Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Size: px
Start display at page:

Download "Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved."

Transcription

1 Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve.

2 Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml irrevole For some prolems, yiels n optiml solution for every instne. For most, oes not ut n e useful for fst pproximtions. 9-2

3 Applitions of the Greey Strtegy Optiml solutions: hnge mking for norml oin enomintions minimum spnning tree (MST) single-soure shortest pths simple sheuling prolems Huffmn oes Approximtions: trveling slesmn prolem (TSP) knpsk prolem other omintoril optimiztion prolems 9-3

4 Chnge-Mking Prolem Given unlimite mounts of oins of enomintions 1 > > m, give hnge for mount n with the lest numer of oins Exmple: 1 = 25, 2 =10, 3 = 5, 4 = 1 n n = 48 Greey solution: Greey solution is optiml for ny mount n norml set of enomintions my not e optiml for ritrry oin enomintions 9-4

5 Minimum Spnning Tree (MST) Spnning tree of onnete grph G: : onnete yli sugrph of G tht inlues ll of G s verties Minimum spnning tree of weighte, onnete grph G: : spnning tree of G of minimum totl weight Exmple:

6 Prim s MST lgorithm Strt with tree T 1 onsisting of one (ny) vertex n grow tree one vertex t time to proue MST through series of expning sutrees T 1, T 2,, T n On eh itertion, onstrut T i+1 from T i y ing vertex not in T i tht is losest to those lrey in T i (this is greey step!) Stop when ll verties re inlue 9-6

7 Exmple

8 Notes out Prim s lgorithm Proof y inution tht this onstrution tully yiels MST Nees priority queue for loting losest fringe vertex Effiieny O(n 2 ) for weight mtrix representtion of grph n rry implementtion of priority queue O(m log n) ) for jeny list representtion of grph with n verties n m eges n min-hep implementtion of priority queue 9-8

9 Another greey lgorithm for MST: Kruskl s Sort the eges in noneresing orer of lengths Grow tree one ege t time to proue MST through series of expning forests F 1, F 2,, F n-1 On eh itertion, the next ege on the sorte list unless this woul rete yle. (If it woul, skip the ege.) 9-9

10 Exmple

11 Notes out Kruskl s lgorithm Algorithm looks esier thn Prim s ut is hrer to implement (heking for yles!) Cyle heking: yle is rete iff e ege onnets verties in the sme onnete omponent Union-fin lgorithms see setion

12 Minimum spnning tree vs. Steiner tree vs

13 Shortest pths Dijkstr s lgorithm Single Soure Shortest Pths Prolem: : Given weighte onnete grph G, fin shortest pths from soure vertex s to eh of the other verties Dijkstr s lgorithm: : Similr to Prim s MST lgorithm, with ifferent wy of omputing numeril lels: Among verties not lrey in the tree, it fins vertex u with the smllest sum v + w(v,u) where v is vertex for whih shortest pth hs een lrey foun on preeing itertions (suh verties form tree) v is the length of the shortest pth form soure to v w(v,u) ) is the length (weight) of ege from v to u 9-13

14 Exmple e Tree verties (-,0) Remining verties (,3) (-, ) (,7) e(-, ) e (,3) (,3+4) (,3+2) e(-, ) e (,5) (,7) e(,5+4) e (,7) e(,9) e(,9) e

15 Notes on Dijkstr s lgorithm Doesn t work for grphs with negtive weights Applile to oth unirete n irete grphs Effiieny O( V 2 ) for grphs represente y weight mtrix n rry implementtion of priority queue O( E log V ) for grphs represente y j. lists n min- hep implementtion of priority queue Don t mix up Dijkstr s lgorithm with Prim s lgorithm! 9-15

16 Coing Prolem Coing: : ssignment of it strings to lphet hrters Coewors: : it strings ssigne for hrters of lphet Two types of oes: fixe-length enoing (e.g., ASCII) vrile-length enoing (e,g., Morse oe) Prefix-free oes: : no oewor is prefix of nother oewor Prolem: If frequenies of the hrter ourrenes re known, wht is the est inry prefix-free oe? 9-16

17 Huffmn oes Any inry tree with eges lele with 0 s n 1 s yiels prefix-free oe of hrters ssigne to its leves Optiml inry tree minimizing the expete (weighte verge) length of oewor n e onstrute s follows Huffmn s lgorithm Initilize n one-noe trees with lphet hrters n the tree weights with their frequenies. Repet the following step n-1 times: join two inry trees with smllest weights into one (s left n right sutrees) n mke its weight equl the sum of the weights of the two trees. Mrk eges leing to left n right sutrees with 0 s n 1 s, respetively. 9-17

18 Exmple B _ C D B _ C D A A B _ A C D C 0.2 D A hrter A B C D _ frequeny B _ C D B _ A oewor verge its per hrter: 2.25 for fixe-length enoing: 3 ompression rtio: : (3-2.25)/3*100% = 25% 9-18

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chapter 9 Greedy Technique Copyright 2007 Pearson Addison-Wesley. All rights reserved. Greedy Technique Constructs a solution to an optimization problem piece by piece through a sequence of choices that

More information

Graph theory Route problems

Graph theory Route problems Bhelors thesis Grph theory Route prolems Author: Aolphe Nikwigize Dte: 986 - -5 Sujet: Mthemtis Level: First level (Bhelor) Course oe: MAE Astrt In this thesis we will review some route prolems whih re

More information

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals

Outline. CS38 Introduction to Algorithms. Graphs. Graphs. Graphs. Graph traversals Outline CS38 Introution to Algorithms Leture 2 April 3, 2014 grph trversls (BFS, DFS) onnetivity topologil sort strongly onnete omponents heps n hepsort greey lgorithms April 3, 2014 CS38 Leture 2 2 Grphs

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Introduction. Example

Introduction. Example OMS0 Introution isjoint sets n minimum spnning trees In this leture we will strt by isussing t struture use for mintining isjoint subsets of some bigger set. This hs number of pplitions, inluing to mintining

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Lecture 8: Graph-theoretic problems (again)

Lecture 8: Graph-theoretic problems (again) COMP36111: Advned Algorithms I Leture 8: Grph-theoreti prolems (gin) In Prtt-Hrtmnn Room KB2.38: emil: iprtt@s.mn..uk 2017 18 Reding for this leture: Sipser: Chpter 7. A grph is pir G = (V, E), where V

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

1 Disjoint-set data structure.

1 Disjoint-set data structure. CS 124 Setion #4 Union-Fin, Greey Algorithms 2/20/17 1 Disjoint-set ata struture. 1.1 Operations Disjoint-set ata struture enale us to effiiently perform operations suh as plaing elements into sets, querying

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Asurveyofpractical algorithms for suffix tree construction in external memory

Asurveyofpractical algorithms for suffix tree construction in external memory Asurveyofprtil lgorithms for suffix tree onstrution in externl memory M. Brsky,, U. Stege n A. Thomo University of Vitori, PO Box, STN CSC Vitori, BC, VW P, Cn SUMMAY The onstrution of suffix trees in

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler

12/9/14. CS151 Fall 20124Lecture (almost there) 12/6. Graphs. Seven Bridges of Königsberg. Leonard Euler CS5 Fll 04Leture (lmost there) /6 Seven Bridges of Königserg Grphs Prof. Tny Berger-Wolf Leonrd Euler 707-783 Is it possile to wlk with route tht rosses eh ridge e Seven Bridges of Königserg Forget unimportnt

More information

Graph Contraction and Connectivity

Graph Contraction and Connectivity Chpter 14 Grph Contrtion n Connetivity So fr we hve mostly overe tehniques for solving problems on grphs tht were evelope in the ontext of sequentil lgorithms. Some of them re esy to prllelize while others

More information

Greedy Algorithms Spanning Trees

Greedy Algorithms Spanning Trees Greedy Algoritms Spnning Trees Cpter 1, Wt mkes greedy lgoritm? Fesible Hs to stisfy te problem s constrints Loclly Optiml Te greedy prt Hs to mke te best locl coice mong ll fesible coices vilble on tt

More information

Chapter 16. Shortest Paths Shortest Weighted Paths

Chapter 16. Shortest Paths Shortest Weighted Paths Chpter 6 Shortet Pth Given grph where ege re lle with weight (or itne) n oure vertex, wht i the hortet pth etween the oure n ome other vertex? Prolem requiring u to nwer uh querie re roly known hortet-pth

More information

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator.

COMMON FRACTIONS. or a / b = a b. , a is called the numerator, and b is called the denominator. COMMON FRACTIONS BASIC DEFINITIONS * A frtion is n inite ivision. or / * In the frtion is lle the numertor n is lle the enomintor. * The whole is seprte into "" equl prts n we re onsiering "" of those

More information

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v.

Adjacency. Adjacency Two vertices u and v are adjacent if there is an edge connecting them. This is sometimes written as u v. Terminology Adjeny Adjeny Two verties u nd v re djent if there is n edge onneting them. This is sometimes written s u v. v v is djent to nd ut not to. 2 / 27 Neighourhood Neighourhood The open neighourhood

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Typing with Weird Keyboards Notes

Typing with Weird Keyboards Notes Typing with Weird Keyords Notes Ykov Berchenko-Kogn August 25, 2012 Astrct Consider lnguge with n lphet consisting of just four letters,,,, nd. There is spelling rule tht sys tht whenever you see n next

More information

13.1 Weighted Graphs and Their Representation

13.1 Weighted Graphs and Their Representation Chpter Shortet Pth In thi hpter we will over prolem involving fining the hortet pth etween vertie in grph with weight (length) on the ege. One oviou pplition i in fining the hortet route from one re to

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

Solids. Solids. Curriculum Ready.

Solids. Solids. Curriculum Ready. Curriulum Rey www.mthletis.om This ooklet is ll out ientifying, rwing n mesuring solis n prisms. SOM CUES The Som Cue ws invente y Dnish sientist who went y the nme of Piet Hein. It is simple 3 # 3 #

More information

Width and Bounding Box of Imprecise Points

Width and Bounding Box of Imprecise Points Width nd Bounding Box of Impreise Points Vhideh Keikh Mrten Löffler Ali Mohdes Zhed Rhmti Astrt In this pper we study the following prolem: we re given set L = {l 1,..., l n } of prllel line segments,

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure

An Algorithm for Enumerating All Maximal Tree Patterns Without Duplication Using Succinct Data Structure , Mrch 12-14, 2014, Hong Kong An Algorithm for Enumerting All Mximl Tree Ptterns Without Dupliction Using Succinct Dt Structure Yuko ITOKAWA, Tomoyuki UCHIDA nd Motoki SANO Astrct In order to extrct structured

More information

Internet Routing. Reminder: Routing. CPSC Network Programming

Internet Routing. Reminder: Routing. CPSC Network Programming PS 360 - Network Progrmming Internet Routing Mihele Weigle eprtment of omputer Siene lemson University mweigle@s.lemson.eu pril, 00 http://www.s.lemson.eu/~mweigle/ourses/ps360 Reminer: Routing Internet

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST

Outline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions

Pattern Matching. Pattern Matching. Pattern Matching. Review of Regular Expressions Pttern Mthing Pttern Mthing Some of these leture slides hve een dpted from: lgorithms in C, Roert Sedgewik. Gol. Generlize string serhing to inompletely speified ptterns. pplitions. Test if string or its

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

WORKSHOP 9 HEX MESH USING SWEEP VECTOR

WORKSHOP 9 HEX MESH USING SWEEP VECTOR WORKSHOP 9 HEX MESH USING SWEEP VECTOR WS9-1 WS9-2 Prolem Desription This exerise involves importing urve geometry from n IGES file. The urves re use to rete other urves. From the urves trimme surfes re

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Structure in solution spaces: Three lessons from Jean-Claude

Structure in solution spaces: Three lessons from Jean-Claude Struture in solution spes: Three lessons from Jen-Clue Dvi Eppstein Computer Siene Deprtment, Univ. of Cliforni, Irvine Conferene on Meningfulness n Lerning Spes: A Triute to the Work of Jen-Clue Flmgne

More information

Honors Thesis: Investigating the Algebraic Properties of Cayley Digraphs

Honors Thesis: Investigating the Algebraic Properties of Cayley Digraphs Honors Thesis: Investigting the Algebri Properties of Cyley Digrphs Alexis Byers, Wittenberg University Mthemtis Deprtment April 30, 2014 This pper utilizes Grph Theory to gin insight into the lgebri struture

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata

CS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION

LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION Overview LINX MATRIX SWITCHERS FIRMWARE UPDATE INSTRUCTIONS FIRMWARE VERSION 4.4.1.0 Due to the omplex nture of this updte, plese fmilirize yourself with these instrutions nd then ontt RGB Spetrum Tehnil

More information

CSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I

CSc 453 Compilers and Systems Software. 6 : Top-Down Parsing I C 45 Compilers n ystems oftwre 6 : op-down Prsing I Christin Collberg Deprtment of Computer iene University of rizon ollberg@gmil.om Copyright 2009 Christin Collberg eptember 14, 2009 1 Overview 2 Compiler

More information

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley

AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility

More information

COSC 6374 Parallel Computation. Dense Matrix Operations

COSC 6374 Parallel Computation. Dense Matrix Operations COSC 6374 Prllel Computtion Dense Mtrix Opertions Edgr Griel Fll Edgr Griel Prllel Computtion Edgr Griel erminology Dense Mtrix: ll elements of the mtrix ontin relevnt vlues ypilly stored s 2-D rry, (e.g.

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

Research Article Determining Sensor Locations in Wireless Sensor Networks

Research Article Determining Sensor Locations in Wireless Sensor Networks Interntionl Journl of Distriuted Sensor Networks Volume 2015, Artile ID 914625, 6 pges http://dx.doi.org/10.1155/2015/914625 Reserh Artile Determining Sensor Lotions in Wireless Sensor Networks Zimo Li

More information

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.

Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014. omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to

More information

Graph Searching & Perfect Graphs

Graph Searching & Perfect Graphs Grph Serhing & Perfet Grphs Lll Moutdid University of Toronto Astrt Perfet grphs, y definition, hve nie struture, tht grph serhing seems to extrt in, often non-inexpensive, mnner. We srth the surfe of

More information

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that

Section 2.3 Functions. Definition: Let A and B be sets. A function (mapping, map) f from A to B, denoted f :A B, is a subset of A B such that Setion 2.3 Funtions Definition: Let n e sets. funtion (mpping, mp) f from to, enote f :, is suset of suh tht x[x y[y < x, y > f ]] n [< x, y 1 > f < x, y 2 > f ] y 1 = y 2 Note: f ssoites with eh x in

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Table-driven look-ahead lexical analysis

Table-driven look-ahead lexical analysis Tle-riven look-he lexil nlysis WUU YANG Computer n Informtion Siene Deprtment Ntionl Chio-Tung University, HsinChu, Tiwn, R.O.C. Astrt. Moern progrmming lnguges use regulr expressions to efine vli tokens.

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

Chapter 4 Fuzzy Graph and Relation

Chapter 4 Fuzzy Graph and Relation Chpter 4 Fuzzy Grph nd Reltion Grph nd Fuzzy Grph! Grph n G = (V, E) n V : Set of verties(node or element) n E : Set of edges An edge is pir (x, y) of verties in V.! Fuzzy Grph ~ n ( ~ G = V, E) n V :

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

An Efficient Algorithm for the Physical Mapping of Clustered Task Graphs onto Multiprocessor Architectures

An Efficient Algorithm for the Physical Mapping of Clustered Task Graphs onto Multiprocessor Architectures An Effiient Algorithm for the Physil Mpping of Clustere Tsk Grphs onto Multiproessor Arhitetures Netrios Koziris Pnyiotis Tsnks Mihel Romesis George Ppkonstntinou Ntionl Tehnil University of Athens Dept.

More information

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs

Bayesian Networks: Directed Markov Properties (Cont d) and Markov Equivalent DAGs Byesin Networks: Direte Mrkov Properties (Cont ) n Mrkov Equivlent DAGs Huizhen Yu jney.yu@s.helsinki.fi Dept. Computer Siene, Univ. of Helsinki Proilisti Moels, Spring, 2010 Huizhen Yu (U.H.) Byesin Networks:

More information

String comparison by transposition networks

String comparison by transposition networks String omprison y trnsposition networks Alexnder Tiskin (Joint work with Peter Krushe) Deprtment of Computer Siene University of Wrwik http://www.ds.wrwik..uk/~tiskin (inludes n extended version of this

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Position Heaps: A Simple and Dynamic Text Indexing Data Structure

Position Heaps: A Simple and Dynamic Text Indexing Data Structure Position Heps: A Simple nd Dynmic Text Indexing Dt Structure Andrzej Ehrenfeucht, Ross M. McConnell, Niss Osheim, Sung-Whn Woo Dept. of Computer Science, 40 UCB, University of Colordo t Boulder, Boulder,

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information