Alignments BLAST, BLAT

Size: px
Start display at page:

Download "Alignments BLAST, BLAT"

Transcription

1 Alignments BLAST, BLAT

2 Genome Genome Gene vs Built of DNA DNA Describes Organism Protein gene Stored as Circular/ linear Single molecule, or a few of them Both (depending on the species) Part of genome Linear Life cycle DNA-DNA-DNA- DNA-RNA-protein Size Amount per cell Information content 05Mb *) 3500Mb 100b b % 100% ~30%

3 The amount of genetic information in organisms Name Mycoplasma genitalium Escherichia coli Saccharomyces cerevisiae Drosophila melanogaster Caenorhabtitis Genome size (Mb) # genes elegans Homo sapiens Zea mays

4 The amount of genetic information in organisms Largest genome: amoeba Chaos chaos (200x human genome)

5 Sequence searching - challenges Exponential growth of databases

6 Sequence searching definition Task: Query: short, new sequence (~1000 letters) Database (searching space): very many sequences Goal: find seqs homologous to the query

7 Sequence searching definition We want: fast tool primarily a filter: most sequences will be unrelated to the query fine-tune the alignment later

8 Database Search Algorithms: Sensitivity, Selectivity True Positive (TP) a homology detected (positive) correctly (true) Signal Detected Name Yes Yes True Positive No No True Negative Yes No False Negative No Yes False Positive

9 Courtesy of Gary Benson (ISSCB 2003) Database Search Algorithms: Sensitivity, Selectivity Sensitivity =TP/(TP+FN) Selectivity =TN/(TN+FP) Sensitivity Selectivity

10 What is BLAST Basic Local Alignment Search Tool Bad news: it is only a heuristics Heuristics: A rule of thumb that often helps in solving a certain class of problems, but makes no guarantees Perkins, DN (1981) The Mind's Best Work Basic idea: High scoring segments have well conserved (almost identical) part As well conserved part are identified, extend it to the real alignment - s e q - s e q u e

11 What means well conserved for BLAST? BLAST works with k-words (words of length k) k is a parameter different for DNA (>10) and proteins (24) word w 1 is T-similar to w 2 if the sum of pair scores is at least T (eg T=12) Similar 3-words W 1 : R K P W 2 : R R P Score: = 15

12 BLAST algorithm 3 basic steps 1)Preprocess 2)Scan 3)Extend 1)Preprocess the query: extract all the k-words 2)Scan for T-similar matches in database 3)Extend them to alignments

13 BLAST, Step 1: Preprocess the query 1)Preprocess 2)Scan 3)Extend Take the query (eg LVNRKPVVP) Chop it into overlapping k-words (k=3 in this case) Query: LVNRKPVVP Word1: LVN Word2: VNR Word3: NRK For each word find all similar words (scoring at least T) Eg for RKP the following 3-words are similar: QKP KKP RQP REP RRP RKP

14 Finite state machine abstract machine constant amount of memory (states) used in computation and languages recognizes regular expressions cp dmt*pdf /home/john 1)Preprocess 2)Scan 3)Extend AC*T GGC

15 BLAST, Step 2: Find exact matches 1)Preprocess 2)Scan 3)Extend with scanning Use all the T-similar k-words to build the Finite State Machine Scan for exact matches QKP KKP RQP movement REP RRP RKP VLQKPLKKPPLVKRQPCCEVVRKPLVKVIRCLA

16 BLAST, Step 3: 1)Preprocess 2)Scan 3)Extend Extending exact matches Having the list of exact matches we extend alignment in both directions Query: L V N R K P V V P T-similar: R R P Subject: G V C R R P L K C Score: till the sum of scores drops below some level X (eg X=-100) from the best known - what with gaps?

17 Gapped BLAST (now standard) 1)Preprocess 2)Scan 3)Extend gapped local alignments are computed: much, much, much slower therefore: modified Hit criteria

18 Hit criteria query pos Extends the alignment only if there are close two hits on the same diagonal sensitivity would drop without lowering T reduces extensions (90% time is spend on extensions) Gapped local alignments are computed increased sensitivity allows us raise T raising T speeds up the search close hit, same diag dbpos 1)Preprocess 2)Scan 3)Extend

19 Gapped BLAST v BLAST We end up with same speed gapped alignments! much higher sensitivity

20 BLAST flavours blastp: protein query, protein db blastn: DNA query, DNA db blastx: DNA query, protein db in all reading frames Used to find potential translation products of an unknown nucleotide sequence tblastn: protein query, DNA db database dynamically translated in all reading frames tblastx: DNA query, DNA db all translations of query against all translations of db

21 PSI-BLAST Position-Specific Iterated BLAST A profile is derived from the result of the first search Database is searched against the profile (instead of a sequence) Up to 3 iterations

22 Profile Profile is generalized form of sequence probabilities instead of a letter A C D W Y Score of the profile scorep,i, A= B p[i,b]score blosum62 A,B profile position letter

23 Constructing a profile Take significant BLAST results Make an alignment Assign weights to sequences Construct the profile A C D W Y

24 BLAT The Blast-Like Alignment Tool Large-scale genome comparison: query can be large Preprocessing phase: BLAST: query BLAT: db

25 BLAT, Step 1: Preprocess the 1)Preprocess 2)Scan 3)Extend database Index the database with k-words k=816 for nucleotides k=35 for proteins For each k-word store in which sequences it appears k-word: RKP Hashed DB: QKP: HUgn , Gene14, IG0, KKP: haemoglobin, Gene134, IG_30, RQP: HSPHOSR1, GeneA22 RKP: galactosyltransferase, IG_1 REP: haemoglobin, Gene134, IG_30, RRP: Z17368, Creatine kinase,

26 Hashing associative arrays 1)Preprocess 2)Scan 3)Extend Indexing with the object Hash function: hash: small (fits in memory) possible objects - large Objects should be well spread x

27 Hashing - examples 1)Preprocess 2)Scan 3)Extend T9 Predictive Text in mobile phones hello in Multitap: 4, 4, 3, 3, 5, 5, 5, (pause) 5, 5, 5, 6, 6, 6 hello in T9: 4, 3, 5, 5, 6 Collisions: 4, 6: in, go

28 BLAT, Step 1: Index to find exact matches with hashing 1)Preprocess 2)Scan 3)Extend The database is preprocessed only once! (independent from the query) k-word: RKP Hashed DB: QKP: HUgn , Gene14, IG0, KKP: haemoglobin, Gene134, IG_30, RQP: HSPHOSR1, GeneA22 RKP: galactosyltransferase, IG_1 REP: haemoglobin, Gene134, IG_30, RRP: Z17368, Creatine kinase,

29 BLAT, Step 2: 1)Preprocess 2)Scan 3)Extend Hit criteria In a constant time we can get the sequences with a certain k-word relaxing hit definition -> improve sensitivity allow imperfect hits costly, huge hash grows a few times! shorten k (would lead to FP), but expect two hits (see BLAST)

30 BLAT, Step 3: Identifying homologous 1)Preprocess 2)Scan 3)Extend regions Exclude common k-words For all k-words from query find out the position in db For results (qpos, dbpos): split into buckets (64kbp) sort on the diagonal (diag=qposdbpos)

31 BLAT, Step 3: Identifying homologous 1)Preprocess 2)Scan 3)Extend regions continued from diagonally close hits (gap limit) create pre-clusters sort each pre-cluster on dbpos create clusters from close hits run Local Alignment for each cluster

32 Seeds improving sensitivity More general form of k-word is a seed The seed CTGTAT gives hits with both sequences CTCGTTATA CTAGTAATG

33 How to detect homology? Take the score of an maximal local alignment can it be obtained by chance? any score can be obtained from comparing (long enough) random sequences

34 What is a chance? Extracting local alignments from random sequences P-value (eg =001) The probability of obtaining the result by pure chance An alignment giving lower P-value than set by user is considered a hit

35 Best Local Alignments by chance Create random seqs, each 1000aa long Find the max local align Repeat # Alignments Score

36 The Statistics of local alignment Subst matrix must guarantee E(score(a,b)) < 0 for random a, b Analytical solution sum of iid variables -> normal distribution max of iid -> extreme value distribution (EVD)

37 Expected number of aligns E-value: the expected number of alignments scoring >= S E=K m n e S 2x size of seq -> 2x number aligns 2x S -> E drops exponentially

38 E-value depends on n, m E=K m n e S Example For comparing seqa with seqb: S=88 -> E = 0001 For comparing seqa with 1000 seqs: score 88 -> E=1 Important for db searching: n size of query, m - size of db

39 Deriving K, L E=Kmne S The above eq is theoretical result for gapless (g=inf) alignment K, L can be derived from the subst table For gapped case it seems that the equation holds we can derive K, L from experiments # Alignments Score

40 Bit score S' E=Kmne S Score S depends on the substitution table What if we want table-independent score? E=mn2 S' where S'= S ln K ln 2

41 Why does the BLAST work? Relevant riddle Are there at least 2 people in Amsterdam with the same number of hairs? At most hairs on each head people living in Amsterdam

42 Why does the BLAST work? Pigeons pigeonhole principle: having 9 boxes and 10 pigeons, there is at least one box with more than 1 pigeon n=9, k=7 case:

43 Why does the BLAST work? Average case pigeonhole principle describes the worst case! On average we'll expect two pigeons in the same box much earlier Birthday paradox: among 23 people, probability that they have the same birthday is > 05 note: 365 boxes and only 23 pigeons!

44 Birthday paradox

45 Why does the BLA[S]T work? Forget the T-similar words, now use only identities 2 sequences, 100 nucleotides each: What's the minimal sequence identity for which there's a string of 3 consecutive identities? 0 identities, 100 mismatches: 67 identities, 33 mismatches: 68st? but if seqs are 50% id, we'll detect it with prob 99% 28% id -> we'll detect it with prob 50% how is it calculated?

46 Expected sensitivity We assume that letters are independent I identity between seqs, for human-mouse 86% for DNA, 89% for proteins p word id =I k

47 Expected sensitivity Q - query size number of non-overlapping words R= Q k prob of a hit p detect =1 1 p wordid R

48 Expected specificity How many matches by chance (C)? G genome size C=Q k1 G k 1 4 k For h-m, to get 99% sensitivity we have to set k=7, and for Q=1000 C ~= 25,000,000 7h assuming 1/1000 per alignment

As of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be

As of August 15, 2008, GenBank contained bases from reported sequences. The search procedure should be 48 Bioinformatics I, WS 09-10, S. Henz (script by D. Huson) November 26, 2009 4 BLAST and BLAT Outline of the chapter: 1. Heuristics for the pairwise local alignment of two sequences 2. BLAST: search and

More information

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading:

24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, This lecture is based on the following papers, which are all recommended reading: 24 Grundlagen der Bioinformatik, SS 10, D. Huson, April 26, 2010 3 BLAST and FASTA This lecture is based on the following papers, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid

More information

Sequence alignment theory and applications Session 3: BLAST algorithm

Sequence alignment theory and applications Session 3: BLAST algorithm Sequence alignment theory and applications Session 3: BLAST algorithm Introduction to Bioinformatics online course : IBT Sonal Henson Learning Objectives Understand the principles of the BLAST algorithm

More information

Biology 644: Bioinformatics

Biology 644: Bioinformatics Find the best alignment between 2 sequences with lengths n and m, respectively Best alignment is very dependent upon the substitution matrix and gap penalties The Global Alignment Problem tries to find

More information

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege

Sequence Alignment. GBIO0002 Archana Bhardwaj University of Liege Sequence Alignment GBIO0002 Archana Bhardwaj University of Liege 1 What is Sequence Alignment? A sequence alignment is a way of arranging the sequences of DNA, RNA, or protein to identify regions of similarity.

More information

BLAST MCDB 187. Friday, February 8, 13

BLAST MCDB 187. Friday, February 8, 13 BLAST MCDB 187 BLAST Basic Local Alignment Sequence Tool Uses shortcut to compute alignments of a sequence against a database very quickly Typically takes about a minute to align a sequence against a database

More information

Basic Local Alignment Search Tool (BLAST)

Basic Local Alignment Search Tool (BLAST) BLAST 26.04.2018 Basic Local Alignment Search Tool (BLAST) BLAST (Altshul-1990) is an heuristic Pairwise Alignment composed by six-steps that search for local similarities. The most used access point to

More information

BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha

BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio CS 466 Saurabh Sinha BLAST: Basic Local Alignment Search Tool Altschul et al. J. Mol Bio. 1990. CS 466 Saurabh Sinha Motivation Sequence homology to a known protein suggest function of newly sequenced protein Bioinformatics

More information

BLAST - Basic Local Alignment Search Tool

BLAST - Basic Local Alignment Search Tool Lecture for ic Bioinformatics (DD2450) April 11, 2013 Searching 1. Input: Query Sequence 2. Database of sequences 3. Subject Sequence(s) 4. Output: High Segment Pairs (HSPs) Sequence Similarity Measures:

More information

Bioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure

Bioinformatics. Sequence alignment BLAST Significance. Next time Protein Structure Bioinformatics Sequence alignment BLAST Significance Next time Protein Structure 1 Experimental origins of sequence data The Sanger dideoxynucleotide method F Each color is one lane of an electrophoresis

More information

CISC 636 Computational Biology & Bioinformatics (Fall 2016)

CISC 636 Computational Biology & Bioinformatics (Fall 2016) CISC 636 Computational Biology & Bioinformatics (Fall 2016) Sequence pairwise alignment Score statistics: E-value and p-value Heuristic algorithms: BLAST and FASTA Database search: gene finding and annotations

More information

Introduction to Computational Molecular Biology

Introduction to Computational Molecular Biology 18.417 Introduction to Computational Molecular Biology Lecture 13: October 21, 2004 Scribe: Eitan Reich Lecturer: Ross Lippert Editor: Peter Lee 13.1 Introduction We have been looking at algorithms to

More information

Database Searching Using BLAST

Database Searching Using BLAST Mahidol University Objectives SCMI512 Molecular Sequence Analysis Database Searching Using BLAST Lecture 2B After class, students should be able to: explain the FASTA algorithm for database searching explain

More information

Bioinformatics explained: BLAST. March 8, 2007

Bioinformatics explained: BLAST. March 8, 2007 Bioinformatics Explained Bioinformatics explained: BLAST March 8, 2007 CLC bio Gustav Wieds Vej 10 8000 Aarhus C Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com info@clcbio.com Bioinformatics

More information

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment

Wilson Leung 01/03/2018 An Introduction to NCBI BLAST. Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment An Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at https://blast.ncbi.nlm.nih.gov/blast.cgi

More information

Lecture 5 Advanced BLAST

Lecture 5 Advanced BLAST Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 5 Advanced BLAST BLAST Recap Sequence Alignment Complexity and indexing BLASTN and BLASTP Basic parameters

More information

Similarity Searches on Sequence Databases

Similarity Searches on Sequence Databases Similarity Searches on Sequence Databases Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Zürich, October 2004 Swiss Institute of Bioinformatics Swiss EMBnet node Outline Importance of

More information

BLAST, Profile, and PSI-BLAST

BLAST, Profile, and PSI-BLAST BLAST, Profile, and PSI-BLAST Jianlin Cheng, PhD School of Electrical Engineering and Computer Science University of Central Florida 26 Free for academic use Copyright @ Jianlin Cheng & original sources

More information

Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST

Wilson Leung 05/27/2008 A Simple Introduction to NCBI BLAST A Simple Introduction to NCBI BLAST Prerequisites: Detecting and Interpreting Genetic Homology: Lecture Notes on Alignment Resources: The BLAST web server is available at http://www.ncbi.nih.gov/blast/

More information

B L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture

B L A S T! BLAST: Basic local alignment search tool. Copyright notice. February 6, Pairwise alignment: key points. Outline of tonight s lecture February 6, 2008 BLAST: Basic local alignment search tool B L A S T! Jonathan Pevsner, Ph.D. Introduction to Bioinformatics pevsner@jhmi.edu 4.633.0 Copyright notice Many of the images in this powerpoint

More information

Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA.

Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence or library of DNA. Fasta is used to compare a protein or DNA sequence to all of the

More information

Pairwise Sequence Alignment. Zhongming Zhao, PhD

Pairwise Sequence Alignment. Zhongming Zhao, PhD Pairwise Sequence Alignment Zhongming Zhao, PhD Email: zhongming.zhao@vanderbilt.edu http://bioinfo.mc.vanderbilt.edu/ Sequence Similarity match mismatch A T T A C G C G T A C C A T A T T A T G C G A T

More information

Lecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations:

Lecture Overview. Sequence search & alignment. Searching sequence databases. Sequence Alignment & Search. Goals: Motivations: Lecture Overview Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating

More information

L4: Blast: Alignment Scores etc.

L4: Blast: Alignment Scores etc. L4: Blast: Alignment Scores etc. Why is Blast Fast? Silly Question Prove or Disprove: There are two people in New York City with exactly the same number of hairs. Large database search Database (n) Query

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2017 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

Sequence Alignment & Search

Sequence Alignment & Search Sequence Alignment & Search Karin Verspoor, Ph.D. Faculty, Computational Bioscience Program University of Colorado School of Medicine With credit and thanks to Larry Hunter for creating the first version

More information

FASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm.

FASTA. Besides that, FASTA package provides SSEARCH, an implementation of the optimal Smith- Waterman algorithm. FASTA INTRODUCTION Definition (by David J. Lipman and William R. Pearson in 1985) - Compares a sequence of protein to another sequence or database of a protein, or a sequence of DNA to another sequence

More information

Heuristic methods for pairwise alignment:

Heuristic methods for pairwise alignment: Bi03c_1 Unit 03c: Heuristic methods for pairwise alignment: k-tuple-methods k-tuple-methods for alignment of pairs of sequences Bi03c_2 dynamic programming is too slow for large databases Use heuristic

More information

COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching

COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1. Database Searching COS 551: Introduction to Computational Molecular Biology Lecture: Oct 17, 2000 Lecturer: Mona Singh Scribe: Jacob Brenner 1 Database Searching In database search, we typically have a large sequence database

More information

BLAST & Genome assembly

BLAST & Genome assembly BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies November 17, 2012 1 Introduction Introduction 2 BLAST What is BLAST? The algorithm 3 Genome assembly De

More information

MetaPhyler Usage Manual

MetaPhyler Usage Manual MetaPhyler Usage Manual Bo Liu boliu@umiacs.umd.edu March 13, 2012 Contents 1 What is MetaPhyler 1 2 Installation 1 3 Quick Start 2 3.1 Taxonomic profiling for metagenomic sequences.............. 2 3.2

More information

Bioinformatics for Biologists

Bioinformatics for Biologists Bioinformatics for Biologists Sequence Analysis: Part I. Pairwise alignment and database searching Fran Lewitter, Ph.D. Director Bioinformatics & Research Computing Whitehead Institute Topics to Cover

More information

INTRODUCTION TO BIOINFORMATICS

INTRODUCTION TO BIOINFORMATICS Molecular Biology-2019 1 INTRODUCTION TO BIOINFORMATICS In this section, we want to provide a simple introduction to using the web site of the National Center for Biotechnology Information NCBI) to obtain

More information

From Smith-Waterman to BLAST

From Smith-Waterman to BLAST From Smith-Waterman to BLAST Jeremy Buhler July 23, 2015 Smith-Waterman is the fundamental tool that we use to decide how similar two sequences are. Isn t that all that BLAST does? In principle, it is

More information

CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores.

CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. CS 284A: Algorithms for Computational Biology Notes on Lecture: BLAST. The statistics of alignment scores. prepared by Oleksii Kuchaiev, based on presentation by Xiaohui Xie on February 20th. 1 Introduction

More information

TCCAGGTG-GAT TGCAAGTGCG-T. Local Sequence Alignment & Heuristic Local Aligners. Review: Probabilistic Interpretation. Chance or true homology?

TCCAGGTG-GAT TGCAAGTGCG-T. Local Sequence Alignment & Heuristic Local Aligners. Review: Probabilistic Interpretation. Chance or true homology? Local Sequence Alignment & Heuristic Local Aligners Lectures 18 Nov 28, 2011 CSE 527 Computational Biology, Fall 2011 Instructor: Su-In Lee TA: Christopher Miles Monday & Wednesday 12:00-1:20 Johnson Hall

More information

Computational Molecular Biology

Computational Molecular Biology Computational Molecular Biology Erwin M. Bakker Lecture 3, mainly from material by R. Shamir [2] and H.J. Hoogeboom [4]. 1 Pairwise Sequence Alignment Biological Motivation Algorithmic Aspect Recursive

More information

An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST

An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST An Analysis of Pairwise Sequence Alignment Algorithm Complexities: Needleman-Wunsch, Smith-Waterman, FASTA, BLAST and Gapped BLAST Alexander Chan 5075504 Biochemistry 218 Final Project An Analysis of Pairwise

More information

BLAST & Genome assembly

BLAST & Genome assembly BLAST & Genome assembly Solon P. Pissis Tomáš Flouri Heidelberg Institute for Theoretical Studies May 15, 2014 1 BLAST What is BLAST? The algorithm 2 Genome assembly De novo assembly Mapping assembly 3

More information

CS313 Exercise 4 Cover Page Fall 2017

CS313 Exercise 4 Cover Page Fall 2017 CS313 Exercise 4 Cover Page Fall 2017 Due by the start of class on Thursday, October 12, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

CAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1

CAP BLAST. BIOINFORMATICS Su-Shing Chen CISE. 8/20/2005 Su-Shing Chen, CISE 1 CAP 5510-6 BLAST BIOINFORMATICS Su-Shing Chen CISE 8/20/2005 Su-Shing Chen, CISE 1 BLAST Basic Local Alignment Prof Search Su-Shing Chen Tool A Fast Pair-wise Alignment and Database Searching Tool 8/20/2005

More information

Introduction to Phylogenetics Week 2. Databases and Sequence Formats

Introduction to Phylogenetics Week 2. Databases and Sequence Formats Introduction to Phylogenetics Week 2 Databases and Sequence Formats I. Databases Crucial to bioinformatics The bigger the database, the more comparative research data Requires scientists to upload data

More information

How to Run NCBI BLAST on zcluster at GACRC

How to Run NCBI BLAST on zcluster at GACRC How to Run NCBI BLAST on zcluster at GACRC BLAST: Basic Local Alignment Search Tool Georgia Advanced Computing Resource Center University of Georgia Suchitra Pakala pakala@uga.edu 1 OVERVIEW What is BLAST?

More information

2) NCBI BLAST tutorial This is a users guide written by the education department at NCBI.

2) NCBI BLAST tutorial   This is a users guide written by the education department at NCBI. Web resources -- Tour. page 1 of 8 This is a guided tour. Any homework is separate. In fact, this exercise is used for multiple classes and is publicly available to everyone. The entire tour will take

More information

C E N T R. Introduction to bioinformatics 2007 E B I O I N F O R M A T I C S V U F O R I N T. Lecture 13 G R A T I V. Iterative homology searching,

C E N T R. Introduction to bioinformatics 2007 E B I O I N F O R M A T I C S V U F O R I N T. Lecture 13 G R A T I V. Iterative homology searching, C E N T R E F O R I N T E G R A T I V E B I O I N F O R M A T I C S V U Introduction to bioinformatics 2007 Lecture 13 Iterative homology searching, PSI (Position Specific Iterated) BLAST basic idea use

More information

Computational Genomics and Molecular Biology, Fall

Computational Genomics and Molecular Biology, Fall Computational Genomics and Molecular Biology, Fall 2015 1 Sequence Alignment Dannie Durand Pairwise Sequence Alignment The goal of pairwise sequence alignment is to establish a correspondence between the

More information

LAGAN and Multi-LAGAN: Efficient Tools for Large-Scale Multiple Alignment of Genomic DNA

LAGAN and Multi-LAGAN: Efficient Tools for Large-Scale Multiple Alignment of Genomic DNA LAGAN and Multi-LAGAN: Efficient Tools for Large-Scale Multiple Alignment of Genomic DNA Michael Brudno, Chuong B. Do, Gregory M. Cooper, et al. Presented by Xuebei Yang About Alignments Pairwise Alignments

More information

BGGN 213 Foundations of Bioinformatics Barry Grant

BGGN 213 Foundations of Bioinformatics Barry Grant BGGN 213 Foundations of Bioinformatics Barry Grant http://thegrantlab.org/bggn213 Recap From Last Time: 25 Responses: https://tinyurl.com/bggn213-02-f17 Why ALIGNMENT FOUNDATIONS Why compare biological

More information

FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:

FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10: FastA and the chaining problem, Gunnar Klau, December 1, 2005, 10:56 4001 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem

More information

Scoring and heuristic methods for sequence alignment CG 17

Scoring and heuristic methods for sequence alignment CG 17 Scoring and heuristic methods for sequence alignment CG 17 Amino Acid Substitution Matrices Used to score alignments. Reflect evolution of sequences. Unitary Matrix: M ij = 1 i=j { 0 o/w Genetic Code Matrix:

More information

Similarity searches in biological sequence databases

Similarity searches in biological sequence databases Similarity searches in biological sequence databases Volker Flegel september 2004 Page 1 Outline Keyword search in databases General concept Examples SRS Entrez Expasy Similarity searches in databases

More information

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database.

BLAST. Basic Local Alignment Search Tool. Used to quickly compare a protein or DNA sequence to a database. BLAST Basic Local Alignment Search Tool Used to quickly compare a protein or DNA sequence to a database. There is no such thing as a free lunch BLAST is fast and highly sensitive compared to competitors.

More information

FastA & the chaining problem

FastA & the chaining problem FastA & the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 1 Sources for this lecture: Lectures by Volker Heun, Daniel Huson and Knut Reinert,

More information

Lectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures

Lectures by Volker Heun, Daniel Huson and Knut Reinert, in particular last years lectures 4 FastA and the chaining problem We will discuss: Heuristics used by the FastA program for sequence alignment Chaining problem 4.1 Sources for this lecture Lectures by Volker Heun, Daniel Huson and Knut

More information

BIOL591: Introduction to Bioinformatics Alignment of pairs of sequences

BIOL591: Introduction to Bioinformatics Alignment of pairs of sequences BIOL591: Introduction to Bioinformatics Alignment of pairs of sequences Reading in text (Mount Bioinformatics): I must confess that the treatment in Mount of sequence alignment does not seem to me a model

More information

Single Pass, BLAST-like, Approximate String Matching on FPGAs*

Single Pass, BLAST-like, Approximate String Matching on FPGAs* Single Pass, BLAST-like, Approximate String Matching on FPGAs* Martin Herbordt Josh Model Yongfeng Gu Bharat Sukhwani Tom VanCourt Computer Architecture and Automated Design Laboratory Department of Electrical

More information

Chapter 4: Blast. Chaochun Wei Fall 2014

Chapter 4: Blast. Chaochun Wei Fall 2014 Course organization Introduction ( Week 1-2) Course introduction A brief introduction to molecular biology A brief introduction to sequence comparison Part I: Algorithms for Sequence Analysis (Week 3-11)

More information

15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs

15-780: Graduate Artificial Intelligence. Computational biology: Sequence alignment and profile HMMs 5-78: Graduate rtificial Intelligence omputational biology: Sequence alignment and profile HMMs entral dogma DN GGGG transcription mrn UGGUUUGUG translation Protein PEPIDE 2 omparison of Different Organisms

More information

Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014

Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic Programming User Manual v1.0 Anton E. Weisstein, Truman State University Aug. 19, 2014 Dynamic programming is a group of mathematical methods used to sequentially split a complicated problem into

More information

Sequence analysis Pairwise sequence alignment

Sequence analysis Pairwise sequence alignment UMF11 Introduction to bioinformatics, 25 Sequence analysis Pairwise sequence alignment 1. Sequence alignment Lecturer: Marina lexandersson 12 September, 25 here are two types of sequence alignments, global

More information

BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J.

BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. BLAST Exercise 2: Using mrna and EST Evidence in Annotation Adapted by W. Leung and SCR Elgin from Annotation Using mrna and ESTs by Dr. J. Buhler Prerequisites: BLAST Exercise: Detecting and Interpreting

More information

Exercise 2: Browser-Based Annotation and RNA-Seq Data

Exercise 2: Browser-Based Annotation and RNA-Seq Data Exercise 2: Browser-Based Annotation and RNA-Seq Data Jeremy Buhler July 24, 2018 This exercise continues your introduction to practical issues in comparative annotation. You ll be annotating genomic sequence

More information

Dynamic Programming Course: A structure based flexible search method for motifs in RNA. By: Veksler, I., Ziv-Ukelson, M., Barash, D.

Dynamic Programming Course: A structure based flexible search method for motifs in RNA. By: Veksler, I., Ziv-Ukelson, M., Barash, D. Dynamic Programming Course: A structure based flexible search method for motifs in RNA By: Veksler, I., Ziv-Ukelson, M., Barash, D., Kedem, K Outline Background Motivation RNA s structure representations

More information

Alignment of Pairs of Sequences

Alignment of Pairs of Sequences Bi03a_1 Unit 03a: Alignment of Pairs of Sequences Partners for alignment Bi03a_2 Protein 1 Protein 2 =amino-acid sequences (20 letter alphabeth + gap) LGPSSKQTGKGS-SRIWDN LN-ITKSAGKGAIMRLGDA -------TGKG--------

More information

How to use KAIKObase Version 3.1.0

How to use KAIKObase Version 3.1.0 How to use KAIKObase Version 3.1.0 Version3.1.0 29/Nov/2010 http://sgp2010.dna.affrc.go.jp/kaikobase/ Copyright National Institute of Agrobiological Sciences. All rights reserved. Outline 1. System overview

More information

PPI Network Alignment Advanced Topics in Computa8onal Genomics

PPI Network Alignment Advanced Topics in Computa8onal Genomics PPI Network Alignment 02-715 Advanced Topics in Computa8onal Genomics PPI Network Alignment Compara8ve analysis of PPI networks across different species by aligning the PPI networks Find func8onal orthologs

More information

Reconstructing long sequences from overlapping sequence fragment. Searching databases for related sequences and subsequences

Reconstructing long sequences from overlapping sequence fragment. Searching databases for related sequences and subsequences SEQUENCE ALIGNMENT ALGORITHMS 1 Why compare sequences? Reconstructing long sequences from overlapping sequence fragment Searching databases for related sequences and subsequences Storing, retrieving and

More information

Indexing and Searching

Indexing and Searching Indexing and Searching Introduction How to retrieval information? A simple alternative is to search the whole text sequentially Another option is to build data structures over the text (called indices)

More information

.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar..

.. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. .. Fall 2011 CSC 570: Bioinformatics Alexander Dekhtyar.. PAM and BLOSUM Matrices Prepared by: Jason Banich and Chris Hoover Background As DNA sequences change and evolve, certain amino acids are more

More information

BIR pipeline steps and subsequent output files description STEP 1: BLAST search

BIR pipeline steps and subsequent output files description STEP 1: BLAST search Lifeportal (Brief description) The Lifeportal at University of Oslo (https://lifeportal.uio.no) is a Galaxy based life sciences portal lifeportal.uio.no under the UiO tools section for phylogenomic analysis,

More information

FINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS

FINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS FINDING APPROXIMATE REPEATS WITH MULTIPLE SPACED SEEDS FINDING APPROXIMATE REPEATS IN DNA SEQUENCES USING MULTIPLE SPACED SEEDS By SARAH BANYASSADY, B.S. A Thesis Submitted to the School of Graduate Studies

More information

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010

Principles of Bioinformatics. BIO540/STA569/CSI660 Fall 2010 Principles of Bioinformatics BIO540/STA569/CSI660 Fall 2010 Lecture 11 Multiple Sequence Alignment I Administrivia Administrivia The midterm examination will be Monday, October 18 th, in class. Closed

More information

Sequence Alignment Heuristics

Sequence Alignment Heuristics Sequence Alignment Heuristics Some slides from: Iosif Vaisman, GMU mason.gmu.edu/~mmasso/binf630alignment.ppt Serafim Batzoglu, Stanford http://ai.stanford.edu/~serafim/ Geoffrey J. Barton, Oxford Protein

More information

Short Read Alignment. Mapping Reads to a Reference

Short Read Alignment. Mapping Reads to a Reference Short Read Alignment Mapping Reads to a Reference Brandi Cantarel, Ph.D. & Daehwan Kim, Ph.D. BICF 05/2018 Introduction to Mapping Short Read Aligners DNA vs RNA Alignment Quality Pitfalls and Improvements

More information

Sequence Alignment: Mo1va1on and Algorithms. Lecture 2: August 23, 2012

Sequence Alignment: Mo1va1on and Algorithms. Lecture 2: August 23, 2012 Sequence Alignment: Mo1va1on and Algorithms Lecture 2: August 23, 2012 Mo1va1on and Introduc1on Importance of Sequence Alignment For DNA, RNA and amino acid sequences, high sequence similarity usually

More information

Dynamic Programming & Smith-Waterman algorithm

Dynamic Programming & Smith-Waterman algorithm m m Seminar: Classical Papers in Bioinformatics May 3rd, 2010 m m 1 2 3 m m Introduction m Definition is a method of solving problems by breaking them down into simpler steps problem need to contain overlapping

More information

The BLASTER suite Documentation

The BLASTER suite Documentation The BLASTER suite Documentation Hadi Quesneville Bioinformatics and genomics Institut Jacques Monod, Paris, France http://www.ijm.fr/ijm/recherche/equipes/bioinformatique-genomique Last modification: 05/09/06

More information

NGS Data and Sequence Alignment

NGS Data and Sequence Alignment Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local

More information

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome.

Supplementary Figure 1. Fast read-mapping algorithm of BrowserGenome. Supplementary Figure 1 Fast read-mapping algorithm of BrowserGenome. (a) Indexing strategy: The genome sequence of interest is divided into non-overlapping 12-mers. A Hook table is generated that contains

More information

Design and Evaluation of a BLAST Ungapped Extension Accelerator, Master's Thesis

Design and Evaluation of a BLAST Ungapped Extension Accelerator, Master's Thesis Washington University in St. Louis Washington University Open Scholarship All Computer Science and Engineering Research Computer Science and Engineering Report Number: WUCSE-2006-21 2006-01-01 Design and

More information

CISC 889 Bioinformatics (Spring 2003) Multiple Sequence Alignment

CISC 889 Bioinformatics (Spring 2003) Multiple Sequence Alignment CISC 889 Bioinformatics (Spring 2003) Multiple Sequence Alignment Courtesy of jalview 1 Motivations Collective statistic Protein families Identification and representation of conserved sequence features

More information

Machine Learning. Computational biology: Sequence alignment and profile HMMs

Machine Learning. Computational biology: Sequence alignment and profile HMMs 10-601 Machine Learning Computational biology: Sequence alignment and profile HMMs Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Growth

More information

OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT

OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT Asif Ali Khan*, Laiq Hassan*, Salim Ullah* ABSTRACT: In bioinformatics, sequence alignment is a common and insistent task. Biologists align

More information

Preliminary Syllabus. Genomics. Introduction & Genome Assembly Sequence Comparison Gene Modeling Gene Function Identification

Preliminary Syllabus. Genomics. Introduction & Genome Assembly Sequence Comparison Gene Modeling Gene Function Identification Preliminary Syllabus Sep 30 Oct 2 Oct 7 Oct 9 Oct 14 Oct 16 Oct 21 Oct 25 Oct 28 Nov 4 Nov 8 Introduction & Genome Assembly Sequence Comparison Gene Modeling Gene Function Identification OCTOBER BREAK

More information

Brief review from last class

Brief review from last class Sequence Alignment Brief review from last class DNA is has direction, we will use only one (5 -> 3 ) and generate the opposite strand as needed. DNA is a 3D object (see lecture 1) but we will model it

More information

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008

6.047 / Computational Biology: Genomes, Networks, Evolution Fall 2008 MIT OpenCourseWare http://ocw.mit.edu 6.047 / 6.878 Computational Biology: Genomes, Networks, Evolution Fall 2008 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Sequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it.

Sequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it. Sequence Alignments Overview Sequence alignment is an essential concept for bioinformatics, as most of our data analysis and interpretation techniques make use of it. Sequence alignment means arranging

More information

USING AN EXTENDED SUFFIX TREE TO SPEED-UP SEQUENCE ALIGNMENT

USING AN EXTENDED SUFFIX TREE TO SPEED-UP SEQUENCE ALIGNMENT IADIS International Conference Applied Computing 2006 USING AN EXTENDED SUFFIX TREE TO SPEED-UP SEQUENCE ALIGNMENT Divya R. Singh Software Engineer Microsoft Corporation, Redmond, WA 98052, USA Abdullah

More information

Searching Sequence Databases

Searching Sequence Databases Wright State University CORE Scholar Computer Science and Engineering Faculty Publications Computer Science & Engineering 2003 Searching Sequence Databases Dan E. Krane Wright State University - Main Campus,

More information

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas

COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP. Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas COMPARATIVE MICROBIAL GENOMICS ANALYSIS WORKSHOP Exercise 2: Predicting Protein-encoding Genes, BlastMatrix, BlastAtlas First of all connect once again to the CBS system: Open ssh shell client. Press Quick

More information

Optimizing multiple spaced seeds for homology search

Optimizing multiple spaced seeds for homology search Optimizing multiple spaced seeds for homology search Jinbo Xu Daniel Brown Ming Li Bin Ma Abstract Optimized spaced seeds improve sensitivity and specificity in local homology search. Several authors have

More information

Alignment of Long Sequences

Alignment of Long Sequences Alignment of Long Sequences BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2009 Mark Craven craven@biostat.wisc.edu Pairwise Whole Genome Alignment: Task Definition Given a pair of genomes (or other large-scale

More information

Introduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2

Introduction to BLAST with Protein Sequences. Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 Introduction to BLAST with Protein Sequences Utah State University Spring 2014 STAT 5570: Statistical Bioinformatics Notes 6.2 1 References Chapter 2 of Biological Sequence Analysis (Durbin et al., 2001)

More information

Module: Sequence Alignment Theory and Applica8ons Session: BLAST

Module: Sequence Alignment Theory and Applica8ons Session: BLAST Module: Sequence Alignment Theory and Applica8ons Session: BLAST Learning Objec8ves and Outcomes v Understand the principles of the BLAST algorithm v Understand the different BLAST algorithms, parameters

More information

VL Algorithmen und Datenstrukturen für Bioinformatik ( ) WS15/2016 Woche 9

VL Algorithmen und Datenstrukturen für Bioinformatik ( ) WS15/2016 Woche 9 VL Algorithmen und Datenstrukturen für Bioinformatik (19400001) WS15/2016 Woche 9 Tim Conrad AG Medical Bioinformatics Institut für Mathematik & Informatik, Freie Universität Berlin Contains material from

More information

Parsimony-Based Approaches to Inferring Phylogenetic Trees

Parsimony-Based Approaches to Inferring Phylogenetic Trees Parsimony-Based Approaches to Inferring Phylogenetic Trees BMI/CS 576 www.biostat.wisc.edu/bmi576.html Mark Craven craven@biostat.wisc.edu Fall 0 Phylogenetic tree approaches! three general types! distance:

More information

This tutorial will show you how to conduct a BLAST search. With BLAST you may:

This tutorial will show you how to conduct a BLAST search. With BLAST you may: Gramene v. 25 Welcome to the Gramene BLAST Tutorial This tutorial will show you how to conduct a BLAST search. With BLAST you may: Search for sequence similarity matches in the Gramene database - ideal

More information

Sequence Alignment. part 2

Sequence Alignment. part 2 Sequence Alignment part 2 Dynamic programming with more realistic scoring scheme Using the same initial sequences, we ll look at a dynamic programming example with a scoring scheme that selects for matches

More information

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment Sequence lignment (chapter 6) p The biological problem p lobal alignment p Local alignment p Multiple alignment Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity

More information

Tutorial 1: Exploring the UCSC Genome Browser

Tutorial 1: Exploring the UCSC Genome Browser Last updated: May 12, 2011 Tutorial 1: Exploring the UCSC Genome Browser Open the homepage of the UCSC Genome Browser at: http://genome.ucsc.edu/ In the blue bar at the top, click on the Genomes link.

More information