Local Run Manager RNA Fusion

Transcription

1 Local Rn Manager RNA Fsion Workflow Gide Overview 3 Install the RNA Fsion Analysis Modle 3 Set Parameters 4 Analysis Methods 6 View Analysis Reslts 7 Analysis Report 8 Analysis Otpt Files 9 Revision History 16 Technical Assistance 17 Docment # v01 March 2018 For Research Use Only. Not for se in diagnostic procedres. ILLUMINA PROPRIETARY

2 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide This docment and its contents are proprietary to Illmina, Inc. and its affiliates ("Illmina"), and are intended solely for the contractal se of its cstomer in connection with the se of the prodct(s) described herein and for no other prpose. This docment and its contents shall not be sed or distribted for any other prpose and/or otherwise commnicated, disclosed, or reprodced in any way whatsoever withot the prior written consent of Illmina. Illmina does not convey any license nder its patent, trademark, copyright, or common-law rights nor similar rights of any third parties by this docment. The instrctions in this docment mst be strictly and explicitly followed by qalified and properly trained personnel in order to ensre the proper and safe se of the prodct(s) described herein. All of the contents of this docment mst be flly read and nderstood prior to sing sch prodct(s). FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT(S), INJURY TO PERSONS, INCLUDING TO USERS OR OTHERS, AND DAMAGE TO OTHER PROPERTY, AND WILL VOID ANY WARRANTY APPLICABLE TO THE PRODUCT(S). ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT(S) DESCRIBED HEREIN (INCLUDING PARTS THEREOF OR SOFTWARE) Illmina, Inc. All rights reserved. All trademarks are the property of Illmina, Inc. or their respective owners. For specific trademark information, see Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 2

3 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Overview The Local Rn Manager RNA Fsion analysis modle aligns reads against the RNA Fsion reference genome sing the STAR aligner, and then detects gene fsions sing Manta. This workflow is designed specifically for RNA libraries prepared with the TrSight RNA Fsion Panel kit. The alignment and fsion calling algorithms that this modle ses were developed specifically to enable discovery power. The algorithms inherently increase the possibility of calling nexpected fsions relative to algorithms that report only known fsions, sch as BCR-ABL1 or EML4-ALK. In addition, the RNA Fsion reference genome was created to enable alignment on a desktop compter. The RNA Fsion reference genome is a compressed version of the hman genome with intronic seqences removed. There may be slight differences in fsions reported from the RNA Fsion reference genome verss a whole genome alignment. For example, removing the intronic and intergenic seqences in the RNA Fsion reference genome removes some of the spatial context that can prevent read throgh transcripts from being reported as fsion events. Cstomers are encoraged to assess data thoroghly and establish their own acceptance criteria. A known limitation of this software is that it does not report fsions, ptative fsions, or read thogh transcripts where the two genes involved are located on the same chromosome, on the same strand, in the same orientation, in close proximity (~100 kbp). For example, this software does not report the STIL-TAL1 fsion, which is cased by a 90 kb deletion on chromosome 1. Additionally, this software may not call rearrangements that inclde intronic regions within the gene fsion prodct. Additional analysis tools are available in BaseSpace Seqence Hb. Inpt Reqirements In addition to seqencing data files generated dring the seqencing rn, sch as base call files, the RNA Fsion analysis modle reqires a specific reference genome for alignment and fsion calling. Download the RNA Fsion Reference Genome installer from the TrSight RNA Fsion Panel spport page on the Illmina website. Abot This Gide This gide provides instrctions for setting p rn parameters for seqencing, and analysis parameters for the RNA Fsion analysis modle. For information abot the Local Rn Manager dashboard and system settings for the Illmina MiniSeq and MiSeq seqencing systems, see the Local Rn Manager Software Gide (docment # ). Install the RNA Fsion Analysis Modle When installing a new version of the modle, yo do not need to ninstall the previos version. 1 Right-click RNAFsion.Modle.Installer.exe and select Rn as administrator. 2 Click Install. 3 Log in sing the ser name and password for the admin accont in Local Rn Manager. The defalt admin credentials are the following: User name: admin Password: password Only admin sers can install analysis modles. 4 Click Next. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 3

4 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide 5 When installation is complete, click Finish. The modle installs some dependencies. 6 When complete, click Close. Install the Reference Genome If yo are sing the Local Rn Manager off-instrment, the Reference Genome mst be installed. 1 Unzip the Reference Genome installer. 2 Doble-click ReferenceGenomeInstaller.msi. 3 Click Next. 4 When complete, click Close. Installation Folder Strctre By defalt, installation folders are located in C:\Illmina. Illmina Genomes Local Rn Manager Local Rn Manager Analysis Job Service Local Rn Manager Service RTA Rn Copy Service The RNA Fsion Analysis Modle files are located nder C:\Illmina\Local Rn Manager\Modles\RNAFsionWorkflow. The RNA Fsion reference genome files are located nder C:\Illmina\Genomes\HmanRNAFsion. Set Parameters 1 Select Create Rn, and select an analysis modle. 2 Enter a rn name that identifies the rn from seqencing throgh analysis. The rn name can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. 3 [Optional] Enter a rn description to frther identify the rn. The rn description can contain alphanmeric characters, spaces, and the following special characters: `~!@#$%-_{}. Specify Rn Settings 1 Enter the nmber of cycles for the rn, if other than the defalt setting of 2 76 cycles. NOTE By defalt, the read type is set to Paired End and the nmber of Index Reads is set to 1. Read lengths are set to 76 cycles for Read 1 and Read 2 and 6 cycles for Index 1 Read. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 4

5 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Specify Modle-Specific Settings The RNA Fsion analysis modle ses STAR for alignment. For more information, see STAR on page 6. To set modle-specific settings, click Show advanced modle settings. Table 1 Setting Advanced Modle Settings Minimm Breakpoint Distance Confidence Score Filter Confidence Score Threshold There are no applicable cstom settings for this modle. Specify Samples for the Rn Specify samples for the rn sing the following options: The minimm breakpoint distance between 2 genes to be considered for fsion. Any fsion with lesser breakpoint distance is filtered ot. By defalt, set to 100,000. When switched on, the modle only considers fsions as high confidence if they have the "Pass" filter and have a score greater than the threshold (set below). By defalt, switched on. If the confidence score is below this threshold, the fsions are filtered ot from high confidence fsion calls. By defalt, set to 0.6. Enter samples manally Use the blank table on the Create Rn screen. Import samples Navigate to an external file in a comma-separated vales (*.csv) format. A template is available for download on the Create Rn screen or yo can import a sample sheet created in Illmina Experiment Manager (IEM). After importing, the samples table is atomatically poplated. After yo have poplated the samples table, yo can export the sample information to an external file, and se the file as a reference when preparing libraries or import the file for another rn. Enter Samples Manally 1 Adjst the samples table to an appropriate nmber of rows. Click the add row icon to add a row. Use the p/down arrows to add mltiple rows. Click the add row icon. Click to delete a row. Right-click on a row in the table and se the commands in the drop-down men. 2 Enter a niqe sample ID in the Sample ID field. Only se alphanmeric characters, dashes, or nderscores. Do not inclde spaces. 3 [Optional] Enter a sample description in the Sample field. Use alphanmeric characters, dashes, nderscores, or spaces. 4 Select an Index 1 adapter from the Index 1 (i7) drop-down list. 5 [Optional] Click Export to export sample information in *.csv format. 6 Click Save Rn. Import Samples Using a Template 1 If creating a sample information file, click Template. The template file contains the correct colmn headings for import. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 5

6 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide 2 Enter the sample information in each colmn for the samples in the rn, and then save the file. 3 Click Import Samples and browse to the new sample information file. 4 Select the sample information file and click Open. 5 Click Save Rn. Import Samples sing a Sample Sheet To create a sample sheet in IEM, select the FASTQ Only application for yor instrment, and then select TrSeq LT as the library prep kit. For more information, see IEM TrSight RNA Pan-Cancer and TrSight RNA Fsion Qick Reference Card (docment # ). 1 Click Import Samples and browse to the sample sheet. 2 Select the sample sheet and click Open. 3 Click Save Rn. Analysis Methods The RNA Fsion analysis modle performs the following analysis steps and then writes analysis otpt files to the Alignment folder. Demltiplexes index reads Generates FASTQ files Aligns to the RNA Fsion reference genome Detects gene fsions Demltiplexing Demltiplexing compares each Index Read seqence to the index seqences specified for the rn. No qality vales are considered in this step. Index reads are identified sing the following steps: Samples are nmbered starting from 1 based on the order they are listed for the rn. Sample nmber 0 is reserved for clsters that were not assigned to a sample. Clsters are assigned to a sample when the index seqence matches exactly. If a collision is detected with one mismatch, the software switches to zero mismatches for the sample. FASTQ File Generation After demltiplexing, the software generates intermediate analysis files in the FASTQ format, which is a text format sed to represent seqences. FASTQ files contain reads for each sample and the associated qality scores. Any controls sed for the rn and clsters that did not pass filter are exclded. Each FASTQ file contains reads for only one sample, and the name of that sample is inclded in the FASTQ file name. FASTQ files are the primary inpt for alignment. STAR Spliced Transcripts Alignment to a Reference (STAR) is a fast RNA-Seq read mapper, with spport for splicejnction and fsion read detection. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 6

7 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide STAR aligns reads by finding the Maximal Mappable Prefix (MMP) hits between reads (or read pairs) and the RNA Fsion reference genome, sing a Sffix Array index. Different parts of a read can be mapped to different genomic positions, corresponding to splicing or RNA-fsions. The genome index incldes known splice-jnctions from annotated gene models, allowing for sensitive detection of spliced reads. STAR performs local alignment, atomatically soft clipping ends of reads with high mismatches. The following cstom parameters are sed with STAR to enable split-read (ie, fsion read) mapping: otsammapquniqe 50 otfiltertype BySJot otsjfiltercontuniqemin otsjfilterconttotalmin otfilterintronmotifs RemoveNoncanonical chimsegmentmin 12 chimjnctionoverhangmin 12 chimscoredropmax 30 chimsegmentreadgapmax 5 chimscoreseparation 5 For more information, see githb.com/alexdobin/star. Manta Manta calls strctral variants (SVs) from mapped paired-end seqencing reads. Manta discovers candidate SVs from discordant pair and split-read alignments, followed by local assembly and realignment to refine candidates. The modle ses Manta to detect gene fsions from reads aligned by STAR, which appear like translocations in the RNA alignments. Read conts across the fsion and alignment qalities. Genome-wide realignment of fsion contigs to filter candidates that can be explained by a local alignment elsewhere in the genome. Length of coverage arond the breakpoints, indicating presence of stable fsion transcripts. For more information, see githb.com/illmina/manta. RNA Fsion Reference Genome The RNA Fsion reference genome is a modified version of the hg19 genome. Download the installer from the TrSight RNA Fsion Panel spport page on the Illmina website. View Analysis Reslts 1 From the Local Rn Manager dashboard, select the rn name. 2 From the Rn Overview tab, review the seqencing rn metrics. 3 [Optional] Select the Copy to Clipboard icon to copy the otpt rn folder file path. 4 If yo want to change the file location of the analysis data for any ftre rns, select the Edit icon, and edit the otpt rn folder file path. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 7

8 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide The file path leading p to the otpt rn folder is editable. The otpt rn folder name cannot be changed. 5 Select the Seqencing Information tab to review rn parameters and consmables information. 6 Select the Samples and Reslts tab to view the analysis report. If analysis was reqeed, select the appropriate analysis from the Select Analysis drop-down list. From the left navigation bar, select a sample name to view the report for another sample. 7 [Optional] Select the Copy to Clipboard icon to copy the Analysis folder file path. Analysis Report The following reslts are provided on the Samples and Reslts tab. Reslts can be viewed for each sample. Rn Information and Library Information The RNA Fsion Report incldes rn information and library information for the sample. Table 2 Section Rn Information Rn Information and Library Information Library Information for sample Report Tables Total of PF reads (entire rn) Total nmber of reads in the rn passing filter % Bases Q30 Percent of bases with a qality score 30 % Aligned reads Percent of reads mapping to the reference genome Nmber of reads Total nmber of pass filter reads Nmber of genes at 1X coverage Nmber of genes that have at least 1x coverage by aligned RNA Fsion reads along the exons % Aligned to rrna Percent of reads that align to ribosomal RNA repeats Each report incldes a main table with high confidence fsion calls and two spplementary tables. Table 3 Table s Table High Confidence Fsion Calls Low Confidence Fsion Calls Recrrent Fsions Not Called Fsions called with both a filter vale of Pass and, if enabled, a score greater than the threshold vale. For more information, see Filtering on page 12 and Scoring on page 13. Fsions called that do not have a filter vale of 'Pass' and, if enabled, do not have a score greater than the threshold vale. Recrrent gene fsions that are defined by the Mitelman database that were not detected. The TrSight RNA Fsion Panel targets both genes of the fsions listed in this table. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 8

9 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Each table incldes the following colmns. Yo can sort the data by clicking any colmn title or se search to search for a disease association or gene fsion. Click Export (csv) or Export (pdf) to export a table. The exported file contains all reslts, regardless of the filters sed. Table 4 Colmn Heading Disease Association* Gene Fsion Colmn Heading s for High and Low Confidence Fsion Calls Tables Cytogenetic Coordinates Fsion Spporting Reads Gene 1 Reference Reads Gene 2 Reference Reads Table 5 Colmn Heading Disease Association* Gene Fsion Cytogenetic Coordinates Gene 1 Whole Gene Read Conts Gene 2 Whole Gene Read Conts Diseases the fsion has been linked with in the Mitelman database. Gene names of the fsed genes. Genomic coordinates of the fsed genes. Reads specifically spporting the fsion transcripts. The sm of PairedAlt and SplitAlt reads in the fsions.csv file. For more information, see Analysis Otpt Files on page 9. Reads aligning across the breakpoint of Gene 1 that do not spport the fsion (ie, nmber of reads from the wild type or endogenos transcript). Reads aligning across the breakpoint of Gene 2 that do not spport the fsion (ie, nmber of reads from the wild type or endogenos transcript). Colmn Heading s for Recrrent Fsions Not Called Table Diseases the fsion has been linked with in the Mitelman database. Gene names of the fsed genes. Genomic coordinates of the fsed genes. Read conts covering the whole gene of the potential fsion partner (no fsion spporting reads were identified). Read conts covering the whole gene of the potential fsion partner (no fsion spporting reads were identified). *The disease associations are defined by data collected from the Mitelman Database on Agst 26, The RNA Fsion modle does not retrieve pdates to the database and sers cannot pdate the database. The RNA Fsion modle reports only the most freqently observed disease association of the fsion from scientific literatre recorded in the Mitelman database as of Agst 26, Disease associations for fsions with ndefined disease associations are reported as NA (not available). The disease association that the RNA Fsion modle provides, via the Mitelman Database, is for research se only and mst not be sed for any clinical decisions. The TrSight RNA Fsion System is classified as Research Use Only. "Mitelman Database of Chromosome Aberrations and Gene Fsions in Cancer (2015/08/26). Mitelman F, Johansson B and Mertens F (Eds.), Analysis Otpt Files The following analysis otpt files are generated for the RNA Fsion analysis modle and provide analysis reslts for alignment. Analysis otpt files are located in the Alignment folder. File Name Demltiplexing (*.demx) FASTQ (*.fastq.gz) Alignment files in the BAM format (*.bam) Intermediate files containing demltiplexing reslts. Intermediate files containing qality scored base calls. FASTQ files are the primary inpt for the alignment step. Contains aligned reads for a given sample. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 9

10 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide File Name Conts files in GeneConts folder (*.csv) fsions.csv Contains read conts information for a given sample. Contains information for all fsion candidates. Demltiplexing File Format The process of demltiplexing reads the index seqence attached to each clster to determine from which sample the clster originated. The mapping between clsters and sample nmber is written to a demltiplexing (*.demx) file for each tile of the flow cell. The demltiplexing file naming format is s_1_x.demx, where X is the tile nmber. Demltiplexing files start with a header: Version (4 byte integer), crrently 1 Clster cont (4 byte integer) The remainder of the file consists of sample nmbers for each clster from the tile. When the demltiplexing step is complete, the software generates a demltiplexing file named DemltiplexSmmaryF1L1.txt. In the file name, F1 represents the flow cell nmber. In the file name, L1 represents the lane nmber. Demltiplexing reslts in a table with one row per tile and one colmn per sample, inclding sample 0. The most commonly occrring seqences in index reads. FASTQ File Format FASTQ is a text-based file format that contains base calls and qality vales per read. Each record contains 4 lines: The identifier The seqence A pls sign (+) The Phred qality scores in an ASCII + 33 encoded format The identifier is formatted ReadNm:FilterFlag:0:SampleNmber 1:N:0:2 TCGCACTCAACGCCCTGCATATGACAAGACAGAATC + <>;##=><9=AAAAAAAAAA9#:<#<;<<<????#= FASTQ File Names FASTQ files are named with the sample name and the sample nmber. The sample nmber is a nmeric assignment based on the order that the sample is listed for the rn. For example:...\samplename_s1_l001_r1_001.fastq.gz Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 10

11 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide samplename The sample name listed for the sample. If a sample name is not provided, the file name incldes the sample ID. S1 The sample nmber based on the order that samples are listed for the rn starting with 1. In this example, S1 indicates that this sample is the first sample listed for the rn. NOTE Reads that cannot be assigned to any sample are written to a FASTQ file for sample nmber 0, and exclded from downstream analysis. L001 The lane nmber. R1 The read. In this example, R1 means Read 1. For a paired-end rn, a file from Read 2 incldes R2 in the file name. When generated, the Index Reads are I1 or I The last segment is always 001. FASTQ files are compressed in the GNU zip format, as indicated by *.gz in the file name. FASTQ files can be ncompressed sing tools sch as gzip (command-line) or 7-zip (GUI). BAM File Format A BAM file (*.bam) is the compressed binary version of a SAM file that is sed to represent aligned seqences. SAM and BAM formats are described in detail at samtools.githb.io/hts-specs/samv1.pdf. BAM files se the file naming format of SampleName_S#.bam, where # is the sample nmber determined by the order that samples are listed for the rn. In mltinode mode, the S# is set to S1, regardless the order of the sample. BAM files contain a header section and an alignment section: Header Contains information abot the entire file, sch as sample name, sample length, and alignment method. Alignments in the alignments section are associated with specific information in the header section. Alignments Contains read name, read seqence, read qality, alignment information, and cstom tags. The read name incldes the chromosome, start coordinate, alignment qality, and the match descriptor string. Alignments correlate to the RNA Fsion reference genome. For descriptions of possible tags in the BAM files, see githb.com/alexdobin/star. BAM index files (*.bam.bai) provide an index of the corresponding BAM file. GeneConts Files The GeneConts folder contains the following files for each sample. File Contigs.csv Conts.csv Conts.csv.coverage.txt Conts.csv.geneinfo.txt Conts of reads to different contigs of the reference genome Read conts per gene Read coverage information per gene Gene length (exonic) and gene IDs Fsions File Format The fsions.csv file located in the MantaFsions folder contains the following information for all fsion candidates. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 11

12 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Colmn Heading Name Chr1 Pos1 Position of end 1. Manta name of the fsion candidate. Chromosome of fsion end 1 (5' for stranded data). Strand1 Strand of RNA fsion transcript at end 1 "." for nstranded. Chr2 Pos2 Position of end 2. Chromosome fsion end 2 (3' for stranded data). Strand2 Strand of RNA fsion transcript at end 2 "." for nstranded. Depth PairedRef PairedAlt SplitRef SplitAlt Total read depth for the fsion candidate. Read pairs spporting the reference alleles. Read pairs spporting the fsion. Split reads spporting the reference alleles. Split reads spporting the fsion. Ref1 Reads spporting the reference allele at end 1. Ref2 Reads spporting the reference allele at end 2. Gene1 Names of all annotated genes (exons) overlapping fsion end 1. Gene2 Names of all annotated genes (exons) overlapping fsion end 2. Cis BreakpointHomology Contig States whether the fsion is in cis orientation (same chromosome, same strand). Length of perfect homology arond 2 fsion breakpoints. Seqence of the fsion-spanning contig. ContigAlign1 Length of fsion contig alignment at fsion end 1. ContigAlign2 Length of fsion contig alignment at fsion end 2. ContigLocalAlign Length of longest alternative nonfsion alignment of the contig. CoverageGene1 Length of genomic region covered by nonfsion reads after fsion end 1. CoverageGene2 Length of genomic region covered by nonfsion reads after fsion end 2. CandidateReads RepeatOverlap Filter Nmber of fsion candidate reads. Indicates if the fsion call overlaps a genomic repeat. "Pass" or the name of the threshold filter triggered by the fsion candidate. For more information, see Filtering on page 12. Score Score of the fsion candidate. For more information, see Scoring on page 13. Filtering A fsion candidate can have the following filter vales. A fsion candidate withot a "Pass" filter can have mltiple nonpassing threshold filters. Table 6 Threshold Filters Filter Pass Imprecise Intragenic Meets the threshold filters detailed in Scoring. A low-resoltion candidate, not an assembled fsion call. The presmed fsion is between portions within the same gene. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 12

13 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Filter LocalContigAlign LowFsionRatio LowFsionReads NoGeneCoverage NonExonic NoReferenceReads WeakBreakend Contig realignment fond a nonfsion alignment for this contig. Few strong evidence reads compared to wild-type reads. Few strong evidence reads. Length of read coverage arond the fsion breakpoint is small. Fsion breakpoint does not fall within an exon. No reads on either side of the presmed breakpoint are marked as reference (strctrally normal) reads. The read/alignment evidence onone side of the fsion is weak. Usally this filter indicates that the reads only overlap the fsion by a few base pairs. Alternatively, it can indicate too mch homology (no niqe seqence). Scoring The score is calclated as a weighted average of the individal featres of each fsion candidate, sing the formla max(min(f, fmin), fmax) - fmin) * Coef. The score is between 0 1. Featre Scored Range Max(Coefficient) Split Reads Paired Reads Alt/Ref Reads Fsion Contig Align Length (bp) (compted for each break-end) Alternative Local Contig Align Fraction Break-end Homology (bp) Fsion Length (bp) (for cis fsions) 2,000, , Is Cis? -0.2 Coverage After Fsion (bp) (compted for the break-end with less coverage) Fsions mst pass the following threshold filters to have a "Pass" filter vale. Split Reads + Paired Reads 3 Alt/Ref Reads 0.01 Fsion Contig Align Length (bp) > 16 Break-end Homology (bp) 10 Alternative Local Contig Align Fraction < 0.8 Coverage after fsion (bp) 100 Spplementary Otpt Files The following otpt files provide spplementary information, or smmarize rn reslts and analysis errors. These files are not reqired for assessing analysis reslts, however they can be sed for trobleshooting prposes. All files are located in the Alignment folder nless otherwise specified. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 13

14 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide File Name AdapterTrimming.txt AnalysisError.txt AnalysisLog.txt CompletedJobInfo.xml DemxSmmaryF1L1.txt FastqSmmaryF1L1.txt SampleSheetUsed.csv Lists the nmber of trimmed bases and percentage of bases for each tile. This file is present only if adapter trimming was specified for the rn. Processing log that lists any errors that occrred dring analysis. This file is present only if errors occrred. Processing log that describes every step that occrred dring analysis of the crrent rn folder. This file does not contain error messages. Written after analysis is complete, contains information abot the rn, sch as date, flow cell ID, software version, and other parameters. Reports demltiplexing reslts in a table with 1 row per tile and 1 colmn per sample. FASTQ smmary file with the sample nmber, tiles, nmber of raw reads, and nmber of reads passing filter. A copy of the sample sheet. Analysis Folder The analysis folder holds the files generated by the Local Rn Manager software. The relationship between the otpt folder and analysis folder is smmarized as follows: Dring seqencing, Real-Time Analysis (RTA) poplates the otpt folder with files generated dring image analysis, base calling, and qality scoring. RTA copies files to the analysis folder in real time and assigns a qality score to each base for each cycle. As analysis contines, Local Rn Manager writes otpt files to the analysis folder, and then copies the files back to the otpt folder. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 14

15 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Folder Strctre Alignment_Imported_X* or Alignment_X* (* indicates different analyses performed) Import Date/Time Fastq Reports Contains rn information. [SampleName] samplename_s1_l001_r1_001.fastq.gz samplename_s1_l001_r2_001.fastq.gz Stats AdapterTrimming.txt ConversionStats.xml DemltiplexingStats.xml DemxSmmaryF1L1txt FastqSmmaryF1L1.txt Stats.json Undertermined_S0 Undetermined_S0_L001_R1_001.fastq.gz Undetermined_S0_L001_R2_001.fastq.gz Logging Contains log files describing steps performed dring alignment. Report Contains files for the sample analysis report. samples [SampleName] Align Contains *.bam and *.ot files. GeneConts Contains contigs and conts files. MantaFsions Contains the fsions.csv file. AnalysisError.txt AnalysisLog.txt Checkpoint.txt CompletedJobInfo.xml SampleSheetUsed.csv Config Contains instrment configration files. Data Contains *.bcl files and scatter plots from the seqencing rn. Images Contains images generated dring the seqencing rn (if appropriate). InterOp Contains binary reporting files sed for Seqencing Analysis Viewer. Logs Contains log files describing steps performed by the instrment for each cycle. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 15

16 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Recipe Contains a *.xml file of the seqencing recipe sed. RTALogs Contains logs of RTA events. Thmbnail_Images Contains smaller versions of files in the Images folder. RTAComplete.txt RTAConfigration.xml RTAReadComplete.txt RnCompletionStats.xml RnInfo.xml RnParameters.xml Alignment Folders Each time that analysis is reqeed, the Local Rn Manager creates an Alignment folder named Alignment_ #, where # is a seqential nmber. Revision History Docment Date of Change Docment # v01 Docment # v00 March 2018 October 2016 Applied latest branding and formatting. Initial release. RNA Fsion specific content was removed from LRM Off-Instrment Gide and placed here to create a separate RNA Fsion Modle gide. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 16

17 Local Rn Manager RNA Fsion Analysis Modle Workflow Gide Technical Assistance For technical assistance, contact Illmina Technical Spport. Website: Illmina Cstomer Spport Telephone Nmbers Region Toll Free Regional North America Astralia Astria Belgim China Denmark Finland France Germany Hong Kong Ireland Italy Japan Netherlands New Zealand Norway Singapore Spain Sweden Switzerland Taiwan United Kingdom Other contries Safety data sheets (SDSs) Available on the Illmina website at spport.illmina.com/sds.html. Prodct docmentation Available for download in PDF from the Illmina website. Go to spport.illmina.com, select a prodct, then select Docmentation & Literatre. Docment # v01 For Research Use Only. Not for se in diagnostic procedres. 17

18 Docment # v01 Illmina 5200 Illmina Way San Diego, California U.S.A ILMN (4566) (otside North America) techspport@illmina.com For Research Use Only. Not for se in diagnostic procedres Illmina, Inc. All rights reserved.