CS-184: Computer Graphics. Today
|
|
- Annabella Summers
- 5 years ago
- Views:
Transcription
1 CS-184: Computer Grphics Lecture #10: Clippin n Hien Surces Pro. Jmes O Brien University o Cliorni, Berkeley V2006-F Toy Clippin Clippin to view volume Clippin ritrry polyons Hien Surce Removl Z-Buer BSP Trees Others 2
2 Clippin Stu outsie view volume shoul not e rwn Too close: oscures view 3 Clippin Stu outsie view volume shoul not e rwn Too close: oscures view Too r: Complexity Z-uer prolems Too hih/low/riht/let: Memory errors Broken lorithms Complexity 4
3 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) Line/plne tht clips it ˆn x ˆn r = 0 ˆn r 5 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) Line/plne tht clips it ˆn x = 0 ˆn 6
4 Clippin Line to Line/Plne Line sement to e clippe x(t) = +t( ) } Line/plne tht clips it ˆn x = 0 ˆn ( +t( )) = 0 ˆn +t(ˆn ( )) = 0 ˆn t = ˆn ˆn 6 Clippin Line to Line/Plne Sement my e on one sie t [0...1] Lines my e prllel ˆn = 0 ˆn t = ˆn ˆn 7
5 Clippin Line to Line/Plne Sement my e on one sie t [0...1] ˆn Lines my e prllel ˆn = 0 ˆn! t = ˆn ˆn (Recll comments out numericl issues) 7 Polyon Clip to Convex Domin Convex omin eine y collection o plnes (or lines or hyper-plnes) Plnes hve outwr pointin normls Clip inst ech plne in turn Check or erly/trivil rejection 8
6 Polyon Clip to Convex Domin 9 Polyon Clip to Convex Domin Insie Outsie Insie Outsie Insie Outsie Insie Outsie s p p i s p s i p s Output p Output i No output Output i n p 10
7 Polyon Clip to Convex Domin Sutherln-Homn lorithm Bsiclly ee wlkin Clippin one oten... shoul e eicient Lin-Brsky prmetric spce lorithm See text or clippin in 4D homoenize coorintes 11 Generl Polyon Clippin A B A B B A A B A B 12
8 Generl Polyon Clippin Weiler Alorithm Doule ees 13 Hien Surce Removl True 3D to 2D projection woul put every thin overlppin into the view plne. We nee to etermine wht s in ront n isply only tht. 14
9 Z-Buers A extr epth chnnel to ime Write Z vlues when writin pixels Test Z vlues eore writin Imes rom Okn Arikn 15 Z-Buers Beneits Esy to implement Works or most ny eometric primitive Prllel opertion in hrwre Limittions Quntiztion n lisin rticts Overill Trnsprency oes not work well 16
10 Z-Buers Trnsprency requires prtil sortin: Prtilly trnsprent 3r Front Prtilly trnsprent 1st Opque 2n Opque 3r Opque 1st Opque 2n Goo Not Goo 17 Z-Buers Recll epth-vlue istortions. It s eture...! More resolution ner viewer! Best use o limite precision 18
11 A-Buers Store sorte list o rments t ech pixel Drw ll opque stu irst then trnsprent Stu ehin ull opcity ets inore Nice or ntilisin Scn-line Alorithm Assume polyons on t intersect Ech time n ee is crosse etermine who s on top 20
12 Pinter s Alorithm Sort Polyons Front-to-Bck Drw in orer Bck-to-Front works lso, ut wsteul How to sort quickly? Intersectin polyons? Cycles? 21 BSP-Trees Binry Spce Prtition Trees Split spce lon plnes Allows st queries o some sptil reltions Simple construction lorithm Select plne s su-tree root Everythin on one sie to one chil Everythin on the other sie to other chil Use rnom polyon or splittin plne 22
13 BSP-Trees,,c,,e,, e c 23 BSP-Trees e,, c 2,e,, c 2 24
14 BSP-Trees e c 2,e,, c 2 25 BSP-Trees e 1 e 2 c 2 c 2 e 1, e 2, 26
15 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2, 27 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 28
16 BSP-Trees + e 1 e c c 2 e 1 e BSP-Trees Visiility Trversl Vrition o in-orer-trversl Chil one Su-tree root Chil two Select chil one se on loction o viewpoint Chil one on sme sie o su-tree root s viewpoint 29
17 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 :::::e 1 :c 2 ::e 2 30 BSP-Trees e 1 e 2 c 2 c 2 e 1 e 2 :e 2 :c 2 ::e 1 :: :: 31
CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons
CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces Prof. Jmes O Brien University of Cliforni, Berkeley V2008S101.0 1 Tody Clipping Clipping to view volume Clipping ritrry polygons Hidden Surfce
More informationCS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.
1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden
More informationToday. CS-184: Computer Graphics. Lecture #10: Clipping and Hidden Surfaces. Clipping. Hidden Surface Removal
Today CS-184: Computer Graphics Lecture #10: Clipping and Hidden Surfaces!! Prof. James O Brien University of California, Berkeley! V2015-S-10-1.0 Clipping Clipping to view volume Clipping arbitrary polygons
More informationVisibility Algorithms
Visibility Determintion Visibility Algorithms AKA, hidden surfce elimintion Roger Crwfis CIS 78 This set of slides reference slides used t Ohio Stte for instruction by Prof. Mchirju nd Prof. Hn-Wei Shen.
More informationCS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal
CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationComputer Graphics Inf4/MSc. Computer Graphics. Lecture 6 View Projection Taku Komura
Computer Graphics Lecture 6 View Projection Taku Komura 1 Overview 1. View transformation 2. Rasterisation Implementation of viewing. Transform into camera coorinates. Perform projection into view volume
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationGENG2140 Modelling and Computer Analysis for Engineers
GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationLesson 11 MA Nick Egbert
Lesson MA 62 Nick Eert Overview In this lesson we return to stndrd Clculus II mteril with res etween curves. Recll rom irst semester clculus tht the deinite interl hd eometric menin, nmel the re under
More informationMath 35 Review Sheet, Spring 2014
Mth 35 Review heet, pring 2014 For the finl exm, do ny 12 of the 15 questions in 3 hours. They re worth 8 points ech, mking 96, with 4 more points for netness! Put ll your work nd nswers in the provided
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationLecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)
Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1
More information3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull
Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron
More informationPremaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More information6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.
6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationDistance vector protocol
istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More information10.2 Graph Terminology and Special Types of Graphs
10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the
More informationHyperbolas. Definition of Hyperbola
CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationObjective: Students will understand what it means to describe, graph and write the equation of a parabola. Parabolas
Pge 1 of 8 Ojective: Students will understnd wht it mens to descrie, grph nd write the eqution of prol. Prols Prol: collection of ll points P in plne tht re the sme distnce from fixed point, the focus
More informationStained Glass Design. Teaching Goals:
Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to
More informationPrairie Kitchen Assembly Instructions
Please retain this information for future reference Parts List: To order replacement parts, please visit www.kidkraft.com 1 2 3 4 5 6 7 17 10 12 18 19 8 9 11 13 20 14 15 16 21 23 22 24 25 26 28 27 29 30
More informationLecture 7: Integration Techniques
Lecture 7: Integrtion Techniques Antiderivtives nd Indefinite Integrls. In differentil clculus, we were interested in the derivtive of given rel-vlued function, whether it ws lgeric, eponentil or logrithmic.
More informationMidterm I Solutions CS164, Spring 2006
Midterm I Solutions CS164, Spring 2006 Februry 23, 2006 Plese red ll instructions (including these) crefully. Write your nme, login, SID, nd circle the section time. There re 8 pges in this exm nd 4 questions,
More information1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)
Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric
More information6.2 Volumes of Revolution: The Disk Method
mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationAnswer Key Lesson 6: Workshop: Angles and Lines
nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power
More informations1 s2 d B (F/D.IR.RS1 == D/X.IR.RD) (F/D.IR.RS2 == D/X.IR.RD) (F/D.IR.RS1 == X/M.IR.RD) (F/D.IR.RS2 == X/M.IR.RD) = 1 = 1
Hrwre Interlock Exmple: cycle Hrwre Interlock Exmple: cycle ile s s / / / t em / ile s s / / / t em / nop nop hzr hzr $,$,$ $,$,$ (/..R == /..R) (/..R == /..R) (/..R == /..R) (/..R == /..R) = (/..R ==
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More information2. What are the types of diffraction and give the differences between them? (June 2005, June 2011)
UNIT-1 b DIFFRACTION Diffrction:A) Distinction between Fresnel nd Frunhofer diffrction, B) diffrction due to single slit, N-slits,C) Diffrction grting experiment. 1 A) Distinction between Fresnel nd Frunhofer
More informationbinary trees, expression trees
COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationMore Raster Line Issues. Bresenham Circles. Once More: 8-Pt Symmetry. Only 1 Octant Needed. Spring 2013 CS5600
Spring 03 Lecture Set 3 Bresenham Circles Intro to Computer Graphics From Rich Riesenfel Spring 03 More Raster Line Issues Fat lines with multiple pixel with Symmetric lines n point geometry how shoul
More informationProduct of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials
Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,
More information5 ANGLES AND POLYGONS
5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.
More informationSection 3.2: Arithmetic Sequences and Series
Sectio 3.: Arithmetic Sequeces Series Arithmetic Sequeces Let s strt out with efiitio: rithmetic sequece: sequece i which the ext term is fou by ig costt (the commo ifferece ) to the previous term Here
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationsuch that the S i cover S, or equivalently S
MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationCMPSC 470: Compiler Construction
CMPSC 47: Compiler Construction Plese complete the following: Midterm (Type A) Nme Instruction: Mke sure you hve ll pges including this cover nd lnk pge t the end. Answer ech question in the spce provided.
More informationIllumination and Shading
Illumintion nd hding In order to produce relistic imges, we must simulte the ppernce of surfces under vrious lighting conditions. Illumintion models: given the illumintion incident t point on surfce, wht
More informationIf f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.
Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the
More informationApplied Databases. Sebastian Maneth. Lecture 13 Online Pattern Matching on Strings. University of Edinburgh - February 29th, 2016
Applied Dtses Lecture 13 Online Pttern Mtching on Strings Sestin Mneth University of Edinurgh - Ferury 29th, 2016 2 Outline 1. Nive Method 2. Automton Method 3. Knuth-Morris-Prtt Algorithm 4. Boyer-Moore
More informationThe Nature of Light. Light is a propagating electromagnetic waves
The Nture of Light Light is propgting electromgnetic wves Index of Refrction n: In mterils, light intercts with toms/molecules nd trvels slower thn it cn in vcuum, e.g., vwter The opticl property of trnsprent
More informationAVolumePreservingMapfromCubetoOctahedron
Globl Journl of Science Frontier Reserch: F Mthemtics nd Decision Sciences Volume 18 Issue 1 Version 1.0 er 018 Type: Double Blind Peer Reviewed Interntionl Reserch Journl Publisher: Globl Journls Online
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationAngle Properties in Polygons. Part 1 Interior Angles
2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationCompilers Spring 2013 PRACTICE Midterm Exam
Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs
More informationEXPONENTIAL & POWER GRAPHS
Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationFinite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
More informationA Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards
A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin
More informationQuiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex
Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)
More informationMath 17 - Review. Review for Chapter 12
Mth 17 - eview Ying Wu eview for hpter 12 1. Given prmetric plnr curve x = f(t), y = g(t), where t b, how to eliminte the prmeter? (Use substitutions, or use trigonometry identities, etc). How to prmeterize
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationPipeline Example: Cycle 1. Pipeline Example: Cycle 2. Pipeline Example: Cycle 4. Pipeline Example: Cycle 3. 3 instructions. 3 instructions.
ipeline Exmple: Cycle 1 ipeline Exmple: Cycle X X/ /W X X/ /W $3,$,$1 lw $,0($5) $3,$,$1 3 instructions 8 9 ipeline Exmple: Cycle 3 ipeline Exmple: Cycle X X/ /W X X/ /W sw $6,($7) lw $,0($5) $3,$,$1 sw
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More informationRasterization. Curves and Surfaces. From Vertices to Fragments Clipping. OpenGL Pixel Manipulation Methods
Curves nd Surfces Dr. Alexnder G. Gee Rsteriztion From Vertices to Frgments Clipping Lines Polygon OpenGL Pixel Mnipultion Methods Lines Polygon Rsteriztion Hidden-Surfce Removl Antilising pge 2 1 Required
More information50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:
5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )
More informationEngineer To Engineer Note
Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit
More informationPage 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes
Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S
More information8.2 Areas in the Plane
39 Chpter 8 Applictions of Definite Integrls 8. Ares in the Plne Wht ou will lern out... Are Between Curves Are Enclosed Intersecting Curves Boundries with Chnging Functions Integrting with Respect to
More informationTopic 3: 2D Transformations 9/10/2016. Today s Topics. Transformations. Lets start out simple. Points as Homogeneous 2D Point Coords
Tody s Topics 3. Trnsformtions in 2D 4. Coordinte-free geometry 5. (curves & surfces) Topic 3: 2D Trnsformtions 6. Trnsformtions in 3D Simple Trnsformtions Homogeneous coordintes Homogeneous 2D trnsformtions
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationPROBLEM OF APOLLONIUS
PROBLEM OF APOLLONIUS In the Jnury 010 issue of Amerin Sientist D. Mkenzie isusses the Apollonin Gsket whih involves fining the rius of the lrgest irle whih just fits into the spe etween three tngent irles
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationa(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X
4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationClass Overview. Database Design. Database Design Process. Database Design. Introduction to Data Management CSE 414
Introution to Dt Mngement CSE 44 Unit 6: Coneptul Design E/R Digrms Integrity Constrints BCNF Introution to Dt Mngement CSE 44 E/R Digrms ( letures) CSE 44 Autumn 08 Clss Overview Dtse Design Unit : Intro
More informationNetwork Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed
More informationx )Scales are the reciprocal of each other. e
9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.
More informationAnnouncements. Tutorial this week Life of the polygon A1 theory questions
Announcements Assignment programming (due Frida) submission directories are ied use (submit -N Ab cscd88 a_solution.tgz) theor will be returned (Wednesda) Midterm Will cover all o the materials so ar including
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationNaming 3D objects. 1 Name the 3D objects labelled in these models. Use the word bank to help you.
Nming 3D ojects 1 Nme the 3D ojects lelled in these models. Use the word nk to help you. Word nk cue prism sphere cone cylinder pyrmid D A C F A B C D cone cylinder cue cylinder E B E prism F cue G G pyrmid
More informationPage 1. Area-Subdivision Algorithms z-buffer Algorithm List Priority Algorithms BSP (Binary Space Partitioning Tree) Scan-line Algorithms
Visible Surface Determination Visibility Culling Area-Subdivision Algorithms z-buffer Algorithm List Priority Algorithms BSP (Binary Space Partitioning Tree) Scan-line Algorithms Divide-and-conquer strategy:
More information12 <= rm <digit> 2 <= rm <no> 2 <= rm <no> <digit> <= rm <no> <= rm <number>
DDD16 Compilers nd Interpreters DDB44 Compiler Construction R Prsing Prt 1 R prsing concept Using prser genertor Prse ree Genertion Wht is R-prsing? eft-to-right scnning R Rigthmost derivtion in reverse
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationRigid Body Transformations
igid od Kinemtics igid od Trnsformtions Vij Kumr igid od Kinemtics emrk out Nottion Vectors,,, u, v, p, q, Potentil for Confusion! Mtrices,, C, g, h, igid od Kinemtics The vector nd its skew smmetric mtri
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationcalled the vertex. The line through the focus perpendicular to the directrix is called the axis of the parabola.
Review of conic sections Conic sections re grphs of the form REVIEW OF CONIC SECTIONS prols ellipses hperols P(, ) F(, p) O p =_p REVIEW OF CONIC SECTIONS In this section we give geometric definitions
More information