Contact: Raymond Hovey Genomics Center - SFS
|
|
- Charlotte Washington
- 6 years ago
- Views:
Transcription
1 Bioinformatics Lunch Seminar (Summer 2014) Every other Friday at noon minutes plus discussion Informal, ask questions anytime, start discussions Content will be based on feedback Targeted at broad audience of various levels of backgrounds and education Emphasis on Genomics Center Contact: Raymond Hovey Genomics Center - SFS rhovey@uwm.edu
2 Filetypes generated by the Genomics Center Sequencers Sanger Sequencer (ABI 3730), <750bp length, Gold standard Fasta file for each sequence (.fasta.fas.fa.fna.txt.seq ) Tracefile for each Sequence (.ab1 ) Multifasta file containing all sequences of a plate in one file
3 simple text format used by almost all programs (standard) [>] header line with a [hard return] at end Sequence (no specific requirements for line length, characters, etc. Though linebreaks inside the sequence can be problematic with some softwares, better to remove them) No standard file extension FASTA Format >URO1 uro1.seq Length: 2018 November 9, :50 Type: N Check: CGCAGAAAGAGGAGGCGCTTGCCTTCAGCTTGTGGGAAATCCCGAAGATGGCCAAAGACA ACTCAACTGTTCGTTGCTTCCAGGGCCTGCTGATTTTTGGAAATGTGATTATTGGTTGTT GCGGCATTGCCCTGACTGCGGAGTGCATCTTCTTTGTATCTGACCAACACAGCCTCTACC CACTGCTTGAAGCCACCGACAACGATGACATCTATGGGGCTGCCTGGATCGGCATATTTG TGGGCATCTGCCTCTTCTGCCTGTCTGTTCTAGGCATTGTAGGCATCATGAAGTCCAGCA GGAAAATTCTTCTGGCGTATTTCATTCTGATGTTTATAGTATATGCCTTTGAAGTGGCAT CTTGTATCACAGCAGCAACACAACAAGACTTTTTCACACCCAACCTCTTCCTGAAGCAGA TGCTAGAGAGGTACCAAAACAACAGCCCTCCAAACAATGATGACCAGTGGAAAAACAATG GAGTCACCAAAACCTGGGACAGGCTCATGCTCCAGGACAATTGCTGTGGCGTAAATGGTC CATCAGACTGGCAAAAATACACATCTGCCTTCCGGACTGAGAATAATGATGCTGACTATC CCTGGCCTCGTCAATGCTGTGTTATGAACAATCTTAAAGAACCTCTCAACCTGGAGGCTT
4 FinchTV ( Free)
5 Filetypes generated by the Genomics Center Sequencers Next Generation Sequencer (Illumina MiSeq), <250bp length Fastq files for each sample (.fastq.fq.fastq.tar.gz). Depending on the sequencer configuration there can be multiple files for a sample. Paired end reads or unpaired Read pairs in same files or separate files Soon: Pacific Biosciences Sequencer Longer reads (up to 50k bps) Can detect Modifications like Methylation High throughput for whole genome projects
6 FASTQ Format Four lines per Sequence. No file extension standard,.fastq and.fq most common Line 1 starts with followed by sequence ID and optional descriptions Line 2 is the raw sequence Line 3 begins with a + and optional repeat of the identical sequence ID from Line 1. Line 4 contains the quality scores for each base in Line 2 No single standard for lines 2 and 4 (Most files are now Sanger standard. Illumina standard is still around) Sanger Standard example 1:Y:18:ATCACG GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Illumina Standard example TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTG TGATTGCCTTGAT +HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1 efcfffffcfeefffcffffffddf`feed]`]_ba_^ [YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBB BBBBBBBBBBBBB
7 ID information for FASTQ Format (Sanger) Sanger Standard example 1:Y:18:ATCACG GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 EAS139 the unique instrument name 136 the run id FC706VJ the flowcell id 2 flowcell lane 2104 tile number within the flowcell lane 'x'-coordinate of the cluster within the tile 'y'-coordinate of the cluster within the tile 1 the member of a pair, 1 or 2 (paired end reads) Y Y if the read is filtered, N otherwise 18 Checksum ATCACG index sequence
8 Quality Scores for FASTQ Format (Sanger, PHRED+33) Sanger Standard example 1:Y:18:ATCACG GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 PHRED quality scores Q are logarithmically related to the base-calling error probabilities P. The quality symbol is the ASCII number of the score plus 33 (for PHRED+33) scores. PHRED Quality Score Probability of incorrect base call 10 1 in 10 90% 20 1 in % 30 1 in % 40 1 in 10, % Base call accuracy 50 1 in 100, % Range of PHRED+33 quality scores in increasing order:!"#$%&'()*+,-./ :;<=>?@abcdefghijklmnopqrstuvwxyz[\]^_`abcdefghijklmnopqrstuvwxyz{ }~ Pitfall: Older Illumina reads generated prior to Casava 1.8 used PHRED+64, meaning the score values are 31 higher.
9 Basic Alignment files generated from NGS. BAM files simple format used by almost all programs (standard) binary compressed file format (not human readable).bam file extension (plus optional.bai index file) Commonly used to transfer data as it is compressed and standardized Standard output from many alignment softwares like DNAStar, Illumina/Casava, Bowtie, etc.
10 Basic Alignment files generated from NGS. SAM files Human readable version of a BAM file Not compressed (~2x size of.bam, genome alignment files can be huge).sam file extension Easier to process than.bam files by text based approaches like awk, sed, python, perl, R, etc. Easily generated from.bam files with Samtools (samtools.sourceforge.net) A standard output of only a few alignment softwares (for example BWA) Consists of a header portion containing general information (aligner software, data size, ) and a sequence alignment portion with one line per aligned read (sequence, phred-scores, start and stop nucleotides of alignment, template ID, variants, ). Both header and sequence data formats are standardized but the actual inclusion of data is optional (!).
11 QC report for NGS data generated by Genomics Center Generated by FastQC software package ( Compressed html file (can be open with most standard browsers) Contains basics statistics and Quality data for fastq files
12 QUESTIONS? COMMENTS? AND DON T FORGET TO CHECK OUT OUR NEW HOMEPAGE AT GREATLAKESGENOMICS.UWM.EDU
Sequence Data Quality Assessment Exercises and Solutions.
Sequence Data Quality Assessment Exercises and Solutions. Starting Note: Please do not copy and paste the commands. Characters in this document may not be copied correctly. Please type the commands and
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines: Illumina MiSeq,
More informationWelcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page.
Welcome to MAPHiTS (Mapping Analysis Pipeline for High-Throughput Sequences) tutorial page. In this page you will learn to use the tools of the MAPHiTS suite. A little advice before starting : rename your
More informationGenomic Files. University of Massachusetts Medical School. October, 2014
.. Genomic Files University of Massachusetts Medical School October, 2014 2 / 39. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationBioinformatics in next generation sequencing projects
Bioinformatics in next generation sequencing projects Rickard Sandberg Assistant Professor Department of Cell and Molecular Biology Karolinska Institutet March 2011 Once sequenced the problem becomes computational
More informationNext Generation Sequence Alignment on the BRC Cluster. Steve Newhouse 22 July 2010
Next Generation Sequence Alignment on the BRC Cluster Steve Newhouse 22 July 2010 Overview Practical guide to processing next generation sequencing data on the cluster No details on the inner workings
More informationNGS Data Analysis. Roberto Preste
NGS Data Analysis Roberto Preste 1 Useful info http://bit.ly/2r1y2dr Contacts: roberto.preste@gmail.com Slides: http://bit.ly/ngs-data 2 NGS data analysis Overview 3 NGS Data Analysis: the basic idea http://bit.ly/2r1y2dr
More informationHigh-throughput sequencing: Alignment and related topic. Simon Anders EMBL Heidelberg
High-throughput sequencing: Alignment and related topic Simon Anders EMBL Heidelberg Established platforms HTS Platforms Illumina HiSeq, ABI SOLiD, Roche 454 Newcomers: Benchtop machines 454 GS Junior,
More informationGenomic Files. University of Massachusetts Medical School. October, 2015
.. Genomic Files University of Massachusetts Medical School October, 2015 2 / 55. A Typical Deep-Sequencing Workflow Samples Fastq Files Fastq Files Sam / Bam Files Various files Deep Sequencing Further
More informationGalaxy Platform For NGS Data Analyses
Galaxy Platform For NGS Data Analyses Weihong Yan wyan@chem.ucla.edu Collaboratory Web Site http://qcb.ucla.edu/collaboratory Collaboratory Workshops Workshop Outline ü Day 1 UCLA galaxy and user account
More informationPre-processing and quality control of sequence data. Barbera van Schaik KEBB - Bioinformatics Laboratory
Pre-processing and quality control of sequence data Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl Topic: quality control and prepare data for the interesting stuf Keep Throw
More informationUnderstanding and Pre-processing Raw Illumina Data
Understanding and Pre-processing Raw Illumina Data Matt Johnson October 4, 2013 1 Understanding FASTQ files After an Illumina sequencing run, the data is stored in very large text files in a standard format
More informationRun Setup and Bioinformatic Analysis. Accel-NGS 2S MID Indexing Kits
Run Setup and Bioinformatic Analysis Accel-NGS 2S MID Indexing Kits Sequencing MID Libraries For MiSeq, HiSeq, and NextSeq instruments: Modify the config file to create a fastq for index reads Using the
More informationRNA-Seq in Galaxy: Tuxedo protocol. Igor Makunin, UQ RCC, QCIF
RNA-Seq in Galaxy: Tuxedo protocol Igor Makunin, UQ RCC, QCIF Acknowledgments Genomics Virtual Lab: gvl.org.au Galaxy for tutorials: galaxy-tut.genome.edu.au Galaxy Australia: galaxy-aust.genome.edu.au
More informationHigh-throughout sequencing and using short-read aligners. Simon Anders
High-throughout sequencing and using short-read aligners Simon Anders High-throughput sequencing (HTS) Sequencing millions of short DNA fragments in parallel. a.k.a.: next-generation sequencing (NGS) massively-parallel
More informationLecture 8. Sequence alignments
Lecture 8 Sequence alignments DATA FORMATS bioawk bioawk is a program that extends awk s powerful processing of tabular data to processing tasks involving common bioinformatics formats like FASTA/FASTQ,
More informationGenome 373: Mapping Short Sequence Reads III. Doug Fowler
Genome 373: Mapping Short Sequence Reads III Doug Fowler What is Galaxy? Galaxy is a free, open source web platform for running all sorts of computational analyses including pretty much all of the sequencing-related
More informationINTRODUCTION AUX FORMATS DE FICHIERS
INTRODUCTION AUX FORMATS DE FICHIERS Plan. Formats de séquences brutes.. Format fasta.2. Format fastq 2. Formats d alignements 2.. Format SAM 2.2. Format BAM 4. Format «Variant Calling» 4.. Format Varscan
More informationNGS Data and Sequence Alignment
Applications and Servers SERVER/REMOTE Compute DB WEB Data files NGS Data and Sequence Alignment SSH WEB SCP Manpreet S. Katari App Aug 11, 2016 Service Terminal IGV Data files Window Personal Computer/Local
More informationNGS : reads quality control
NGS : reads quality control Data used in this tutorials are available on https:/urgi.versailles.inra.fr/download/tuto/ngs-readsquality-control. Select genome solexa.fasta, illumina.fastq, solexa.fastq
More informationResequencing Analysis. (Pseudomonas aeruginosa MAPO1 ) Sample to Insight
Resequencing Analysis (Pseudomonas aeruginosa MAPO1 ) 1 Workflow Import NGS raw data Trim reads Import Reference Sequence Reference Mapping QC on reads Variant detection Case Study Pseudomonas aeruginosa
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy Contents September 16, 2014 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationDNA / RNA sequencing
Outline Ways to generate large amounts of sequence Understanding the contents of large sequence files Fasta format Fastq format Sequence quality metrics Summarizing sequence data quality/quantity Using
More informationAn Introduction to Linux and Bowtie
An Introduction to Linux and Bowtie Cavan Reilly November 10, 2017 Table of contents Introduction to UNIX-like operating systems Installing programs Bowtie SAMtools Introduction to Linux In order to use
More informationAccessible, Transparent and Reproducible Analysis with Galaxy
Accessible, Transparent and Reproducible Analysis with Galaxy Application of Next Generation Sequencing Technologies for Whole Transcriptome and Genome Analysis ABRF 2013 Saturday, March 2, 2013 Palm Springs,
More informationdbcamplicons pipeline Bioinformatics
dbcamplicons pipeline Bioinformatics Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Workshop dataset: Slashpile
More informationGalaxy workshop at the Winter School Igor Makunin
Galaxy workshop at the Winter School 2016 Igor Makunin i.makunin@uq.edu.au Winter school, UQ, July 6, 2016 Plan Overview of the Genomics Virtual Lab Introduce Galaxy, a web based platform for analysis
More informationSequence Mapping and Assembly
Practical Introduction Sequence Mapping and Assembly December 8, 2014 Mary Kate Wing University of Michigan Center for Statistical Genetics Goals of This Session Learn basics of sequence data file formats
More informationNGS Data Visualization and Exploration Using IGV
1 What is Galaxy Galaxy for Bioinformaticians Galaxy for Experimental Biologists Using Galaxy for NGS Analysis NGS Data Visualization and Exploration Using IGV 2 What is Galaxy Galaxy for Bioinformaticians
More informationDr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata
Analysis of RNA sequencing data sets using the Galaxy environment Dr. Gabriela Salinas Dr. Orr Shomroni Kaamini Rhaithata Microarray and Deep-sequencing core facility 30.10.2017 RNA-seq workflow I Hypothesis
More informationEnsembl RNASeq Practical. Overview
Ensembl RNASeq Practical The aim of this practical session is to use BWA to align 2 lanes of Zebrafish paired end Illumina RNASeq reads to chromosome 12 of the zebrafish ZV9 assembly. We have restricted
More informationNGS Analysis Using Galaxy
NGS Analysis Using Galaxy Sequences and Alignment Format Galaxy overview and Interface Get;ng Data in Galaxy Analyzing Data in Galaxy Quality Control Mapping Data History and workflow Galaxy Exercises
More informationEpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1
EpiGnome Methyl Seq Bioinformatics User Guide Rev. 0.1 Introduction This guide contains data analysis recommendations for libraries prepared using Epicentre s EpiGnome Methyl Seq Kit, and sequenced on
More informationMapping NGS reads for genomics studies
Mapping NGS reads for genomics studies Valencia, 28-30 Sep 2015 BIER Alejandro Alemán aaleman@cipf.es Genomics Data Analysis CIBERER Where are we? Fastq Sequence preprocessing Fastq Alignment BAM Visualization
More information!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468,
!"#$%&$'()#$*)+,-./).01"0#,23+3,303456"6,&((46,7$+-./&((468, 9"(1(02)1+(',:.;.4(*.',?9@A,!."2.4B.'#A,C(;.
More informationCopyright 2014 Regents of the University of Minnesota
Quality Control of Illumina Data using Galaxy August 18, 2014 Contents 1 Introduction 2 1.1 What is Galaxy?..................................... 2 1.2 Galaxy at MSI......................................
More informationNGS Sequence data. Jason Stajich. UC Riverside. jason.stajich[at]ucr.edu. twitter:hyphaltip stajichlab
NGS Sequence data Jason Stajich UC Riverside jason.stajich[at]ucr.edu twitter:hyphaltip stajichlab Lecture available at http://github.com/hyphaltip/cshl_2012_ngs 1/58 NGS sequence data Quality control
More informationOverview of Generated Files Courtesy of Dr. Jon Keebler
Overview of Generated Files Courtesy of Dr. Jon Keebler Fastq Files What s inside of them How they are built Phred Quality Score Strings Quality Analysis of Fastq libraries Fastq File What s Inside Read
More informationSentieon Documentation
Sentieon Documentation Release 201808.03 Sentieon, Inc Dec 21, 2018 Sentieon Manual 1 Introduction 1 1.1 Description.............................................. 1 1.2 Benefits and Value..........................................
More informationSAM : Sequence Alignment/Map format. A TAB-delimited text format storing the alignment information. A header section is optional.
Alignment of NGS reads, samtools and visualization Hands-on Software used in this practical BWA MEM : Burrows-Wheeler Aligner. A software package for mapping low-divergent sequences against a large reference
More informationImporting your Exeter NGS data into Galaxy:
Importing your Exeter NGS data into Galaxy: The aim of this tutorial is to show you how to import your raw Illumina FASTQ files and/or assemblies and remapping files into Galaxy. As of 1 st July 2011 Illumina
More informationUsing Galaxy: RNA-seq
Using Galaxy: RNA-seq Stanford University September 23, 2014 Jennifer Hillman-Jackson Galaxy Team Penn State University http://galaxyproject.org/ The Agenda Introduction RNA-seq Example - Data Prep: QC
More informationITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013
ITMO Ecole de Bioinformatique Hands-on session: smallrna-seq N. Servant 21 rd November 2013 1. Data and objectives We will use the data from GEO (GSE35368, Toedling, Servant et al. 2011). Two samples were
More informationDecrypting your genome data privately in the cloud
Decrypting your genome data privately in the cloud Marc Sitges Data Manager@Made of Genes @madeofgenes The Human Genome 3.200 M (x2) Base pairs (bp) ~20.000 genes (~30%) (Exons ~1%) The Human Genome Project
More informationQuality Control of Sequencing Data
Quality Control of Sequencing Data Surya Saha Sol Genomics Network (SGN) Boyce Thompson Institute, Ithaca, NY ss2489@cornell.edu // Twitter:@SahaSurya BTI Plant Bioinformatics Course 2017 3/27/2017 BTI
More informationLecture 12. Short read aligners
Lecture 12 Short read aligners Ebola reference genome We will align ebola sequencing data against the 1976 Mayinga reference genome. We will hold the reference gnome and all indices: mkdir -p ~/reference/ebola
More informationPreparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers
Preparation of alignments for variant calling with GATK: exercise instructions for BioHPC Lab computers Data used in the exercise We will use D. melanogaster WGS paired-end Illumina data with NCBI accessions
More informationChIP-seq Analysis. BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - March 21 st 2017 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationChIP-seq (NGS) Data Formats
ChIP-seq (NGS) Data Formats Biological samples Sequence reads SRA/SRF, FASTQ Quality control SAM/BAM/Pileup?? Mapping Assembly... DE Analysis Variant Detection Peak Calling...? Counts, RPKM VCF BED/narrowPeak/
More informationVariation among genomes
Variation among genomes Comparing genomes The reference genome http://www.ncbi.nlm.nih.gov/nuccore/26556996 Arabidopsis thaliana, a model plant Col-0 variety is from Landsberg, Germany Ler is a mutant
More informationMolecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
More informationIntroduction to Galaxy
Introduction to Galaxy Saint Louis University St. Louis, Missouri April 30, 2013 Dave Clements, Emory University http://galaxyproject.org/ Agenda 9:00 Welcome 9:20 Basic Analysis with Galaxy 10:30 Basic
More informationRNA-seq Data Analysis
Seyed Abolfazl Motahari RNA-seq Data Analysis Basics Next Generation Sequencing Biological Samples Data Cost Data Volume Big Data Analysis in Biology تحلیل داده ها کنترل سیستمهای بیولوژیکی تشخیص بیماریها
More informationASAP - Allele-specific alignment pipeline
ASAP - Allele-specific alignment pipeline Jan 09, 2012 (1) ASAP - Quick Reference ASAP needs a working version of Perl and is run from the command line. Furthermore, Bowtie needs to be installed on your
More informationColorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi
Colorado State University Bioinformatics Algorithms Assignment 6: Analysis of High- Throughput Biological Data Hamidreza Chitsaz, Ali Sharifi- Zarchi Although a little- bit long, this is an easy exercise
More informationMolecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing
Molecular Identifier (MID) Analysis for TAM-ChIP Paired-End Sequencing Catalog Nos.: 53126 & 53127 Name: TAM-ChIP antibody conjugate Description Active Motif s TAM-ChIP technology combines antibody directed
More informationPRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR
PRACTICAL SESSION 5 GOTCLOUD ALIGNMENT WITH BWA JAN 7 TH, 2014 STOM 2014 WORKSHOP HYUN MIN KANG UNIVERSITY OF MICHIGAN, ANN ARBOR GOAL OF THIS SESSION Assuming that The audiences know how to perform GWAS
More information1. Download the data from ENA and QC it:
GenePool-External : Genome Assembly tutorial for NGS workshop 20121016 This page last changed on Oct 11, 2012 by tcezard. This is a whole genome sequencing of a E. coli from the 2011 German outbreak You
More informationRNA-seq. Manpreet S. Katari
RNA-seq Manpreet S. Katari Evolution of Sequence Technology Normalizing the Data RPKM (Reads per Kilobase of exons per million reads) Score = R NT R = # of unique reads for the gene N = Size of the gene
More informationMaize genome sequence in FASTA format. Gene annotation file in gff format
Exercise 1. Using Tophat/Cufflinks to analyze RNAseq data. Step 1. One of CBSU BioHPC Lab workstations has been allocated for your workshop exercise. The allocations are listed on the workshop exercise
More informationAnalyzing ChIP- Seq Data in Galaxy
Analyzing ChIP- Seq Data in Galaxy Lauren Mills RISS ABSTRACT Step- by- step guide to basic ChIP- Seq analysis using the Galaxy platform. Table of Contents Introduction... 3 Links to helpful information...
More informationREADME _EPGV_DataTransfer_Illumina Sequencing
README _EPGV_DataTransfer_Illumina Sequencing I. Delivered files / Paired-ends (PE) sequences... 2 II. Flowcell (FC) Nomenclature... 2 III. Quality Control Process and EPGV Cleaning Version 1.7... 4 A.
More informationIllumina Next Generation Sequencing Data analysis
Illumina Next Generation Sequencing Data analysis Chiara Dal Fiume Sr Field Application Scientist Italy 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More information2015 Workshop on Genomics. Genomics Laboratory
2015 Workshop on Genomics Genomics Laboratory Instructors: Konrad Paszkiewicz k.h.paszkiewicz@exeter.ac.uk Objectives: By the end of the lab you will be expected to: Understand how short reads are generated.
More informationVariant calling using SAMtools
Variant calling using SAMtools Calling variants - a trivial use of an Interactive Session We are going to conduct the variant calling exercises in an interactive idev session just so you can get a feel
More informationFile Formats: SAM, BAM, and CRAM. UCD Genome Center Bioinformatics Core Tuesday 15 September 2015
File Formats: SAM, BAM, and CRAM UCD Genome Center Bioinformatics Core Tuesday 15 September 2015 / BAM / CRAM NEW! http://samtools.sourceforge.net/ - deprecated! http://www.htslib.org/ - SAMtools 1.0 and
More informationMapping reads to a reference genome
Introduction Mapping reads to a reference genome Dr. Robert Kofler October 17, 2014 Dr. Robert Kofler Mapping reads to a reference genome October 17, 2014 1 / 52 Introduction RESOURCES the lecture: http://drrobertkofler.wikispaces.com/ngsandeelecture
More informationFrom the Schnable Lab:
From the Schnable Lab: Yang Zhang and Daniel Ngu s Pipeline for Processing RNA-seq Data (As of November 17, 2016) yzhang91@unl.edu dngu2@huskers.unl.edu Pre-processing the reads: The alignment software
More informationAnalysis of ChIP-seq data
Before we start: 1. Log into tak (step 0 on the exercises) 2. Go to your lab space and create a folder for the class (see separate hand out) 3. Connect to your lab space through the wihtdata network and
More informationNGS Analyses with Galaxy
1 NGS Analyses with Galaxy Introduction Every living organism on our planet possesses a genome that is composed of one or several DNA (deoxyribonucleotide acid) molecules determining the way the organism
More informationUMass High Performance Computing Center
UMass High Performance Computing Center University of Massachusetts Medical School February, 2019 Challenges of Genomic Data 2 / 93 It is getting easier and cheaper to produce bigger genomic data every
More informationNext Generation Sequencing quality trimming (NGSQTRIM)
Next Generation Sequencing quality trimming (NGSQTRIM) Danamma B.J 1, Naveen kumar 2, V.G Shanmuga priya 3 1 M.Tech, Bioinformatics, KLEMSSCET, Belagavi 2 Proprietor, GenEclat Technologies, Bengaluru 3
More informationHow to map millions of short DNA reads produced by Next-Gen Sequencing instruments onto a reference genome
How to map millions of short DNA reads produced by Next-Gen Sequencing instruments onto a reference genome Stratos Efstathiadis stratos@nyu.edu Slides are from Cole Trapneli, Steven Salzberg, Ben Langmead,
More information2013 Workshop on Genomics, Cesky Krumlov
2013 Workshop on Genomics, Cesky Krumlov Instructors: Part 1: Short read genomics: Remapping Konrad Paszkiewicz k.h.paszkiewicz at exeter ac uk Objectives: By the end of the workshop you will be expected
More informationIntroduction to NGS analysis on a Raspberry Pi. Beta version 1.1 (04 June 2013)
Introduction to NGS analysis on a Raspberry Pi Beta version 1.1 (04 June 2013)!! Contents Overview Contents... 3! Overview... 4! Download some simulated reads... 5! Quality Control... 7! Map reads using
More informationReads Alignment and Variant Calling
Reads Alignment and Variant Calling CB2-201 Computational Biology and Bioinformatics February 22, 2016 Emidio Capriotti http://biofold.org/ Institute for Mathematical Modeling of Biological Systems Department
More informationImage Analysis and Base Calling Sarah Reid FAS
Image Analysis and Base Calling Sarah Reid FAS For Research Use Only. Not for use in diagnostic procedures. 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse,
More informationZFS for NGS data analysis
ZFS for NGS data analysis saving space from the galactic expansion Davide Cittaro - Cogentech (Milan, Italy) Galaxy DevCon 2010 - CHSL NY Motivation Motivation Deploy Galaxy to serve a small NGS facility
More informationBioinformatics for High-throughput Sequencing
Bioinformatics for High-throughput Sequencing An Overview Simon Anders EBI is an Outstation of the European Molecular Biology Laboratory. Overview In recent years, new sequencing schemes, also called high-throughput
More informationChIP-seq Analysis. BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute.
ChIP-seq Analysis BaRC Hot Topics - Feb 23 th 2016 Bioinformatics and Research Computing Whitehead Institute http://barc.wi.mit.edu/hot_topics/ Outline ChIP-seq overview Experimental design Quality control/preprocessing
More informationMerge Conflicts p. 92 More GitHub Workflows: Forking and Pull Requests p. 97 Using Git to Make Life Easier: Working with Past Commits p.
Preface p. xiii Ideology: Data Skills for Robust and Reproducible Bioinformatics How to Learn Bioinformatics p. 1 Why Bioinformatics? Biology's Growing Data p. 1 Learning Data Skills to Learn Bioinformatics
More informationBioinformatics Services for HT Sequencing
Bioinformatics Services for HT Sequencing Tyler Backman, Rebecca Sun, Thomas Girke December 19, 2008 Bioinformatics Services for HT Sequencing Slide 1/18 Introduction People Service Overview and Rates
More informationBIT 815: Analysis of Deep DNA Sequencing Data
BIT 815: Analysis of Deep DNA Sequencing Data Overview: This course covers methods for analysis of data from high-throughput DNA sequencing, with or without a reference genome sequence, using free and
More informationALGORITHM USER GUIDE FOR RVD
ALGORITHM USER GUIDE FOR RVD The RVD program takes BAM files of deep sequencing reads in as input. Using a Beta-Binomial model, the algorithm estimates the error rate at each base position in the reference
More informationDNA Sequencing analysis on Artemis
DNA Sequencing analysis on Artemis Mapping and Variant Calling Tracy Chew Senior Research Bioinformatics Technical Officer Rosemarie Sadsad Informatics Services Lead Hayim Dar Informatics Technical Officer
More informationThese will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data.
These will serve as a basic guideline for read prep. This assumes you have demultiplexed Illumina data. We have a few different choices for running jobs on DT2 we will explore both here. We need to alter
More informationADNI Sequencing Working Group. Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD
ADNI Sequencing Working Group Robert C. Green, MD, MPH Andrew J. Saykin, PsyD Arthur Toga, PhD Why sequencing? V V V V V V V V V V V V V A fortuitous relationship TIME s Best Invention of 2008 The initial
More informationIntroduction To NGS Data & Analytic Tools. Steve Pederson Bioinformatics Centre University Of Adelaide
Introduction To NGS Data & Analytic Tools Steve Pederson Bioinformatics Centre University Of Adelaide Adelaide, South Australa October 2014 Introduction 1 Thank you for your attendance & welcome to the
More informationreplace my_user_id in the commands with your actual user ID
Exercise 1. Alignment with TOPHAT Part 1. Prepare the working directory. 1. Find out the name of the computer that has been reserved for you (https://cbsu.tc.cornell.edu/ww/machines.aspx?i=57 ). Everyone
More informationDemultiplexing Illumina sequencing data containing unique molecular indexes (UMIs)
next generation sequencing analysis guidelines Demultiplexing Illumina sequencing data containing unique molecular indexes (UMIs) See what more we can do for you at www.idtdna.com. For Research Use Only
More informationPacBio SMRT Analysis 3.0 preview
PacBio SMRT Analysis 3.0 preview David Alexander, Ph.D. Pacific Biosciences, Inc. FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright 2015 by Pacific Biosciences
More informationUsing Galaxy for NGS Analyses Luce Skrabanek
Using Galaxy for NGS Analyses Luce Skrabanek Registering for a Galaxy account Before we begin, first create an account on the main public Galaxy portal. Go to: https://main.g2.bx.psu.edu/ Under the User
More informationUSING BRAT-BW Table 1. Feature comparison of BRAT-bw, BRAT-large, Bismark and BS Seeker (as of on March, 2012)
USING BRAT-BW-2.0.1 BRAT-bw is a tool for BS-seq reads mapping, i.e. mapping of bisulfite-treated sequenced reads. BRAT-bw is a part of BRAT s suit. Therefore, input and output formats for BRAT-bw are
More information1 Abstract. 2 Introduction. 3 Requirements
1 Abstract 2 Introduction This SOP describes the HMP Whole- Metagenome Annotation Pipeline run at CBCB. This pipeline generates a 'Pretty Good Assembly' - a reasonable attempt at reconstructing pieces
More informationSuper-Fast Genome BWA-Bam-Sort on GLAD
1 Hututa Technologies Limited Super-Fast Genome BWA-Bam-Sort on GLAD Zhiqiang Ma, Wangjun Lv and Lin Gu May 2016 1 2 Executive Summary Aligning the sequenced reads in FASTQ files and converting the resulted
More informationNGSEP plugin manual. Daniel Felipe Cruz Juan Fernando De la Hoz Claudia Samantha Perea
NGSEP plugin manual Daniel Felipe Cruz d.f.cruz@cgiar.org Juan Fernando De la Hoz j.delahoz@cgiar.org Claudia Samantha Perea c.s.perea@cgiar.org Juan Camilo Quintero j.c.quintero@cgiar.org Jorge Duitama
More informationEssential Skills for Bioinformatics: Unix/Linux
Essential Skills for Bioinformatics: Unix/Linux SHELL SCRIPTING Overview Bash, the shell we have used interactively in this course, is a full-fledged scripting language. Unlike Python, Bash is not a general-purpose
More informationBaseSpace - MiSeq Reporter Software v2.4 Release Notes
Page 1 of 5 BaseSpace - MiSeq Reporter Software v2.4 Release Notes For MiSeq Systems Connected to BaseSpace June 2, 2014 Revision Date Description of Change A May 22, 2014 Initial Version Revision History
More informationNevada Genomics Center
Nevada Genomics Center These are general instructions on how to use dnatools to submit Sanger sequencing samples to be run on the ABI Prism 3730 DNA analyzer. We here at the Nevada Genomics Center feel
More informationCBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection
CBSU/3CPG/CVG Joint Workshop Series Reference genome based sequence variation detection Computational Biology Service Unit (CBSU) Cornell Center for Comparative and Population Genomics (3CPG) Center for
More information