CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal

Size: px
Start display at page:

Download "CS 551 Computer Graphics. Hidden Surface Elimination. Z-Buffering. Basic idea: Hidden Surface Removal"

Transcription

1 CS 55 Computer Grphis Hidden Surfe Removl Hidden Surfe Elimintion Ojet preision lgorithms: determine whih ojets re in front of others Uses the Pinter s lgorithm drw visile surfes from k (frthest) to front (nerest) Resize doesn t require relultion Works for stti senes Methods: k-fe ulling, depth-sort, BSP tree Imge preision lgorithms: determine whih ojet is visile t eh pixel Resize requires relultion Works for dynmi senes Methods: z-uffering, ry tring Z-Buffering Imge preision lgorithm: Determine whih ojet is visile t eh pixel Order of polygons not ritil Works for dynmi senes Bsi ide: Rsterize (sn-onvert) eh polygon Keep trk of z vlue t eh pixel - Interpolte z vlue of polygon verties during rsteriztion Reple pixel with new olor if z vlue is smller (i.e., if ojet is loser to eye)

2 Z-Buffering: lgorithm llote z-uffer; // llote depth uffer Sme size s viewport. for eh pixel (x,y) // For eh pixel in viewport. writepixel(x,y,kgrnd); // Initilize olor. writedepth(x,y,frplne); // Initilize depth (z) uffer. for eh polygon // Drw eh polygon (in ny order). for eh pixel (x,y) in polygon // Rsterize polygon. p z = polygon s z-vlue t (x,y); // Interpolte z-vlue t (x, y). if (p z < z-uffer(x,y)) // If new depth is loser: writepixel(x,y,olor); // Write new (polygon) olor. writedepth(x,y,p z ); // Write new depth. Note: This ssumes you ve negted the z vlues! Z-Buffering: Exmple = = = = 5 5 Colors R R R R R G G G G R Depths

3 Z-Buffering: Computing Z How do you ompute the z vlue t given pixel? Sme wy you do for olor Interpolte from verties Wht is the z vlue t vertex? Cnnot use stright z vlue prior to perspetive divide Cnnot use simple perspetive projetion: - ll points re ompressed onto the view plne Need to use one of the nonil z vlues B Hs the form: z = z z Use /z where z is fter the viewing trnsform ut efore the perspetive trnsform Z-Buffering: Computing Z /Z Demo Let x = [.0,.0,.0,.0,.0,.0,.0,.0]; Let z = [-0.0, -0.0, -0.0, -0.0, -50.0, -60.0, -70.0, ]; ner = -.0 fr = Projet x nd z using projetion equtions Grph x vs. z world ND x vs. z-projeted (/z) Z-Buffering: Computing Z x vs z n x = x z x vs. z n y = y z fn z = n f z h =

4 Z-Buffering : Summry dvntges: Esy to implement in hrdwre (nd softwre!) Fst with hrdwre support Fst depth uffer memory Hrdwre supported Proess polygons in ritrry order Hndles polygon interpenetrtion trivilly Disdvntges: Lots of memory for z-uffer: - Integer depth vlues - Sn-line lgorithm Prone to lising - Super-smpling Overhed in z-heking: requires fst memory Bk-Fe Culling Don t drw surfes fing wy from viewpoint: ssumes ojets re solid polyhedr - Usully omined with dditionl method(s) Compute polygon norml n: - ssume ounter-lokwise vertex order (when n pointing towrds you) - For tringle (,, ): n = ( ) ( ) Compute vetor from viewpoint to ny point p on polygon v: - For orthogrphi projetion: v = [0 0 ] T - For perspetive projetion: v = p - eye Fing wy (don t drw) if ngle etween n nd v is less thn 90 dot produt n v > 0 z n x (or y) Pinter s lgorithm Drw surfes from k (frthest wy) to front (losest): Sort surfes/polygons y their depth (z vlue) Drw ojets in order (frthest to losest) Closer ojets pint over the top of frther wy ojets Need speil proessing if polygons overlp in depth

5 Binry Spe Prtition (BSP) Tree Reursively sudivide spe to determine depth order: Think of sene s lusters of ojets Find plne tht seprtes two lusters Cluster on sme side of plne s viewpoint n osure, ut nnot e osured y, luster on other side of plne Reursively sudivide lusters y finding pproprite plnes Store sudivision (spe-prtioning) plnes in inry tree - Node: tringle nd spe prtioning plne - Left (right) hild: sutree of ojets on negtive (positive) side of plne Very effiient for stti senes New viewpoints lulted quikly BSP Trees: Bsi Ide t t In the plne (= 0) eye Behind the plne ( side) In front of the plne ( side) BSP Trees: Bsi Ide (ont.) ssume (for now) the polygons do not ross the plne Let f (p) e the impliit eqution of plne evluted t p t t In the plne eye if (f t (eye)< 0) then drw t drw t else drw t drw t Behind the plne Works for ny eye point!! 5

6 BSP lgorithm BSP Tree: prtitions spe into positive nd negtive sides Node: tringle nd spe prtioning plne Left (right) hild: sutree of ojets on negtive (positive) side of plne Use modified in-order trversl to drw the sene: Strt nd root Compute whih side of node s plne eye is on Reursively sn onvert polygons on opposite side s eye Sn onvert node s polygon Reursively sn onvert polygons on sme side s eye eye Root polygon BSP lgorithm (ont.) eye Root polygon drw(tree, eye) { if (tree.empty()) then return; if (tree.f plne (eye) < 0) then drw(tree.plus, eye); rsterize(tree.tringle); drw(tree.minus, eye) else drw(tree.minus, eye); rsterize(tree.tringle); drw(tree.plus, eye); } Resulting drwing order:,,, Building the Tree: Plne Eqution Impliit eqution of plne f plne (p) = ( ) ( ) (p ) More fmilir formultion: ssumes onsistent f plne (p) = x By Cz D = 0 vertex ordering where [BC] T represents the norml vetor n to the plne n = ( ) ( ) Solve for D y plugging in point D = x By Cz = n So: f plne (p) = (n p) (n ) = n (p ) 6

7 Building the Tree: Psuedo-Code uildtree() { tree = node(t ); // Crete root of tree. for (i = to N) do // dd eh tringle to tree. tree.dd(t i ); } dd(tringle t) { f = f plne (t.); // Compute whih side of plne f = f plne (t.); // eh vertex is on. f = f plne (t.); if (f 0 nd f 0 nd f 0) // If ll verties on negtive side if (minus.empty()) minus = node(t); // dd t to minus side. else minus.dd(t) else if (f 0 nd f 0 nd f 0) // If ll verties on positive side.... // dd t to plus side else... } // Wht do we do here? Cutting Tringles Plne If tringle intersets plne Split B Must mintin sme vertex ordering so they ll keep the sme norml! t Plne t t B t =(,, ) t = (, B, ) t = (, B, ) Cutting Tringles (ont.) ssume we ve isolted on one side of plne nd tht f plne () > 0, then: dd t nd t to negtive sutree: minus.dd(t ) minus.dd(t ) dd t to positive sutree: plus.dd(t ) t Plne t t B t =(,, ) t = (, B, ) t = (, B, ) 7

8 Cutting Tringles (ont.) How do we find nd B? : intersetion of line etween nd with the plne f plne Use prmetri form of line: p(t) = t( ) Plug p into the plne eqution for the tringle: f plne (p) = (n p) D = n ( t( )) D Solve for t nd plug k into p(t) to get ( n ) D t = n ( ) Repet for B B We will use sme formul in ry tring!! Cutting Tringles (ont.) Wht if is not isolted? if (f * f 0) // If nd on sme side: ->; ->; ->; // Shift verties lokwise. else if (f * f 0) // If nd on sme side: ->; ->; ->; // Shift verties ounter-lokwise. Note: ug in the ook here! plne plne plne ssumes onsistent, ounter-lokwise ordering of verties Cutting Tringles: Complete lgorithm if (f * f 0) // If nd on sme side: ->; ->; ->; // Shift verties lokwise. else if (f * f 0) // If nd on sme side: ->; ->; ->; // Shift verties ounter-lokwise. // Now is isolted on one side of the plne. ompute,b; // Compute intersetions points. t = (,,); // Crete su-tringles. t = (,B,); t = (,B,); if (f plne () 0) // dd su-tringles to tree. minus.dd(t ); minus.dd(t ); plus.dd(t ); else plus.dd(t ); plus.dd(t ); minus.dd(t ); 8

9 BSP Trees: Summry How do you pik the first tringle? Tril nd error Pik few permuttions t rndom nd try them out It s pre-proess: don t worry muh out uild speed O(N) trversl on verge Cn e worse sine it retes more tringles! Eye n e pled nywhere No prolems with resizing BSP Trees: pplitions Originlly developed for hidden surfe determintion However, rrely used for this purpose now How else might we use BSP tree? Visiility ulling Ry tring Dynmi Senes Collisions BSP Trees: Representtion Our originl representtion put polygons t internl nd lef nodes eye Root polygon We n lso store polygons t lef nodes only. The BSP tree then eomes sptil sudivision dt struture 9

10 BSP Trees: Sptil Sudivision Our originl representtion put polygons t internl nd lef nodes - B eye E Root dividing plne D C E D B C We n lso store polygons t lef nodes only. The BSP tree then eomes sptil sudivision dt struture BSP Trees: View Culling Compre the frustum to the split plne If it s on one side, you n ompletely ignore the other! - BSP Trees: Sptil Suidivion- dyn. sene Wht if the sene is hnging? Ie. hrter is moving out the environment? ssume the hrter is point point CNNOT interset plne so it s either in front or ehind dd the hrter to the BSP tree - Fst only requires omprisons to the root node until you reh lef Modified in-order trversl results in the sene with the hrter drwn ppropritely wrt. the sene. 0

11 BSP Tree: Clrifition We dont relly re out lning Why? We hve to hit every node nywys to render so it s O(N) on verge whether lned or not - t lest when we re using it for k to front rendering We DO re out polygon splits good BSP tree is one tht doesn t rete lots of splits! BSP Trees & ZBuffer Initil Quke engine used BSP trees for front to k rendering Lter modified to omine BSP with Zuffer BSP the stti prt of the world When rendering, keep /z vlues (only need to write the zuffer, no heking neessry) When render the hrter lst nd z-uffer it

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons

CS-184: Computer Graphics. Today. Clipping. Hidden Surface Removal. Tuesday, October 7, Clipping to view volume Clipping arbitrary polygons CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces Prof. Jmes O Brien University of Cliforni, Berkeley V2008S101.0 1 Tody Clipping Clipping to view volume Clipping ritrry polygons Hidden Surfce

More information

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014.

CS-184: Computer Graphics. Today. Lecture #10: Clipping and Hidden Surfaces ClippingAndHidden.key - October 27, 2014. 1 CS184: Computer Grphics Lecture #10: Clipping nd Hidden Surfces!! Prof. Jmes O Brien University of Cliforni, Berkeley! V2013F101.0 Tody 2 Clipping Clipping to view volume Clipping ritrry polygons Hidden

More information

CS 241 Week 4 Tutorial Solutions

CS 241 Week 4 Tutorial Solutions CS 4 Week 4 Tutoril Solutions Writing n Assemler, Prt & Regulr Lnguges Prt Winter 8 Assemling instrutions utomtilly. slt $d, $s, $t. Solution: $d, $s, nd $t ll fit in -it signed integers sine they re 5-it

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved.

Chapter 9. Greedy Technique. Copyright 2007 Pearson Addison-Wesley. All rights reserved. Chpter 9 Greey Tehnique Copyright 2007 Person Aison-Wesley. All rights reserve. Greey Tehnique Construts solution to n optimiztion prolem piee y piee through sequene of hoies tht re: fesile lolly optiml

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Lesson 4.4. Euler Circuits and Paths. Explore This

Lesson 4.4. Euler Circuits and Paths. Explore This Lesson 4.4 Euler Ciruits nd Pths Now tht you re fmilir with some of the onepts of grphs nd the wy grphs onvey onnetions nd reltionships, it s time to egin exploring how they n e used to model mny different

More information

Last Time? Ray Casting II. Explicit vs. Implicit? Assignment 1: Ray Casting. Object-Oriented Design. Graphics Textbooks

Last Time? Ray Casting II. Explicit vs. Implicit? Assignment 1: Ray Casting. Object-Oriented Design. Graphics Textbooks Csting II Lst Time? Csting / Tring Orthogrphi Cmer epresenttion (t) = origin + t * diretion -Sphere Intersetion -lne Intersetion Impliit vs. Epliit epresenttions MIT EECS 6.837, Cutler nd Durnd 1 MIT EECS

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

CS553 Lecture Introduction to Data-flow Analysis 1

CS553 Lecture Introduction to Data-flow Analysis 1 ! Ide Introdution to Dt-flow nlysis!lst Time! Implementing Mrk nd Sweep GC!Tody! Control flow grphs! Liveness nlysis! Register llotion CS553 Leture Introdution to Dt-flow Anlysis 1 Dt-flow Anlysis! Dt-flow

More information

EXPONENTIAL & POWER GRAPHS

EXPONENTIAL & POWER GRAPHS Eponentil & Power Grphs EXPONENTIAL & POWER GRAPHS www.mthletics.com.u Eponentil EXPONENTIAL & Power & Grphs POWER GRAPHS These re grphs which result from equtions tht re not liner or qudrtic. The eponentil

More information

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral

Doubts about how to use azimuth values from a Coordinate Object. Juan Antonio Breña Moral Douts out how to use zimuth vlues from Coordinte Ojet Jun Antonio Breñ Morl # Definition An Azimuth is the ngle from referene vetor in referene plne to seond vetor in the sme plne, pointing towrd, (ut

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

CS453 INTRODUCTION TO DATAFLOW ANALYSIS

CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 INTRODUCTION TO DATAFLOW ANALYSIS CS453 Leture Register llotion using liveness nlysis 1 Introdution to Dt-flow nlysis Lst Time Register llotion for expression trees nd lol nd prm vrs Tody Register

More information

Introduction to Algebra

Introduction to Algebra INTRODUCTORY ALGEBRA Mini-Leture 1.1 Introdution to Alger Evlute lgeri expressions y sustitution. Trnslte phrses to lgeri expressions. 1. Evlute the expressions when =, =, nd = 6. ) d) 5 10. Trnslte eh

More information

Problem Final Exam Set 2 Solutions

Problem Final Exam Set 2 Solutions CSE 5 5 Algoritms nd nd Progrms Prolem Finl Exm Set Solutions Jontn Turner Exm - //05 0/8/0. (5 points) Suppose you re implementing grp lgoritm tt uses ep s one of its primry dt strutures. Te lgoritm does

More information

10.2 Graph Terminology and Special Types of Graphs

10.2 Graph Terminology and Special Types of Graphs 10.2 Grph Terminology n Speil Types of Grphs Definition 1. Two verties u n v in n unirete grph G re lle jent (or neighors) in G iff u n v re enpoints of n ege e of G. Suh n ege e is lle inient with the

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V)

V = set of vertices (vertex / node) E = set of edges (v, w) (v, w in V) Definitions G = (V, E) V = set of verties (vertex / noe) E = set of eges (v, w) (v, w in V) (v, w) orere => irete grph (igrph) (v, w) non-orere => unirete grph igrph: w is jent to v if there is n ege from

More information

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam

MITSUBISHI ELECTRIC RESEARCH LABORATORIES Cambridge, Massachusetts. Introduction to Matroids and Applications. Srikumar Ramalingam Cmrige, Msshusetts Introution to Mtrois n Applitions Srikumr Rmlingm MERL mm//yy Liner Alger (,0,0) (0,,0) Liner inepenene in vetors: v, v2,..., For ll non-trivil we hve s v s v n s, s2,..., s n 2v2...

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Calculus Differentiation

Calculus Differentiation //007 Clulus Differentition Jeffrey Seguritn person in rowot miles from the nerest point on strit shoreline wishes to reh house 6 miles frther down the shore. The person n row t rte of mi/hr nd wlk t rte

More information

COMP108 Algorithmic Foundations

COMP108 Algorithmic Foundations Grph Theory Prudene Wong http://www.s.liv..uk/~pwong/tehing/omp108/201617 How to Mesure 4L? 3L 5L 3L ontiner & 5L ontiner (without mrk) infinite supply of wter You n pour wter from one ontiner to nother

More information

Distance Computation between Non-convex Polyhedra at Short Range Based on Discrete Voronoi Regions

Distance Computation between Non-convex Polyhedra at Short Range Based on Discrete Voronoi Regions Distne Computtion etween Non-onvex Polyhedr t Short Rnge Bsed on Disrete Voronoi Regions Ktsuki Kwhi nd Hiroms Suzuki Deprtment of Preision Mhinery Engineering, The University of Tokyo 7-3-1 Hongo, Bunkyo-ku,

More information

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP

Outline. Motivation Background ARCH. Experiment Additional usages for Input-Depth. Regular Expression Matching DPI over Compressed HTTP ARCH This work ws supported y: The Europen Reserh Counil, The Isreli Centers of Reserh Exellene, The Neptune Consortium, nd Ntionl Siene Foundtion wrd CNS-119748 Outline Motivtion Bkground Regulr Expression

More information

Lecture 13: Graphs I: Breadth First Search

Lecture 13: Graphs I: Breadth First Search Leture 13 Grphs I: BFS 6.006 Fll 2011 Leture 13: Grphs I: Bredth First Serh Leture Overview Applitions of Grph Serh Grph Representtions Bredth-First Serh Rell: Grph G = (V, E) V = set of verties (ritrry

More information

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull

3D convex hulls. Convex Hull in 3D. convex polyhedron. convex polyhedron. The problem: Given a set P of points in 3D, compute their convex hull Convex Hull in The rolem: Given set P of oints in, omute their onvex hull onvex hulls Comuttionl Geometry [si 3250] Lur Tom Bowoin College onvex olyheron 1 2 3 olygon olyheron onvex olyheron 4 5 6 Polyheron

More information

Convex Hull Algorithms. Convex hull: basic facts

Convex Hull Algorithms. Convex hull: basic facts CG Leture D Conve Hull Algorithms Bsi fts Algorithms: Nïve, Gift wrpping, Grhm sn, Quik hull, Divide-nd-onquer Lower ound 3D Bsi fts Algorithms: Gift wrpping, Divide nd onquer, inrementl Conve hulls in

More information

CS-184: Computer Graphics. Today

CS-184: Computer Graphics. Today CS-184: Computer Grphics Lecture #10: Clippin n Hien Surces Pro. Jmes O Brien University o Cliorni, Berkeley V2006-F-10-1.0 Toy Clippin Clippin to view volume Clippin ritrry polyons Hien Surce Removl Z-Buer

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

Greedy Algorithm. Algorithm Fall Semester

Greedy Algorithm. Algorithm Fall Semester Greey Algorithm Algorithm 0 Fll Semester Optimiztion prolems An optimiztion prolem is one in whih you wnt to fin, not just solution, ut the est solution A greey lgorithm sometimes works well for optimiztion

More information

Can Pythagoras Swim?

Can Pythagoras Swim? Overview Ativity ID: 8939 Mth Conepts Mterils Students will investigte reltionships etween sides of right tringles to understnd the Pythgoren theorem nd then use it to solve prolems. Students will simplify

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

ITEC2620 Introduction to Data Structures

ITEC2620 Introduction to Data Structures ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book

Final Exam Review F 06 M 236 Be sure to look over all of your tests, as well as over the activities you did in the activity book inl xm Review 06 M 236 e sure to loo over ll of your tests, s well s over the tivities you did in the tivity oo 1 1. ind the mesures of the numered ngles nd justify your wor. Line j is prllel to line.

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

Distance vector protocol

Distance vector protocol istne vetor protool Irene Finohi finohi@i.unirom.it Routing Routing protool Gol: etermine goo pth (sequene of routers) thru network from soure to Grph strtion for routing lgorithms: grph noes re routers

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

Minimal Memory Abstractions

Minimal Memory Abstractions Miniml Memory Astrtions (As implemented for BioWre Corp ) Nthn Sturtevnt University of Alert GAMES Group Ferury, 7 Tlk Overview Prt I: Building Astrtions Minimizing memory requirements Performnes mesures

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it.

6.3 Volumes. Just as area is always positive, so is volume and our attitudes towards finding it. 6.3 Volumes Just s re is lwys positive, so is volume nd our ttitudes towrds finding it. Let s review how to find the volume of regulr geometric prism, tht is, 3-dimensionl oject with two regulr fces seprted

More information

Compilers Spring 2013 PRACTICE Midterm Exam

Compilers Spring 2013 PRACTICE Midterm Exam Compilers Spring 2013 PRACTICE Midterm Exm This is full length prctice midterm exm. If you wnt to tke it t exm pce, give yourself 7 minutes to tke the entire test. Just like the rel exm, ech question hs

More information

Cameras. Importance of camera models

Cameras. Importance of camera models pture imges mesuring devie Digitl mers mers fill in memor ith olor-smple informtion D hrge-oupled Devie insted of film film lso hs finite resolution grininess depends on speed IS 00 00 6400 sie 35mm IMAX

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

9 Graph Cutting Procedures

9 Graph Cutting Procedures 9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Visibility Algorithms

Visibility Algorithms Visibility Determintion Visibility Algorithms AKA, hidden surfce elimintion Roger Crwfis CIS 78 This set of slides reference slides used t Ohio Stte for instruction by Prof. Mchirju nd Prof. Hn-Wei Shen.

More information

Graphing Conic Sections

Graphing Conic Sections Grphing Conic Sections Definition of Circle Set of ll points in plne tht re n equl distnce, clled the rdius, from fixed point in tht plne, clled the center. Grphing Circle (x h) 2 + (y k) 2 = r 2 where

More information

MTH 146 Conics Supplement

MTH 146 Conics Supplement 105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

UT1553B BCRT True Dual-port Memory Interface

UT1553B BCRT True Dual-port Memory Interface UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl

More information

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI)

Lecture 7: Building 3D Models (Part 1) Prof Emmanuel Agu. Computer Science Dept. Worcester Polytechnic Institute (WPI) Computer Grphics (CS 4731) Lecture 7: Building 3D Models (Prt 1) Prof Emmnuel Agu Computer Science Dept. Worcester Polytechnic Institute (WPI) Stndrd d Unit itvectors Define y i j 1,0,0 0,1,0 k i k 0,0,1

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

Tiling Triangular Meshes

Tiling Triangular Meshes Tiling Tringulr Meshes Ming-Yee Iu EPFL I&C 1 Introdution Astrt When modelling lrge grphis senes, rtists re not epeted to model minute nd repetitive fetures suh s grss or snd with individul piees of geometry

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.

CS 340, Fall 2016 Sep 29th Exam 1 Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string. CS 340, Fll 2016 Sep 29th Exm 1 Nme: Note: in ll questions, the speil symol ɛ (epsilon) is used to indite the empty string. Question 1. [10 points] Speify regulr expression tht genertes the lnguge over

More information

GENG2140 Modelling and Computer Analysis for Engineers

GENG2140 Modelling and Computer Analysis for Engineers GENG4 Moelling n Computer Anlysis or Engineers Letures 9 & : Gussin qurture Crete y Grn Romn Joles, PhD Shool o Mehnil Engineering, UWA GENG4 Content Deinition o Gussin qurture Computtion o weights n points

More information

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22)

Homework. Context Free Languages III. Languages. Plan for today. Context Free Languages. CFLs and Regular Languages. Homework #5 (due 10/22) Homework Context Free Lnguges III Prse Trees nd Homework #5 (due 10/22) From textbook 6.4,b 6.5b 6.9b,c 6.13 6.22 Pln for tody Context Free Lnguges Next clss of lnguges in our quest! Lnguges Recll. Wht

More information

5 ANGLES AND POLYGONS

5 ANGLES AND POLYGONS 5 GLES POLYGOS urling rige looks like onventionl rige when it is extene. However, it urls up to form n otgon to llow ots through. This Rolling rige is in Pington sin in Lonon, n urls up every Friy t miy.

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

Agilent Mass Hunter Software

Agilent Mass Hunter Software Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss

More information

3 4. Answers may vary. Sample: Reteaching Vertical s are.

3 4. Answers may vary. Sample: Reteaching Vertical s are. Chpter 7 Answers Alterntive Activities 7-2 1 2. Check students work. 3. The imge hs length tht is 2 3 tht of the originl segment nd is prllel to the originl segment. 4. The segments pss through the endpoints

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

UNCORRECTED SAMPLE PAGES. Angle relationships and properties of 6geometrical figures 1. Online resources. What you will learn

UNCORRECTED SAMPLE PAGES. Angle relationships and properties of 6geometrical figures 1. Online resources. What you will learn Online resoures uto-mrked hpter pre-test Video demonstrtions of ll worked exmples Intertive widgets Intertive wlkthroughs Downlodle HOTsheets ess to ll HOTmths ustrlin urriulum ourses ess to the HOTmths

More information

Geometric Algorithms. Geometric Algorithms. Warning: Intuition May Mislead. Geometric Primitives

Geometric Algorithms. Geometric Algorithms. Warning: Intuition May Mislead. Geometric Primitives Geometri Algorithms Geometri Algorithms Convex hull Geometri primitives Closest pir of points Voronoi Applitions. Dt mining. VLSI design. Computer vision. Mthemtil models. Astronomil simultion. Geogrphi

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Math 142, Exam 1 Information.

Math 142, Exam 1 Information. Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012

Grade 7/8 Math Circles Geometric Arithmetic October 31, 2012 Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt

More information

Assembly & Installation Instructions: 920 CPU Holder, 920-X

Assembly & Installation Instructions: 920 CPU Holder, 920-X Assemly & Instlltion Instrutions: 920 CPU Holder, 920-X Prt Inluded, CPU Holder (ll models) A Exterior Housing B Interior Housing C Hrdwre Kit (ll models) D CPU Supporting Plte F Loking Kit (models 920-FL

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Pythagoras theorem and trigonometry (2)

Pythagoras theorem and trigonometry (2) HPTR 10 Pythgors theorem nd trigonometry (2) 31 HPTR Liner equtions In hpter 19, Pythgors theorem nd trigonometry were used to find the lengths of sides nd the sizes of ngles in right-ngled tringles. These

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

Right Angled Trigonometry. Objective: To know and be able to use trigonometric ratios in rightangled

Right Angled Trigonometry. Objective: To know and be able to use trigonometric ratios in rightangled C2 Right Angled Trigonometry Ojetive: To know nd e le to use trigonometri rtios in rightngled tringles opposite C Definition Trigonometry ws developed s method of mesuring ngles without ngulr units suh

More information

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup

COSC 6374 Parallel Computation. Communication Performance Modeling (II) Edgar Gabriel Fall Overview. Impact of communication costs on Speedup COSC 6374 Prllel Computtion Communition Performne Modeling (II) Edgr Griel Fll 2015 Overview Impt of ommunition osts on Speedup Crtesin stenil ommunition All-to-ll ommunition Impt of olletive ommunition

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information