CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

Size: px
Start display at page:

Download "CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline"

Transcription

1 CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum likelihood 1

2 Tree Defini4ons tree: A connected cyclic grph G = (V, E). grph: A set V of vertices (nodes) nd set E of edges, where ech edge (v i, v j ) connects pir of vertices. A pth in G is sequence (v 1, v 2,, v n ) of vertices in V such tht (v i, v i+1 ) re edges in E. A grph is connected provided for every pir v i v j of vertices, there is pth between v i nd v j. A cycle is pth with the sme strting nd ending vertices. A grph is cyclic provided it hs no cycles. Tree Defini4ons degree of vertex v is the number of edges incident to v. A phylogenetic tree is tree with lbel for ech lef (vertex of degree one). A binry phylogenetic tree is phylogenetic tree where every interior (non-lef) vertex hs degree 3; (one prent nd two children). A rooted (*binry) phylogenetic tree is phylogenetic tree with single designted vertex r (* of degree 2). w is prent (ncestor) of v provided (v,w) is on pth to root. In this cse v is child (descendnt) of w. 2

3 Tree Defini4ons tree: A connected cyclic grph G = (V, E). degree of vertex v is the number of edges incident to v. A phylogenetic tree is tree with lbel for ech lef (vertex of degree one). Leves represent existing species Other vertices represent most recent common ncestor. Length of brnches represent evolutionry time. Root (if present) represents the oldest evolutionry ncestor. Coun4ng nd Trees A tree with n ver4ces hs n 1 edges. (Proof?) A rooted binry phylogene4c tree with n leves hs n 1 internl ver4ces; nd thus 2n 1 totl ver4ces. How mny rooted binry phylogene4c trees with n leves? 3

4 Chrcter bsed Phylogene4c Tree Reconstruc4on Input Chrcters Moleculr Morphologicl Algorithm Output 1. Wht is chrcter dt? 2. Wht is the criteri for evlu6ng tree? 3. How do we op6mize this criteri: 1. Over ll possible trees? 2. Over restricted clss of trees? Op6ml phylogene4c tree Chrcter Bsed Tree Reconstruc4on Chrcters my be morphologicl fetures # of eyes or legs or the shpe of bek or fin. Chrcters my be nucleo4des of DNA (A, G, C, T) or mino cids (20 leher lphbet). Vlues re clled sttes of chrcter. Gorill: CCTGTGACGTAACAAACGA Chimpnzee: CCTGTGACGTAGCAAACGA Humn: CCTGTGACGTAGCAAACGA Non inform4ve chrcter 2 stte chrcter 4

5 Chrcter Bsed Tree Reconstruc4on GOAL: determine wht chrcter strings t internl nodes would best explin the chrcter strings for the n observed species An Exmple Vlue1 Vlue2 Mouth Smile Frown Eyebrows Norml Pointed 5

6 Chrcter Bsed Tree Reconstruc4on Which tree is beaer? Chrcter Bsed Tree Reconstruc4on Count chnges on tree 6

7 Chrcter Bsed Tree Reconstruc4on Mximum Prsimony: minimize number of chnges on edges of tree Mximum Prsimony Ockhm s rzor: simplest expln4on for the dt Assumes tht observed chrcter differences resulted from the fewest possible mut4ons Seeks tree with the lowest possible prsimony score, defined sum of cost of ll mut4ons found in the tree 7

8 Chrcter Mtrix Given n species, ech lbeled by m chrcters. Ech chrcter hs k possible sttes. Gorill: CCTGTGACGTAACAAACGA Chimpnzee: CCTGTGACGTAGCAAACGA Humn: CCTGTGACGTAGCAAACGA n x m chrcter mtrix Assume tht chrcters in chrcter string re independent. Prsimony Score Gorill: CCTGTGACGTAACAAACGA Chimpnzee: CCTGTGACGTAGCAAACGA Humn: CCTGTGACGTAGCAAACGA Assume tht chrcters in chrcter string re independent. Given chrcter strings S=s 1 s m nd T=t 1 t m : #chnges (S T) = Σ i d H (s i, t i ) where d H = Hmming distnce d H (v, w) = 0 if v=w d H (v, w) = 1 otherwise prsimony score of the tree s the sum of the lengths (weights) of the edges 8

9 Prsimony nd Tree Reconstruc4on Mximum Prsimony Two comput4onl sub problems: 1. Find the prsimony score for fixed tree. Smll Prsimony Problem (esy) 2. Find the lowest prsimony score over ll trees with n leves. Lrge prsimony problem (hrd) 9

10 Smll Prsimony Problem Input: Tree T with ech lef lbeled by n m chrcter string. Output: Lbeling of internl ver4ces of the tree T minimizing the prsimony score. Since chrcters re independent, every lef is lbeled by single chrcter. Smll Prsimony Problem Input: T: tree with ech lef lbeled by n m chrcter string. Output: Lbeling of internl ver4ces of the tree T minimizing the prsimony score. Lrge Prsimony Problem Input: M: n n x m chrcter mtrix. Output: A tree T with: n leves lbeled by the n rows of mtrix M lbeling of the internl ver4ces of T minimizing the prsimony score over ll possible trees nd ll possible lbelings of internl ver4ces 10

11 Smll Prsimony Problem Input: Binry tree T with ech lef lbeled by n m chrcter string. Output: Lbeling of internl ver4ces of the tree T minimizing the prsimony score. Since chrcters re independent, every lef is lbeled by single chrcter. Weighted Smll Prsimony Problem More generl version of Smll Prsimony Problem Input includes k x k scoring mtrix δ describing the cost of trnsforming ech of k sttes into nother stte. Smll Prsimony Problem is specil cse: δ ij = 0, if i = j, 1, otherwise. 11

12 Scoring Mtrices Smll Prsimony Problem A T G C A T G C Weighted Smll Prsimony Problem A T G C A T G C Unweighted vs. Weighted Smll Prsimony Scoring Mtrix: A T G C A T G C Smll Prsimony Score: 5 12

13 Unweighted vs. Weighted Weighted Prsimony Scoring Mtrix: A T G C A T G C Weighted Prsimony Score: 22 Weighted Smll Prsimony Problem Input: T: tree with ech lef lbeled by n m chrcter string from k leher lphbet. δ: k x k scoring mtrix Output: Lbeling of internl ver4ces of the tree T minimizing the weighted prsimony score. 13

14 Snkoff Algorithm Clculte nd keep trck of score for every possible lbel t ech vertex: s t (v) = minimum prsimony score of the subtree rooted t vertex v if v hs chrcter t s t (v) t.. Snkoff Algorithm s t (v) = minimum prsimony score of the subtree rooted t vertex v if v hs chrcter t The score s t (v) is bsed only on scores of its children: s t (prent) = min i {s i ( leo child ) + δ i, t } + min j {s j ( right child ) + δ j, t } t δ i, t δ j, t s i (leo child) s j (right child) 14

15 Snkoff Algorithm (cont.) Begin t leves: If lef hs the chrcter in ques4on, score is 0 Else, score is Snkoff Algorithm (cont.) s t (v) = min i {s i (u) + δ i, t } + min j {s j (w) + δ j, t } s i (u) δ i, A sum s A (v) = 0 min i {s i (u) + δ i, A } + min j {s j (w) + δ j, A } A T 3 G 4 C 9 15

16 Snkoff Algorithm (cont.) s t (v) = min i {s i (u) + δ i, t } + min j {s j (w) + δ j, t } s j (u) δ j, A sum s A (v) = min 0 i {s i (u) + δ i, A } + + min 9 = j {s 9 j (w) + δ j, A } A 0 T 3 G 4 C Snkoff Algorithm (cont.) s t (v) = min i {s i (u) + δ i, t } + min j {s j (w) + δ j, t } Repet for T, G, nd C 16

17 Snkoff Algorithm (cont.) Repet for right subtree Snkoff Algorithm (cont.) Repet for root 17

18 Snkoff Algorithm (cont.) Smllest score t root is minimum weighted prsimony score In this cse, 9 so lbel with T Snkoff Algorithm: Trveling down the Tree The scores t the root vertex hve been computed by going up the tree Aoer the scores t root vertex re computed the Snkoff lgorithm moves down the tree nd ssign ech vertex with op4ml chrcter. 18

19 Snkoff Algorithm (cont.) 9 is derived from So left child is T, And right child is T Snkoff Algorithm (cont.) And the tree is thus lbeled 19

20 Anlysis of Snkoff s Algorithm A dynmic progrmming problem lgorithm: Op>ml substructure: solu4on obtined by solving smller problem of sme type. s t (prent) = min i {s i ( leo child ) + δ i, t } + min j {s j ( right child ) + δ j, t } t Recurrence termintes t leves, where solu4on is known. s i (leo child) δ i, t δ j, t s j (right child) Anlysis of Snkoff s Algorithm How mny comput6ons do we perform for n species, m chrcters, nd k sttes per chrcter? Forwrd step: At ech internl node of tree: s t (prent) = min i {s i ( leo child ) + δ i, t } + min j {s j ( right child ) + δ j, t } 2k sums nd 2 (k 1) comprisons = 4k 2 n 1 internl nodes. (4k 2)(n 1) sums. Trcebck: one lookup per internl node. (n 1) oper4ons For ech chrcter (4k 2)(n 1) + (n 1) oper4ons C n k Above clcul4on performed once for ech chrcter: C m n k oper4ons O( m n k) 4me. [ big O ] Increses linerly w/ # of species or # of chrcters. 20

21 Anlysis of Snkoff s Algorithm How mny comput6ons do we perform for n species, m chrcters, nd k sttes per chrcter? Trcebck: 2k sums Above clcul4on performed once for ech chrcter O( m n k) 4me. [ big O ] Increses linerly w/ # of species or # of chrcters. Fitch s Algorithm Solves Smll Prsimony problem Published 4 yers before Snkoff (1971) Mkes two psses through tree: Leves root. Root leves. 21

22 Fitch Algorithm: Step 1 Assign set S(v) of lehers to every vertex v in the tree, trversing the tree from leves to root S(l) = observed chrcter for ech lef l For vertex v with children u nd w: S(v) = S(u) S(w) if non empty intersec4on S(u) S(w), otherwise E.g. if the node we re looking t hs leo child lbeled {A, C} nd right child lbeled {A, T}, the node will be given the set {A, C, T} Fitch s Algorithm: Exmple c t {,c} {t,} {,c} c t {t,} c t 22

23 Fitch Algorithm: Step 2 Assign lbels to ech vertex, trversing the tree from root to leves. Assign root r rbitrrily from its set S(r) For ll other ver4ces v: If its prent s lbel is in its set S(v), ssign it its prent s lbel Else, choose n rbitrry leher from its set S(v) s its lbel Fitch s Algorithm: Exmple c t {,c} {t,} c t {,c} {t,} c t c t 23

24 Fitch Algorithm (cont.) Fitch vs. Snkoff Both hve n O(nk) run4me Are they ctully different? Let s compre 24

25 Fitch As seen previously: Comprison of Fitch nd Snkoff As seen erlier, the scoring mtrix for the Fitch lgorithm is merely: A T G C A T G C So let s do the sme problem using Snkoff lgorithm nd this scoring mtrix 25

26 Snkoff Snkoff vs. Fitch The Snkoff lgorithm gives the sme set of op4ml lbels s the Fitch lgorithm For Snkoff lgorithm, chrcter t is op4ml for vertex v if s t (v) = min 1<i<k s i (v) Let S v = set of op4ml lehers for v. Then S v = S u S w if S u S v, S u S w, This is lso the Fitch recurrence The two lgorithms re iden4cl otherwise. 26

27 A Problem with Prsimony Ignores brnch lengths on trees A A A A A A A C A A A A Sme prsimony score. Mut4on more likely on longer brnch. A C x Probbilis4c Model y t Pr[ x y, t] = probbility tht y muttes to x in 4me t Given tree T with leves lbeled by present chrcters, wht is the probbility of lbeling of ncestrl nodes? Assume: 1. Chrcters evolve independently. 2. Constnt rte of mut4on on ech brnch. 3. Stte of vertex depends only on prent nd brnch length: i.e. Pr[ x y, t] depends only on y nd t. (Mrkov process) 27

28 Probbilis4c Model y x t Pr[ x y, t] = probbility tht y muttes to x in 4me t Two species t 1 t 2 x 1 x 2 T = tree topology x 1, x 2 : chrcters for ech species : chrcter for ncestor Pr[ x 1, x 2, T, t 1, t 2 ] = q Pr[x 1, t 1 ] Pr[x 2, t 2 ] q = Pr[ ncestor hs chrcter ] Probbilis4c Model n species: x 1, x 2,, x n Let α(i) = ncestor of node i. Let n+1, n+2,, 2n 1 = chrcters on internl nodes, where nodes re number from internl ver4ces up to root. Pr[x 1,..., x n T, t 1,..., t 2n 2 ]= n+1, n+2,.., 2n 1 q 2n 1 2n 2 i=n+1 Pr[ i α(i),t i ] n Pr[x i α(i),t i ] i=1 Follows from Lw of Totl Probbility: P(X) = Σ P(X Y i ) P(Y i ). 28

29 Felsenstein s Algorithm Let Pr[T k ] = probbility of lef nodes below node k, given k =. Compute vi dynmic progrmming b c Pr[T k ] = b Pr[b, t i ]Pr[T i b] c Pr[c, t j ]Pr[T j c] Ini4l condi4ons. For k = 1,, n (lef nodes) Pr[T k ] = 1, if = x k 0, otherwise. Compu4ng the Likelihood Let Pr[T k ] = probbility of lef nodes below node k, given k =. Pr[x 1,..., x n T, t ]= Pr[T 2n 1 ]q Note: Root is node 2n 1 29

30 Mximum Likelihood Let Pr[T k ] = probbility of lef nodes below node k, given k =. ( Pr[T k ] = mx b ( ) Pr[b, t i ]Pr[T i b]) mx Pr[c, t j ]Pr[T j c] c Trcebck s before with Snkoff s lgorithm. Mx. Prsimony vs. Mx. Likelihood Set δ ij = log P(j i) in weighted prsimony (Snkoff lgorithm) Weighted prsimony produces mximum probbility ssignments, ignoring brnch lengths 30

Phylogeny and Molecular Evolution

Phylogeny and Molecular Evolution Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion

More information

Better Hill-Climbing Searches for Parsimony

Better Hill-Climbing Searches for Parsimony Better Hill-Climbing Serches for Prsimony Gneshkumr Gnpthy, Vijy Rmchndrn, nd Tndy Wrnow Deprtment of Computer Sciences, University of Texs, Austin, TX 78712; gsgk, vlr, tndy @cs.utexs.edu Abstrct. The

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

Suffix Tries. Slides adapted from the course by Ben Langmead

Suffix Tries. Slides adapted from the course by Ben Langmead Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

Information Retrieval and Organisation

Information Retrieval and Organisation Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls

CPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

On the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis

On the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis On the Detection of Step Edges in Algorithms Bsed on Grdient Vector Anlysis A. Lrr6, E. Montseny Computer Engineering Dept. Universitt Rovir i Virgili Crreter de Slou sin 43006 Trrgon, Spin Emil: lrre@etse.urv.es

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1. Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

The Distributed Data Access Schemes in Lambda Grid Networks

The Distributed Data Access Schemes in Lambda Grid Networks The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn

More information

Illumination and Shading

Illumination and Shading Illumintion nd hding In order to produce relistic imges, we must simulte the ppernce of surfces under vrious lighting conditions. Illumintion models: given the illumintion incident t point on surfce, wht

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded

More information

Looking up objects in Pastry

Looking up objects in Pastry Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy

4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy /9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier

More information

Functor (1A) Young Won Lim 8/2/17

Functor (1A) Young Won Lim 8/2/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

II. THE ALGORITHM. A. Depth Map Processing

II. THE ALGORITHM. A. Depth Map Processing Lerning Plnr Geometric Scene Context Using Stereo Vision Pul G. Bumstrck, Bryn D. Brudevold, nd Pul D. Reynolds {pbumstrck,brynb,pulr2}@stnford.edu CS229 Finl Project Report December 15, 2006 Abstrct A

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona

Implementing Automata. CSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona Implementing utomt Sc 5 ompilers nd Systems Softwre : Lexicl nlysis II Deprtment of omputer Science University of rizon collerg@gmil.com opyright c 009 hristin ollerg NFs nd DFs cn e hrd-coded using this

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

3.5.1 Single slit diffraction

3.5.1 Single slit diffraction 3.5.1 Single slit diffrction Wves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. We will consider this lter.

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Visibility Algorithms

Visibility Algorithms Visibility Determintion Visibility Algorithms AKA, hidden surfce elimintion Roger Crwfis CIS 78 This set of slides reference slides used t Ohio Stte for instruction by Prof. Mchirju nd Prof. Hn-Wei Shen.

More information

Functor (1A) Young Won Lim 10/5/17

Functor (1A) Young Won Lim 10/5/17 Copyright (c) 2016-2017 Young W. Lim. Permission is grnted to copy, distribute nd/or modify this document under the terms of the GNU Free Documenttion License, Version 1.2 or ny lter version published

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

9 Graph Cutting Procedures

9 Graph Cutting Procedures 9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

Evolutionary tree reconstruction (Chapter 10)

Evolutionary tree reconstruction (Chapter 10) Evolutionary tree reconstruction (Chapter 10) Early Evolutionary Studies Anatomical features were the dominant criteria used to derive evolutionary relationships between species since Darwin till early

More information