. All susets of given solution is lso solution. All these senrios n e represente using mtrois! MERL mm//yy 7

8 Mtrois re everywhere, if only we knew how to look. MERL mm//yy 8

9 Mtroi Definition (introue y Whitney in 935) A mtroi is pir (E,Ι ) where E is finite set. Ι is fmily of susets of E suh tht: (I) Ι (I2) If A B n B Ι then A Ι. (I3) If A, B Ι n A B, then there exists e B suh tht ( A e) I. E is lle the groun set n olletion of inepenent sets. Ι is referre to s the MERL mm//yy 9

10 Grphi Mtroi Let G ( V, E ) e grph n let Ι e olletion of ege sets (susets of E) without yles, then (E,Ι ) is mtroi. E {,,, } Inepenent sets MERL

11 Mtroi Definition (using n Exmple) (I) is n inepenent set. (2) Sine is inepenent, then ll its suset {,,,,,, } re lso inepenent. (I3) If I, J Ι n I J there exists, e J suh tht ( I e) I.,,,,,,,,,, MERL mm//yy

12 Liner Mtroi Let E e finite set of vetors in vetor spe V n let Ι e the olletion of linerly epenent sets in E then (E,Ι ) is mtroi. (,0,0) (0,,0) (0,,) (0,0,) E {,,, } MERL

13 Prtition Mtroi Let E e finite set of vetors n let E, E2,..., E N e isjoint susets of E. Given N positive integers k,..., k, let Ι e the olletion of susets of eh suset hs tmost from (E,Ι ) is mtroi. N E k. i E i E, k E 2, k2 2 Inepenent sets MERL

14 Trnsversl Mtroi Let G e iprtite grph with iprtition ( D, E). Let Ι e the olletion of susets of E whih n e mthe to (E,Ι ) D. is mtroi. 2 3 D E D E D E D E MERL mm//yy 4

15 Bsis of Mtroi MITSUBISHI ELECTRIC RESEARCH LABORATORIES A sis of mtroi is mximl inepenent set. Exmple: Bses:,, All the ses of mtroi hve the sme size. MERL mm//yy 5

16 Rnk Let (E,Ι ) e mtroi. The rnk of suset of E is given y the size of the lrgest inepenent set ontine in it. The rnk of set A, A E : rnk(a) rgmx B A,B I B rnk({, rnk({,,,}) }) 2 3 rnk({,,}) 2 MERL mm//yy 6

17 Dul of mtroi is mtroi If the ul mtroi of M (E,Ι ) * * * is M ( E,Ι ) n A Ι then E A hs se of M (E,Ι ). M (E,Ι ), * M ( E,Ι ) *,,,,,,,,,,,,,,, MERL mm//yy 7

18 Greey Algorithm Given mtroi (E,Ι ) n weights w : E R, fin sis of minimum weight.. Strt with A {}. 2. A to A the smllest e s.t A e I. 3. Repet until you hve sis. (Greey lgorithm gurntees n optiml soln.) (The unerlying struture is mtroi) MERL mm//yy 8

19 Greey Algorithm Given mtroi (E,Ι ) n weights w : E R, fin sis of minimum weight. min A E s. t. e A i A A I, M w e i i rnk( E) p ( E, I) Miniml spnning lgorithm is very simple n useful! MERL mm//yy 9

20 Mtrois in other omins physil relizility They lso pper in severl geometry prolems: rrngements of hyperplnes, onfigurtions of points, et. Sugihr s pproh lifts line rwings to 3D spe for triherl rwings. Chek whether line rwing is physilly relizle or not. The lifting proeure where the 3D points re ompute on the projetion rys stisfying ll the onstrints from projetions n line lels. For generl line rwings, Whiteley extene Sugihr s work using mtrois in 989. MERL mm//yy 20

21 Line-Lifting Given single imge pture y your moile phone or other evies: Imge Re, Blue n Green enote lines in orthogonl iretions VRML moel of the line reonstrution [Rmlingm n Brn, 203] MERL mm//yy 2

22 Our Min Ie G H C F D Orthogonl input lines from rel imge B E A 9 intersetions y onneting nery lines. H is wrong intersetion All intersetions n not simultneously stisfy mer projetion, orthogonlity n prllelism onstrints F E G D A 7 intersetions when we remove H B C F E Only 6 intersetions when we inlue H Our min ssumption is tht the mximum rinlity suset tht stisfies ll the onstrints will onsist of orret intersetions. MERL mm//yy 22 D A H B F E G D A H B C

23 Miniml Spnning Tree (MST) for line-lifting ll intersetions Intersetions in the MST Two perspetive views of the line reonstrution Using gp etween the line segments s the ege osts, we ompute MST to ientify the lest numer of onstrints to lift the lines to 3D spe. MERL mm//yy 23

24 Qulittive Evlution imge etete lines Two perspetive views of the line reonstrution MERL mm//yy 24

25 Greey Algorithms for sumoulr ojetive funtions uner mtroi onstrint We n lso fin suset tht mximizes sumoulr funtion uner the onstrint tht the suset is n inepenent set of mtroi. The solution omes with some optimlity gurntees. sumoulr [Nemhuser, Fisher & Wolsey 78] MERL mm//yy 25

26 Mximize monotoni sumoulr funtions uner one or more mtrois Theorem: For monotoni sumoulr funtions, greey lgorithm gives onstnt ftor pproximtion ( p ) F( A ) 2 F( greey A opt Greey gives over intersetion of p mtrois. ) MERL [Nemhuser, Fisher & Wolsey 78] 26

27 Exmple: Cmer network Groun set Configurtion: Sensing qulity moel Configurtion is fesile if no mer is pointe in two iretions t one MERL Slie ourtesy: Kruse 27

28 Exmple: Cmer network Groun set Configurtion: Sensing qulity moel Configurtion is fesile if no mer is pointe in two iretions t one This is prtition mtroi: Inepenene: MERL Slie ourtesy: Kruse 28

29 Greey lgorithm for mtrois: Given: finite set V Wnt: suh tht Greey lgorithm: Strt with While MERL Slie ourtesy: Kruse 29

30 Superpixel Segmenttion Pixel representtion Superpixel representtion Suset Seletion Prolem n optimiztion prolem on grph topology mx F( A ) sujet to n A results in K lusters Proues stte-of-the-rt results in superpixel segmenttion n lustering tsets. [Liu et l. 20, 203] MERL mm//yy 30

31 Referenes Oxley, Mtroi Theory, 20 (possily the est mteril, ut time-onsuming). The Coming of the Mtrois", Willim Cunninghm, 202. Welsh, Mtroi Theory, 975. Slies n Vieos: Jeff Bilmes, Sumoulr Funtions, Optimiztion, n Applitions to Mhine Lerning, 204. Feerio Aril, Mtroi Theory, MERL mm//yy 3

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

Introduction. Example

Introduction. Example OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining

More information

Width and Bounding Box of Imprecise Points

Width and Bounding Box of Imprecise Points Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

Graph theory Route problems

Graph theory Route problems Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re

More information

Lecture 12 : Topological Spaces

Lecture 12 : Topological Spaces Leture 12 : Topologil Spes 1 Topologil Spes Topology generlizes notion of distne nd loseness et. Definition 1.1. A topology on set X is olletion T of susets of X hving the following properties. 1. nd X

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Chapter 4 Fuzzy Graph and Relation

Chapter 4 Fuzzy Graph and Relation Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :

More information

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

WORKSHOP 9 HEX MESH USING SWEEP VECTOR

WORKSHOP 9 HEX MESH USING SWEEP VECTOR WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Duality in linear interval equations

Duality in linear interval equations Aville online t http://ijim.sriu..ir Int. J. Industril Mthemtis Vol. 1, No. 1 (2009) 41-45 Dulity in liner intervl equtions M. Movhedin, S. Slhshour, S. Hji Ghsemi, S. Khezerloo, M. Khezerloo, S. M. Khorsny

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model.

FEEDBACK: The standard error of a regression is not an unbiased estimator for the standard deviation of the error in a multiple regression model. Introutory Eonometris: A Moern Approh 6th Eition Woolrige Test Bnk Solutions Complete ownlo: https://testbnkre.om/ownlo/introutory-eonometris-moern-pproh-6th-eition-jeffreym-woolrige-test-bnk/ Solutions

More information

Graph Contraction and Connectivity

Graph Contraction and Connectivity Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others

More information

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS

UTMC APPLICATION NOTE UT1553B BCRT TO INTERFACE PSEUDO-DUAL-PORT RAM ARCHITECTURE INTRODUCTION ARBITRATION DETAILS DESIGN SELECTIONS UTMC APPLICATION NOTE UT1553B BCRT TO 80186 INTERFACE INTRODUCTION The UTMC UT1553B BCRT is monolithi CMOS integrte iruit tht provies omprehensive Bus Controller n Remote Terminl funtions for MIL-STD-

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks

Cooperative Routing in Multi-Source Multi-Destination Multi-hop Wireless Networks oopertive Routing in Multi-Soure Multi-estintion Multi-hop Wireless Networks Jin Zhng Qin Zhng eprtment of omputer Siene n ngineering Hong Kong University of Siene n Tehnology, HongKong {zjzj, qinzh}@se.ust.hk

More information

A matching algorithm for measuring the structural similarity between an XML document and a DTD and its applications $

A matching algorithm for measuring the structural similarity between an XML document and a DTD and its applications $ Informtion Systems 29 (2004) 23 46 A mthing lgorithm for mesuring the struturl similrity etween n XML oument n DTD n its pplitions $ Elis Bertino, Giovnn Guerrini, Mro Mesiti, * Diprtimento i Informti

More information

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:

More information

Containers: Queue and List

Containers: Queue and List Continers: Queue n List Queue A ontiner in whih insertion is one t one en (the til) n eletion is one t the other en (the he). Also lle FIFO (First-In, First-Out) Jori Cortell n Jori Petit Deprtment of

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v. Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood

More information

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS

WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WORKSHOP 19 GLOBAL/LOCAL MODELING USING FEM FIELDS WS19-1 WS19-2 Prolem Desription This exerise is use to emonstrte how to mp isplement results from the nlysis of glol(overll) moel onto the perimeter of

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Convex Hull Algorithms. Convex hull: basic facts

Convex Hull Algorithms. Convex hull: basic facts CG Leture D Conve Hull Algorithms Bsi fts Algorithms: Nïve, Gift wrpping, Grhm sn, Quik hull, Divide-nd-onquer Lower ound 3D Bsi fts Algorithms: Gift wrpping, Divide nd onquer, inrementl Conve hulls in

More information

Tight triangulations: a link between combinatorics and topology

Tight triangulations: a link between combinatorics and topology Tight tringultions: link between ombintoris nd topology Jonthn Spreer Melbourne, August 15, 2016 Topologil mnifolds (Geometri) Topology is study of mnifolds (surfes) up to ontinuous deformtion Complited

More information

Structure in solution spaces: Three lessons from Jean-Claude

Structure in solution spaces: Three lessons from Jean-Claude Struture in solution spes: Three lessons from Jen-Clue Dvi Eppstein Computer Siene Deprtment, Univ. of Cliforni, Irvine Conferene on Meningfulness n Lerning Spes: A Triute to the Work of Jen-Clue Flmgne

More information

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116

[Prakash* et al., 5(8): August, 2016] ISSN: IC Value: 3.00 Impact Factor: 4.116 [Prksh* et l 58: ugust 6] ISSN: 77-9655 I Vlue: Impt Ftor: 6 IJESRT INTERNTIONL JOURNL OF ENGINEERING SIENES & RESERH TEHNOLOGY SOME PROPERTIES ND THEOREM ON FUZZY SU-TRIDENT DISTNE Prveen Prksh* M Geeth

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems

Distributed Systems Principles and Paradigms. Chapter 11: Distributed File Systems Distriuted Systems Priniples nd Prdigms Mrten vn Steen VU Amsterdm, Dept. Computer Siene steen@s.vu.nl Chpter 11: Distriuted File Systems Version: Deemer 10, 2012 2 / 14 Distriuted File Systems Distriuted

More information

Distributed Systems Principles and Paradigms

Distributed Systems Principles and Paradigms Distriuted Systems Priniples nd Prdigms Christoph Dorn Distriuted Systems Group, Vienn University of Tehnology.dorn@infosys.tuwien..t http://www.infosys.tuwien..t/stff/dorn Slides dpted from Mrten vn Steen,

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE

COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE 24 th Interntionl Conferene on Eletriity Distriution Glsgow, 12-15 June 2017 Pper 0615 COMPUTATION AND VISUALIZATION OF REACHABLE DISTRIBUTION NETWORK SUBSTATION VOLTAGE Mihel SANKUR Dniel ARNOLD Lun SCHECTOR

More information

Comparison-based Choices

Comparison-based Choices Comprison-se Choies John Ugner Mngement Siene & Engineering Stnfor University Joint work with: Jon Kleinerg (Cornell) Senhil Mullinthn (Hrvr) EC 17 Boston June 28, 2017 Preiting isrete hoies Clssi prolem:

More information

1 Disjoint-set data structure.

1 Disjoint-set data structure. CS 124 Setion #4 Union-Fin, Greey Algorithms 2/20/17 1 Disjoint-set ata struture. 1.1 Operations Disjoint-set ata struture enale us to effiiently perform operations suh as plaing elements into sets, querying

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Table-driven look-ahead lexical analysis

Table-driven look-ahead lexical analysis Tle-riven look-he lexil nlysis WUU YANG Computer n Informtion Siene Deprtment Ntionl Chio-Tung University, HsinChu, Tiwn, R.O.C. Astrt. Moern progrmming lnguges use regulr expressions to efine vli tokens.

More information

WORKSHOP 8B TENSION COUPON

WORKSHOP 8B TENSION COUPON WORKSHOP 8B TENSION COUPON WS8B-2 Workshop Ojetives Prtie reting n eiting geometry Prtie mesh seeing n iso meshing tehniques. WS8B-3 Suggeste Exerise Steps 1. Crete new tse. 2. Crete geometry moel of the

More information

An Efficient Algorithm for the Physical Mapping of Clustered Task Graphs onto Multiprocessor Architectures

An Efficient Algorithm for the Physical Mapping of Clustered Task Graphs onto Multiprocessor Architectures An Effiient Algorithm for the Physil Mpping of Clustere Tsk Grphs onto Multiproessor Arhitetures Netrios Koziris Pnyiotis Tsnks Mihel Romesis George Ppkonstntinou Ntionl Tehnil University of Athens Dept.

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs

Lesson6: Modeling the Web as a graph Unit5: Linear Algebra for graphs Lesson6: Modeling the We s grph Unit5: Liner Alger for grphs Rene Pikhrdt Introdution to We Siene Prt 2 Emerging We Properties Rene Pikhrdt Institute CC-BY-SA-3. for We Siene nd Tehnologies Modeling the

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

WORKSHOP 8A TENSION COUPON

WORKSHOP 8A TENSION COUPON WORKSHOP 8A TENSION COUPON WS8A-2 Workshop Ojetives Buil the tension oupon geometry Control the mesh y using tehniques isusse in lss Compre FEA stress results to theoretil results From Stress Conentrtion

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Quadrilateral and Tetrahedral Mesh Stripification Using 2-Factor Partitioning of the Dual Graph

Quadrilateral and Tetrahedral Mesh Stripification Using 2-Factor Partitioning of the Dual Graph The Visul omputer mnusript No. (will e inserted y the editor) Plo Diz-Gutierrez M. Gopi Qudrilterl nd Tetrhedrl Mesh Stripifition Using 2-Ftor Prtitioning of the Dul Grph strt In order to find 2-ftor of

More information

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline

The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

s 1 t 4 s 2 4 t 2 a b r 2 r 8 r10 g 4

s 1 t 4 s 2 4 t 2 a b r 2 r 8 r10 g 4 k-pirs Non-Crossing Shortest Pths in Simple Polgon Evnthi Ppdopoulou Northwestern Universit, Evnston, Illinois 60208, USA Astrt. This pper presents n O(n + k) time lgorithm to ompute the set of k non-rossing

More information

Automatic Morphological Reconstruction of Neurons from Multiphoton and Confocal Microscopy Images Using 3D Tubular Models

Automatic Morphological Reconstruction of Neurons from Multiphoton and Confocal Microscopy Images Using 3D Tubular Models Neuroinform (2015) 13:297 320 DOI 10.1007/s12021-014-9253-2 ORIGINAL ARTICLE Automti Morphologil Reonstrution of Neurons from Multiphoton n Confol Mirosopy Imges Using 3D Tuulr Moels Alerto Sntmrí-Png

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers?

1.1. Interval Notation and Set Notation Essential Question When is it convenient to use set-builder notation to represent a set of numbers? 1.1 TEXAS ESSENTIAL KNOWLEDGE AND SKILLS Prepring for 2A.6.K, 2A.7.I Intervl Nottion nd Set Nottion Essentil Question When is it convenient to use set-uilder nottion to represent set of numers? A collection

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

Consistent Mesh Parameterizations

Consistent Mesh Parameterizations Sumitted for pulition, Jnury 2001 Consistent Mesh Prmeteriztions Emil Prun Prineton Wim Sweldens Bell Ls Peter Shröder Bell Ls + + + + + + + = Figure 1: When given set of hed models n ovious shpe to ompute

More information

PROBLEM OF APOLLONIUS

PROBLEM OF APOLLONIUS PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles

More information

Design Space Exploration for Massively Parallel Processor Arrays

Design Space Exploration for Massively Parallel Processor Arrays In Proeedings of the Sixth Interntionl Conferene on Prllel Computing Tehnologies (PCT-2001), Novosiirsk, Russi, Septemer 3-7, 2001. Volume 2127 of Leture Notes in Computer Siene (LNCS), pp. 51-65, Springer-Verlg,

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Tracking Hidden Agents Through Shadow Information Spaces

Tracking Hidden Agents Through Shadow Information Spaces Trking Hidden Agents Through Shdow Informtion Spes Jingjin Yu Steven M. LVlle jyu@uiu.edu lvlle@uiu.edu Deprtment of Computer Siene University of Illinois Urn, IL 601 USA Astrt This pper ddresses prolems

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Graph Searching & Perfect Graphs

Graph Searching & Perfect Graphs Grph Serhing & Perfet Grphs Lll Moutdid University of Toronto Astrt Perfet grphs, y definition, hve nie struture, tht grph serhing seems to extrt in, often non-inexpensive, mnner. We srth the surfe of

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

Error Numbers of the Standard Function Block

Error Numbers of the Standard Function Block A.2.2 Numers of the Stndrd Funtion Blok evlution The result of the logi opertion RLO is set if n error ours while the stndrd funtion lok is eing proessed. This llows you to rnh to your own error evlution

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information