Course Administration
|
|
- Sharyl Bradford
- 6 years ago
- Views:
Transcription
1 /4/7 Spring 7 EE 363: Computer Orgniztion Arithmetic for Computers Numer Representtion & ALU Avinsh Kodi Deprtment of Electricl Engineering & Computer Science Ohio University, Athens, Ohio 457 E-mil: kodi@ohio.edu Wesite: Acknowledgement: Srinivsn Rmsurmnin, Mry J. Irwin, PSU Course Administrtion Homework A due next Fridy /3 Get strted with Qt-SPIM
2 /4/7 Arithmetic Where we hve een Performnce (seconds, cycles, instructions) Astrctions Instruction Set Architecture Assemly Lnguge nd Mchine Lnguge (SPIM) Opertion Wht s up hed? Implementing the rchitecture (Chpter 3) 3 result 3 Numers Bits re just its (no inherent mening) Conventions define reltionship etween its nd numers Binry numers (se ) Deciml. n - Of course it gets more complicted Numers re finite (overflow) Frctions nd rel numers Negtive numers How do we represent negtive numers? i.e. which it pttern will represent which numers?
3 /4/7 Possile Representtions Code Signed Mgnitude One s Complement Two s Complement Issues: lnce, numer of zeros, ese of opertion Which one is est? Why? Numer Representtion 3 it signed numers = = = =, 47,483, 646 =, 47,483, 647 = -, 47, 483, 648 = -, 47, 483, 647 = -, 47, 483, 646 = - = - 3
4 /4/7 Two s Complement Opertions Representing positive nd negtive numers (3-3 ) (3 3 ) (9 9 ) ( ) ( ) Negting two s complement numer: invert ll its nd dd Rememer: negte nd invert re quite different Converting n its numers into numers with more thn n its MIPS 6 it immedite gets converted to 3 its for rithmetic Copy the most significnt it (sign it) into the other its s Complement Binry Representtion Negte nd dd complement ll the its Note: negte nd invert re different! - 3 = -( 3 - ) = 3 - = sc inry deciml
5 /4/7 Addition nd Sutrction Just like in high school (crry/orrow s) Add 6 to 7 Sutrct 6 from 7 - Sutrct 6 from 7 (in two s complement) Overflow (result too lrge for finite computer word) Eg. Adding two n-it numers does not yield n n-it numers Adder: Boolen Alger A B Crry In Crry Out SUM Crry Out = A.B B.CI A.CI SUM = A.B.CI A.B.CI A.B.CI A.B.CI 5
6 /4/7 One-it Adder Tkes three input its nd genertes two output its Multiple its cn e cscded result () () () () () () () Detecting Overflow Overflow: the result is too lrge to represent in 3 its Overflow occurs when dding two positives yields negtive or, dding two negtives gives positive or, sutrct negtive from positive gives negtive or, sutrct positive from negtive gives positive On your own: Prove you cn detect overflow y: Crry into MSB xor Crry out of MSB, ex for 4 it signed numers
7 /4/7 Effects of Overflow An exception (interrupt) occurs Control jumps to predefined ddress for exception Interrupted ddress is sved for possile resumption Detils sed on softwre system/lnguge Don t lwys wnt to detect overflow New MIPS instructions: ddu, ddiu, suu Review: Boolen Alger nd Gtes Prolem: Consider logic function with 3 inputs: A, B nd C Output D is true if tlest one input is true Output E is true if exctly two inputs re true Output F is true if ll three inputs re true Show the truth tle for these three functions Show the Boolen equtions for these three functions Show n implementtion consisting of inverters, OR nd AND gtes A B C D E F D = E = F = 7
8 /4/7 An ALU (Arithmetic Logic Unit) Let s uild n ALU to support nd nd or instructions We will uild -it ALU nd use 3 of them Op A B Result result Possile Implementtion (sum-of-products) Not esy to decide the est wy to uild something Building 3-it ALU (AND, OR nd ADD) opertion opertion ALU result Result ALU result ALU result 3 3 ALU 3 result 3 8
9 /4/7 Wht out sutrction? Two s complement pproch Negte nd dd NOR implementtion ( ) =. Binvert opertion Ainvert Binvert opertion Result Result Supporting slt nd Overflow Detection Cn you figure out the ide? Ainvert Binvert opertion Result Ainvert Binvert opertion Result 3 3 Overflow Detection Set 9
10 /4/7 A 3-Bit ALU A ripple crry ALU B invert opertion Two its to decide ADD/SUB AND OR LESS A crry-in it Comine with Binvert to otin Bnegte result ALU result ALU result ALU Bit 3 genertes set nd overflow How to implement rnch instructions? 3 result 3 3 ALU 3 Set Overflow Test for Equlity Notice the control lines = AND = OR = ADD = SUBTRACT = SLT B negte ALU ALU ALU opertion Zero 3 3 ALU 3 Set Overflow
11 /4/7 Conclusions We cn uild ALU to support the MIPS instruction set Key Ide: Use multiplexor to select the output we wnt Efficiently perform sutrction using two s complement Replicte -it ALU to produce 3-it ALU Importnt points out hrdwre All of the gtes re lwys working The speed of the gte is ffected y the numer of inputs to the gte The speed of circuit is ffected y the numer of gtes in series (on the criticl pth or the deepest level of logic )
Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationComputer Arithmetic Logical, Integer Addition & Subtraction Chapter
Computer Arithmetic Logicl, Integer Addition & Sutrction Chpter 3.-3.3 3.3 EEC7 FQ 25 MIPS Integer Representtion -it signed integers,, e.g., for numeric opertions 2 s s complement: one representtion for
More informationQuestions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?
Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationChapter 3 Arithmetic for Computers
Chapter 3 Arithmetic for Computers 1 Arithmetic Where we've been: Abstractions: Instruction Set Architecture Assembly Language and Machine Language What's up ahead: Implementing the Architecture operation
More informationToday s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued)
Tod s Lecture Bsics of Logic Design: Boolen Alger, Logic Gtes Alvin R. Leeck CPS 4 Lecture 8 Homework #2 Due Ferur 3 Outline Review (sseml recursion) Building the uilding locks Logic Design Truth tles,
More informationGeorge Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationComputer Architecture Set Four. Arithmetic
Computer Architecture Set Four Arithmetic Arithmetic Where we ve been: Performance (seconds, cycles, instructions) Abstractions: Instruction Set Architecture Assembly Language and Machine Language What
More informationCMPUT101 Introduction to Computing - Summer 2002
CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,
More informationCS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras
CS 3 : Computer Systems - II Shnkr Blchndrn (shnkr@cse.iitm.c.in) Dept. of Computer Science & Engineering IIT Mdrs Recp Differentite Between s nd s Truth Tbles b AND b OR NOT September 4, 27 Introduction
More informationConcepts Introduced. A 1-Bit Logical Unit. 1-Bit Half Adder (cont.) 1-Bit Half Adder
oncepts Introduced A -Bit Logicl Unit sic rithmetic/logic unit clocks ltches nd ip-ops registers SRAMs nd RAMs nite stte mchines Below is -it logicl unit tht performs AN nd OR opertions Both the AN nd
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationDescribing Combinational circuits in BSV
Decriing Comintionl circuit in BSV Arvind Computer Science & Artificil Intelligence L. Mchuett Intitute of Technology Ferury 13, 2018 http://cg.cil.mit.edu/6.s084 L03-1 Three imple comintionl circuit NOT
More information6/23/2011. Review: IEEE-754. CSE 2021: Computer Organization. Exercises. Examples. Shakil M. Khan (adapted from Profs. Roumani & Asif)
6/23/2 CSE 22: Computer Orgniztion Lecture-8() Floting point computing (IEEE 754) Review: IEEE-754 single: 8 its doule: its single: 23 its doule: 52 its S Exponent Frction S x ( ) ( Frction) 2 (Exponent
More informationLAB L Hardware Building Blocks
LAB L Hrdwre Building Blocks Perform the following groups of tsks: LL1.v 1. In previous l we creted the 2-to-1 mux shown in the left prt of the figure elow nd found tht it cts s n if sttement. c c 0 1
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More information5 Regular 4-Sided Composition
Xilinx-Lv User Guide 5 Regulr 4-Sided Composition This tutoril shows how regulr circuits with 4-sided elements cn be described in Lv. The type of regulr circuits tht re discussed in this tutoril re those
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationEECS150 - Digital Design Lecture 23 - High-level Design and Optimization 3, Parallelism and Pipelining
EECS150 - Digitl Design Lecture 23 - High-level Design nd Optimiztion 3, Prllelism nd Pipelining Nov 12, 2002 John Wwrzynek Fll 2002 EECS150 - Lec23-HL3 Pge 1 Prllelism Prllelism is the ct of doing more
More informationRepresentation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation
Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationPart I: Translating & Starting a Program: Compiler, Linker, Assembler, Loader. Lecture 4
Part I: a Program: Compiler, Linker, Assembler, Loader Lecture 4 Program Translation Hierarchy C program Com piler Assem bly language program Assem bler Object: Machine language module Object: Library
More informationCS/COE 0447 Example Problems for Exam 2 Spring 2011
CS/COE 0447 Example Problems for Exam 2 Spring 2011 1) Show the steps to multiply the 4-bit numbers 3 and 5 with the fast shift-add multipler. Use the table below. List the multiplicand (M) and product
More informationReview. Steps to writing (stateless) circuits: Create a logic function (one per output)
MIPS ALU Review Steps to writing (stateless) circuits: Create a truth table Go through all different combinations of inputs For each row, generate each output based on the problem description Create a
More informationCPE 335 Computer Organization. MIPS Arithmetic Part I. Content from Chapter 3 and Appendix B
CPE 335 Computer Organization MIPS Arithmetic Part I Content from Chapter 3 and Appendix B Dr. Iyad Jafar Adatped from Dr. Gheith Abandah Slides http://www.abandah.com/gheith/courses/cpe335_s08/index.html
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationChapter Three. Arithmetic
Chapter Three 1 Arithmetic Where we've been: Performance (seconds, cycles, instructions) Abstractions: Instruction Set Architecture Assembly Language and Machine Language What's up ahead: Implementing
More informationChapter 3 Arithmetic for Computers. ELEC 5200/ From P-H slides
Chapter 3 Arithmetic for Computers 1 Arithmetic for Computers Operations on integers Addition and subtraction Multiplication and division Dealing with overflow Floating-point real numbers Representation
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationSubtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More informationCS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
More informationLecture Topics. Announcements. Today: Integer Arithmetic (P&H ) Next: continued. Consulting hours. Introduction to Sim. Milestone #1 (due 1/26)
Lecture Topics Today: Integer Arithmetic (P&H 3.1-3.4) Next: continued 1 Announcements Consulting hours Introduction to Sim Milestone #1 (due 1/26) 2 1 Overview: Integer Operations Internal representation
More informationSERIES. Patterns and Algebra OUT. Name
D Techer Student Book IN OUT 8 Nme Series D Contents Topic Section Ptterns Answers nd (pp. functions ) identifying ptterns nd nd functions_ creting ptterns_ skip equtions counting nd equivlence completing
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationCS 241 Week 4 Tutorial Solutions
CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationDigital Design using HDLs EE 4755 Final Examination
Nme Solution Digitl Design using HDLs EE 4755 Finl Exmintion Thursdy, 8 Decemer 6 :3-4:3 CST Alis The Hottest Plce in Hell Prolem Prolem Prolem 3 Prolem 4 Prolem 5 Prolem 6 Exm Totl (3 pts) ( pts) (5 pts)
More informationChapter 3. ALU Design
COMPUTER ORGANIZATION AND DESIGN The Hardware/Software Interface 5 th Edition Chapter 3 ALU Design Review - A MIPS ALU Implementation add/subt A 0 op B 0 A 1 less + result 0 Zero detect (slt, slti,sltiu,sltu,
More informationCS 31: Intro to Systems Digital Logic
CS 3: Intro to Systems Digital Logic Martin Gagné Swarthmore College January 3, 27 You re going to want scratch papr today borrow some if needed. Quick nnouncements Late Policy Reminder 3 late days total
More informationSummer Review Packet For Algebra 2 CP/Honors
Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationCS2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014
CS DIGITAL LOGIC & STATE MACHINE DESIGN SPRING DUE : April 7, HOMEWOR V READ : Relted portions of Chpters III, IV, VI, VII nd VIII ASSIGNMENT : There re seven questions Solve ll homework nd exm problems
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationLecture T1: Pattern Matching
Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.
More informationCaches I. CSE 351 Spring Instructor: Ruth Anderson
L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,
More informationLexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
More informationQubit allocation for quantum circuit compilers
Quit lloction for quntum circuit compilers Nov. 10, 2017 JIQ 2017 Mrcos Yukio Sirichi Sylvin Collnge Vinícius Fernndes dos Sntos Fernndo Mgno Quintão Pereir Compilers for quntum computing The first genertion
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
More informationLECTURE 4. Logic Design
LECTURE 4 Logic Design LOGIC DESIGN The language of the machine is binary that is, sequences of 1 s and 0 s. But why? At the hardware level, computers are streams of signals. These signals only have two
More informationRegistering as a HPE Reseller. Quick Reference Guide for new Partners in Asia Pacific
Registering s HPE Reseller Quick Reference Guide for new Prtners in Asi Pcific Registering s new Reseller prtner There re five min steps to e new Reseller prtner. Crete your Appliction Copyright 2017 Hewlett
More informationCS/COE0447: Computer Organization
CS/COE0447: Computer Organization and Assembly Language Chapter 3 Sangyeun Cho Dept. of Computer Science Five classic components I am like a control tower I am like a pack of file folders I am like a conveyor
More informationCS/COE0447: Computer Organization
Five classic components CS/COE0447: Computer Organization and Assembly Language I am like a control tower I am like a pack of file folders Chapter 3 I am like a conveyor belt + service stations I exchange
More informationRegistering as an HPE Reseller
Registering s n HPE Reseller Quick Reference Guide for new Prtners Mrch 2019 Registering s new Reseller prtner There re four min steps to register on the Prtner Redy Portl s new Reseller prtner: Appliction
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationChapter 1: Boolean Logic Boolean Logic 1
Chpter 1: Boolen Logic 1 1. Boolen Logic 1 Such simple things, And we mke of them something so complex it defets us, Almost. (John Ashery, Americn poet, 1927-) Every digitl device e it personl computer,
More informationIntroduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example
Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847
More informationCS352H: Computer Systems Architecture
CS352H: Computer Systems Architecture Lecture 4: Instruction Set Architectures III + MIPS ALU September 10, 2008 University of Texas at Austin CS352H - Computer Systems Architecture Fall 2009 Don Fussell
More informationCMU Fall VLSI CAD
CMU Fll 01 18-760 VLSI CAD [120 pts] Homework 2. Out Thu Sep 13, Due Thu Sep 27 01. 1. BDD ordering [10 pts] We sw tht vrible order is highly significnt for something s simple s multiplexor. How bout something
More informationDigital Signal Processing: A Hardware-Based Approach
Digitl Signl Processing: A Hrdwre-Bsed Approch Roert Esposito Electricl nd Computer Engineering Temple University troduction Teching Digitl Signl Processing (DSP) hs included the utilition of simultion
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationLanguages. L((a (b)(c))*) = { ε,a,bc,aa,abc,bca,... } εw = wε = w. εabba = abbaε = abba. (a (b)(c)) *
Pln for Tody nd Beginning Next week Interpreter nd Compiler Structure, or Softwre Architecture Overview of Progrmming Assignments The MeggyJv compiler we will e uilding. Regulr Expressions Finite Stte
More informationLily Yen and Mogens Hansen
SKOLID / SKOLID No. 8 Lily Yen nd Mogens Hnsen Skolid hs joined Mthemticl Myhem which is eing reformtted s stnd-lone mthemtics journl for high school students. Solutions to prolems tht ppered in the lst
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationArea & Volume. Chapter 6.1 & 6.2 September 25, y = 1! x 2. Back to Area:
Bck to Are: Are & Volume Chpter 6. & 6. Septemer 5, 6 We cn clculte the re etween the x-xis nd continuous function f on the intervl [,] using the definite integrl:! f x = lim$ f x * i )%x n i= Where fx
More informationWe are quite familiar with adding two numbers in decimal
Addition We are quite familiar with adding two numbers in decimal What about adding two binary numbers? If we use the two s complement method to represent binary numbers, addition can be done in a straightforward
More informationA Reconfigurable Arithmetic Datapath Architecture
A Reconfigurle Arithmetic Dtpth Architecture Reiner W. Hrtenstein, Riner Kress, Helmut Reinig University of Kiserslutern Erwin-Schrödinger-Strße, D-67663 Kiserslutern, Germny Fx: 49 631 205 2640, emil:
More informationOPERATIONS AND ALGEBRAIC THINKING NUMBER AND OPERATIONS IN BASE TEN NUMBER AND OPERATIONS: FRACTIONS
OPERTIONS ND LGERIC THINKING 003-019 WRITE ND INTERPRET NUMERICL EXPRESSIONS NLYZE PTTERNS ND RELTIONSHIPS NUMER ND OPERTIONS IN SE TEN 020-174 UNDERSTND THE PLCE VLUE SYSTEM PERFORM OPERTIONS WITH MULTI-DIGIT
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationTailoring the 32-Bit ALU to MIPS
Tailoring the 32-Bit ALU to MIPS MIPS ALU extensions Overflow detection: Carry into MSB XOR Carry out of MSB Branch instructions Shift instructions Slt instruction Immediate instructions ALU performance
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationCOMPUTER EDUCATION TECHNIQUES, INC. (MS_W2K3_SERVER ) SA:
In order to lern which questions hve een nswered correctly: 1. Print these pges. 2. Answer the questions. 3. Send this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
More informationContext-Free Grammars
Context-Free Grmmrs Descriing Lnguges We've seen two models for the regulr lnguges: Finite utomt ccept precisely the strings in the lnguge. Regulr expressions descrie precisely the strings in the lnguge.
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationUT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationArithmetic Logic Unit. Digital Computer Design
Arithmetic Logic Unit Digital Computer Design Arithmetic Circuits Arithmetic circuits are the central building blocks of computers. Computers and digital logic perform many arithmetic functions: addition,
More informationFundamentals of Engineering Analysis ENGR Matrix Multiplication, Types
Fundmentls of Engineering Anlysis ENGR - Mtri Multiplition, Types Spring Slide Mtri Multiplition Define Conformle To multiply A * B, the mtries must e onformle. Given mtries: A m n nd B n p The numer of
More informationALU Design. 1-bit Full Adder 4-bit Arithmetic circuits. Arithmetic and Logic Unit Flags. Add/Subtract/Increament/Decrement Circuit
LU Design -bit Full dder 4-bit rithmetic circuits dd/subtract/increament/decrement Circuit rithmetic and Logic Unit Flags Carry-Out, Sign, Zero, Overflow Shift and Rotate t Operations COE2 (Fall27) LU
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationCS 432 Fall Mike Lam, Professor a (bc)* Regular Expressions and Finite Automata
CS 432 Fll 2017 Mike Lm, Professor (c)* Regulr Expressions nd Finite Automt Compiltion Current focus "Bck end" Source code Tokens Syntx tree Mchine code chr dt[20]; int min() { flot x = 42.0; return 7;
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More information