CS-184: Computer Graphics. Today

Size: px
Start display at page:

Download "CS-184: Computer Graphics. Today"

Transcription

1 CS-184: Computer Grphics Lecture #10: Clippin n Hien Surces Pro. Jmes O Brien University o Cliorni, Berkeley V2006-F Toy Clippin Clippin to view volume Clippin ritrry polyons Hien Surce Removl Z-Buer BSP Trees Others 2

2 Clippin Stu outsie view volume shoul not e rwn Too close: oscures view 3 Clippin Stu outsie view volume shoul not e rwn Too close: oscures view Too r: Complexity Z-uer prolems Too hih/low/riht/let: Memory errors Broken lorithms Complexity 4

3 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) Line/plne tht clips it ˆn x ˆn r = 0 ˆn r 5 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) Line/plne tht clips it ˆn x = 0 ˆn 6

4 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) } Line/plne tht clips it ˆn x = 0 ˆn ( +t( )) = 0 ˆn +t(ˆn ( )) = 0 ˆn t = ˆn ˆn 6 Clippin Line to Line/Plne Sement my e on one sie t [0...1] Lines my e prllel ˆn = 0 ˆn t = ˆn ˆn 7

5 Clippin Line to Line/Plne Sement my e on one sie t [0...1] ˆn Lines my e prllel ˆn = 0 ˆn! t = ˆn ˆn (Recll comments out numericl issues) 7 Polyon Clip to Convex Domin Convex omin eine y collection o plnes (or lines or hyper-plnes) Plnes hve outwr pointin normls Clip inst ech plne in turn Check or erly/trivil rejection 8

6 Polyon Clip to Convex Domin 9 Polyon Clip to Convex Domin Insie Outsie Insie Outsie Insie Outsie Insie Outsie s p p i s p s i p s Output p Output i No output Output i n p 10

7 Polyon Clip to Convex Domin Sutherln-Homn lorithm Bsiclly ee wlkin Clippin one oten... shoul e eicient Lin-Brsky prmetric spce lorithm See text or clippin in 4D homoenize coorintes 11 Generl Polyon Clippin A B A B B A A B A B 12

8 Generl Polyon Clippin Weiler Alorithm Doule ees 13 Hien Surce Removl True 3D to 2D projection woul put every thin overlppin into the view plne. We nee to etermine wht s in ront n isply only tht. 14

9 Z-Buers A extr epth chnnel to ime Write Z vlues when writin pixels Test Z vlues eore writin Imes rom Okn Arikn 15 Z-Buers Beneits Esy to implement Works or most ny eometric primitive Prllel opertion in hrwre Limittions Quntiztion n lisin rticts Overill Trnsprency oes not work well 16

10 Z-Buers Trnsprency requires prtil sortin: Prtilly trnsprent 3r Front Prtilly trnsprent 1st Opque 2n Opque 3r Opque 1st Opque 2n Goo Not Goo 17 Z-Buers Recll epth-vlue istortions. It s eture...! More resolution ner viewer! Best use o limite precision 18

11 A-Buers Store sorte list o rments t ech pixel Drw ll opque stu irst then trnsprent Stu ehin ull opcity ets inore Nice or ntilisin Scn-line Alorithm Assume polyons on t intersect Ech time n ee is crosse etermine who s on top 20

12 Pinter s Alorithm Sort Polyons Front-to-Bck Drw in orer Bck-to-Front works lso, ut wsteul How to sort quickly? Intersectin polyons? Cycles? 21 BSP-Trees Binry Spce Prtition Trees Split spce lon plnes Allows st queries o some sptil reltions Simple construction lorithm Select plne s su-tree root Everythin on one sie to one chil Everythin on the other sie to other chil Use rnom polyon or splittin plne 22

13 BSP-Trees,,c,,e,, e c 23 BSP-Trees e,, c 2,e,, c 2 24

14 BSP-Trees e c 2,e,, c 2 25 BSP-Trees e 1 e 2 c 2 c 2 e 1, e 2, 26

15 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2, 27 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 28

16 BSP-Trees + e 1 e c c 2 e 1 e BSP-Trees Visiility Trversl Vrition o in-orer-trversl Chil one Su-tree root Chil two Select chil one se on loction o viewpoint Chil one on sme sie o su-tree root s viewpoint 29

17 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 :::::e 1 :c 2 ::e 2 30 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 :e 2 :c 2 ::e 1 :: :: 31

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces Prof. Jmes O Brien University of Cliforni, Berkeley V2008S101.0 1 Tody Clipping Clipping to view volume Clipping ritrry polygons Hidden Surfce

More information

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014. 1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden

More information

Today. CS-184: Computer Graphics. Lecture #10: Clipping and Hidden Surfaces. Clipping. Hidden Surface Removal

Today. CS-184: Computer Graphics. Lecture #10: Clipping and Hidden Surfaces. Clipping. Hidden Surface Removal Today CS-184: Computer Graphics Lecture #10: Clipping and Hidden Surfaces!! Prof. James O Brien University of California, Berkeley! V2015-S-10-1.0 Clipping Clipping to view volume Clipping arbitrary polygons

More information

Visibility Algorithms

Visibility Algorithms Visibility Determintion Visibility Algorithms AKA, hidden surfce elimintion Roger Crwfis CIS 78 This set of slides reference slides used t Ohio Stte for instruction by Prof. Mchirju nd Prof. Hn-Wei Shen.

More information

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Geometric transformations

Geometric transformations Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22

More information

Computer Graphics Inf4/MSc. Computer Graphics. Lecture 6 View Projection Taku Komura

Computer Graphics Inf4/MSc. Computer Graphics. Lecture 6 View Projection Taku Komura Computer Graphics Lecture 6 View Projection Taku Komura 1 Overview 1. View transformation 2. Rasterisation Implementation of viewing. Transform into camera coorinates. Perform projection into view volume

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Lesson 11 MA Nick Egbert

Lesson 11 MA Nick Egbert Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under

More information

Math 35 Review Sheet, Spring 2014

Math 35 Review Sheet, Spring 2014 Mth 35 Review heet, pring 2014 For the finl exm, do ny 12 of the 15 questions in 3 hours. They re worth 8 points ech, mking 96, with 4 more points for netness! Put ll your work nd nswers in the provided

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI) Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018

Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018 Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas

Objective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Prairie Kitchen Assembly Instructions

Prairie Kitchen Assembly Instructions Please retain this information for future reference Parts List: To order replacement parts, please visit www.kidkraft.com 1 2 3 4 5 6 7 17 10 12 18 19 8 9 11 13 20 14 15 16 21 23 22 24 25 26 28 27 29 30

More information

Lecture 7: Integration Techniques

Lecture 7: Integration Techniques Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.

More information

Midterm I Solutions CS164, Spring 2006

Midterm I Solutions CS164, Spring 2006 Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

6.2 Volumes of Revolution: The Disk Method

6.2 Volumes of Revolution: The Disk Method mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes

More information

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis

CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

s1 s2 d B (F/D.IR.RS1 == D/X.IR.RD) (F/D.IR.RS2 == D/X.IR.RD) (F/D.IR.RS1 == X/M.IR.RD) (F/D.IR.RS2 == X/M.IR.RD) = 1 = 1

s1 s2 d B (F/D.IR.RS1 == D/X.IR.RD) (F/D.IR.RS2 == D/X.IR.RD) (F/D.IR.RS1 == X/M.IR.RD) (F/D.IR.RS2 == X/M.IR.RD) = 1 = 1 Hrwre Interlock Exmple: cycle Hrwre Interlock Exmple: cycle ile s s / / / t em / ile s s / / / t em / nop nop hzr hzr $,$,$ $,$,$ (/..R == /..R) (/..R == /..R) (/..R == /..R) (/..R == /..R) = (/..R ==

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

2. What are the types of diffraction and give the differences between them? (June 2005, June 2011)

2. What are the types of diffraction and give the differences between them? (June 2005, June 2011) UNIT-1 b DIFFRACTION Diffrction:A) Distinction between Fresnel nd Frunhofer diffrction, B) diffrction due to single slit, N-slits,C) Diffrction grting experiment. 1 A) Distinction between Fresnel nd Frunhofer

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

1.5 Extrema and the Mean Value Theorem

1.5 Extrema and the Mean Value Theorem .5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

More Raster Line Issues. Bresenham Circles. Once More: 8-Pt Symmetry. Only 1 Octant Needed. Spring 2013 CS5600

More Raster Line Issues. Bresenham Circles. Once More: 8-Pt Symmetry. Only 1 Octant Needed. Spring 2013 CS5600 Spring 03 Lecture Set 3 Bresenham Circles Intro to Computer Graphics From Rich Riesenfel Spring 03 More Raster Line Issues Fat lines with multiple pixel with Symmetric lines n point geometry how shoul

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

Section 3.2: Arithmetic Sequences and Series

Section 3.2: Arithmetic Sequences and Series Sectio 3.: Arithmetic Sequeces Series Arithmetic Sequeces Let s strt out with efiitio: rithmetic sequece: sequece i which the ext term is fou by ig costt (the commo ifferece ) to the previous term Here

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

CMPSC 470: Compiler Construction

CMPSC 470: Compiler Construction CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.

More information

Illumination and Shading

Illumination and Shading Illumintion nd hding In order to produce relistic imges, we must simulte the ppernce of surfces under vrious lighting conditions. Illumintion models: given the illumintion incident t point on surfce, wht

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016

Applied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016 Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore

More information

The Nature of Light. Light is a propagating electromagnetic waves

The Nature of Light. Light is a propagating electromagnetic waves The Nture of Light Light is propgting electromgnetic wves Index of Refrction n: In mterils, light intercts with toms/molecules nd trvels slower thn it cn in vcuum, e.g., vwter The opticl property of trnsprent

More information

AVolumePreservingMapfromCubetoOctahedron

AVolumePreservingMapfromCubetoOctahedron Globl Journl of Science Frontier Reserch: F Mthemtics nd Decision Sciences Volume 18 Issue 1 Version 1.0 er 018 Type: Double Blind Peer Reviewed Interntionl Reserch Journl Publisher: Globl Journls Online

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Angle Properties in Polygons. Part 1 Interior Angles

Angle Properties in Polygons. Part 1 Interior Angles 2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

Stack. A list whose end points are pointed by top and bottom

Stack. A list whose end points are pointed by top and bottom 4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

Math 17 - Review. Review for Chapter 12

Math 17 - Review. Review for Chapter 12 Mth 17 - eview Ying Wu eview for hpter 12 1. Given prmetric plnr curve x = f(t), y = g(t), where t b, how to eliminte the prmeter? (Use substitutions, or use trigonometry identities, etc). How to prmeterize

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

Pipeline Example: Cycle 1. Pipeline Example: Cycle 2. Pipeline Example: Cycle 4. Pipeline Example: Cycle 3. 3 instructions. 3 instructions.

Pipeline Example: Cycle 1. Pipeline Example: Cycle 2. Pipeline Example: Cycle 4. Pipeline Example: Cycle 3. 3 instructions. 3 instructions. ipeline Exmple: Cycle 1 ipeline Exmple: Cycle X X/ /W X X/ /W $3,$,$1 lw $,0($5) $3,$,$1 3 instructions 8 9 ipeline Exmple: Cycle 3 ipeline Exmple: Cycle X X/ /W X X/ /W sw $6,($7) lw $,0($5) $3,$,$1 sw

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Rasterization. Curves and Surfaces. From Vertices to Fragments Clipping. OpenGL Pixel Manipulation Methods

Rasterization. Curves and Surfaces. From Vertices to Fragments Clipping. OpenGL Pixel Manipulation Methods Curves nd Surfces Dr. Alexnder G. Gee Rsteriztion From Vertices to Frgments Clipping Lines Polygon OpenGL Pixel Mnipultion Methods Lines Polygon Rsteriztion Hidden-Surfce Removl Antilising pge 2 1 Required

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes

Page 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S

More information

8.2 Areas in the Plane

8.2 Areas in the Plane 39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to

More information

Topic 3: 2D Transformations 9/10/2016. Today s Topics. Transformations. Lets start out simple. Points as Homogeneous 2D Point Coords

Topic 3: 2D Transformations 9/10/2016. Today s Topics. Transformations. Lets start out simple. Points as Homogeneous 2D Point Coords Tody s Topics 3. Trnsformtions in 2D 4. Coordinte-free geometry 5. (curves & surfces) Topic 3: 2D Trnsformtions 6. Trnsformtions in 3D Simple Trnsformtions Homogeneous coordintes Homogeneous 2D trnsformtions

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

PROBLEM OF APOLLONIUS

PROBLEM OF APOLLONIUS PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Basics of Logic Design Arithmetic Logic Unit (ALU)

Basics of Logic Design Arithmetic Logic Unit (ALU) Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building

More information

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X 4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414

Class Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414 Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro

More information

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved

Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

Announcements. Tutorial this week Life of the polygon A1 theory questions

Announcements. Tutorial this week Life of the polygon A1 theory questions Announcements Assignment programming (due Frida) submission directories are ied use (submit -N Ab cscd88 a_solution.tgz) theor will be returned (Wednesda) Midterm Will cover all o the materials so ar including

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Naming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you.

Naming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you. Nming 3D ojects 1 Nme the 3D ojects lelled in these models. Use the word nk to help you. Word nk cue prism sphere cone cylinder pyrmid D A C F A B C D cone cylinder cue cylinder E B E prism F cue G G pyrmid

More information

Page 1. Area-Subdivision Algorithms z-buffer Algorithm List Priority Algorithms BSP (Binary Space Partitioning Tree) Scan-line Algorithms

Page 1. Area-Subdivision Algorithms z-buffer Algorithm List Priority Algorithms BSP (Binary Space Partitioning Tree) Scan-line Algorithms Visible Surface Determination Visibility Culling Area-Subdivision Algorithms z-buffer Algorithm List Priority Algorithms BSP (Binary Space Partitioning Tree) Scan-line Algorithms Divide-and-conquer strategy:

More information

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>

12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number> DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Rigid Body Transformations

Rigid Body Transformations igid od Kinemtics igid od Trnsformtions Vij Kumr igid od Kinemtics emrk out Nottion Vectors,,, u, v, p, q, Potentil for Confusion! Mtrices,, C, g, h, igid od Kinemtics The vector nd its skew smmetric mtri

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

called the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola.

called the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola. Review of conic sections Conic sections re grphs of the form REVIEW OF CONIC SECTIONS prols ellipses hperols P(, ) F(, p) O p =_p REVIEW OF CONIC SECTIONS In this section we give geometric definitions

More information