Network Interconnection: Bridging CS 571 Fall Kenneth L. Calvert All rights reserved
|
|
|
- Janis Stevenson
- 5 years ago
- Views:
Transcription
1 Network Interconnection: Bridging CS 57 Fll 6 6 Kenneth L. Clvert All rights reserved
2 The Prolem We know how to uild (rodcst) LANs Wnt to connect severl LANs together to overcome scling limits Recll: speed of light limits on efficiency of MAC protocols Gol: mke set of interconnected LANs "look like" single, lrge LAN Ech sttion uses the sme protocol it normlly would to trnsmit to ny sttion on the extended LAN But the LANs my e different technologies (e.g. Ethernet, WiFi) Use stndrd IEEE 8 ddresses to identify destintions
3 Solution Approch We get to design specil oxes (ISs) to interconnect LANs Cll these ridges Ech ridge cts like sttion on ech LAN to which it is connected IS
4 Solution Approch We get to design specil oxes (ISs) to interconnect LANs Cll these ridges Ech ridge cts like sttion on ech LAN to which it is connected B IS A B A
5 Lerning Bridge Bridge keeps tle mpping ddresses to interfces Bridge looks t source ddresses of received pckets to populte tle Pcket with source B received on interfce indictes tht B is in tht direction Addr i/f B B IS A A B Prolem: Where is A?
6 Lerning Bridge If the destintion ddress is not in the tle Forwrd out ll interfces other thn the incoming one Reply (if ny) revels loction of destintion Addr i/f B B IS A B A
7 Lerning Bridge If the destintion ddress is not in the tle Forwrd out ll interfces other thn the incoming one Reply (if ny) revels loction of destintion B IS Addr i/f B A A B A
8 Bridge Processing For ech received frme:. Rememer the interfce it rrived on. Look up the source ddress in the tle If not present, dd (source ddr, incoming i/f) to tle 3. Look up the destintion ddress in the tle If found: trnsmit frme on the indicted interfce, if different from the incoming i/f If not found: flood, i.e. trnsmit on ll interfces except incoming Steps nd 3 cn e done in prllel Works when pths include multiple ridges Content-ddressle memory (CAM) is idel for implementing this processing
9 Advntges of Bridging Communiction on different LANs cn occur in prllel Any sttion cn rech ny other sttion s if they were connected to the sme LAN Heterogenous LANs cn e ccomodted Miniml dministrtive overhed Bridges populte tles utomticlly No dditionl ddress ssignment required
10 Issues The lerning ridge lgorithm works provided there re no cycles in the network The interconnected network topology is constrined to e tree Only one pth etween ny pir of nodes If this constrint is violted, rodcst frmes circulte forever! Drwcks of the tree topology constrint: Any ridge filure prtitions the network Cpcity limited y minimum-rte LAN Hevy trffic on strtup (when no ddresses re known)
11 Brodcst Loops B 3 A B 5
12 Roustness Solution: Spnning Tree Protocol Allow ritrry topologies Including cycles of ridges nd LANs Bridges collorte to construct spnning tree (overly) on the network Before ny pckets cn e flooded Ech ridge determines which of its interfces re prt of the tree Interfces not in the tree re not used in the forwrding lgorithm All interfces prticipte in the spnning tree lgorithm When prtition occurs, protocol djusts the spnning tree
13 Roustness Solution: Spnning Tree Protocol 3 5
14 Roustness Solution: Spnning Tree Protocol 3 No trffic forwrded over these interfces 5
15 Spnning Tree Construction. Elect root ridge Bridge with lowest ID. Ech ridge determines its shortest pth to root Interfce closest to the root is lwys prt of the tree 3. Elect "designted ridge" for ech LAN Bridge with shortest pth to root Brek ties using lowest ID. Any interfce connecting ridge to LAN for which it is designted ridge is in the tree; ny others re not
16 Spnning Tree Protocol Ech ridge mintins two glol stte vriles Root ID Distnce to Root nd one per-interfce vrile: designted ridge on this LAN Ech ridge rodcsts messges contining triples: (Who I think is root, distnce to tht root, my ID) Triples re lexicogrphiclly ordered (,7,) < (3,,5) (,,5) < (,,5) (,, ) < (,, )
17 Spnning Tree Protocol Ech ridge initilly proclims itself s root Ech ridge updtes its stte vriles sed on the smllest triples it sees Root ID := Root ID from smllest triple yet seen Distnce to Root := Distnce from smllest triple + (unless smllest triple is tht ridge's) Designted Bridge on LAN := sender of smllest triple seen on tht LAN Bridges turn off interfces not in the tree
18 Spnning Tree Protocol Exmple Root: Distnce: Des. : Des. : Distnce: Des. : Des. : 3 Root: 3 Distnce: Des. : 3 Des. : 3 Root: 5 Distnce: Des. : 5 Des. : 5 5 c Root: Distnce: Des. : Des. : Des. c: Root: Distnce: Des. : Des. :
19 Spnning Tree Protocol Exmple (,,) Root: 5 Distnce: Des. : 5 Des. : 5 (,,) (,,) (,,) 5 (,,) (5,,5) Distnce: Des. : Des. : (,,) c Root: Distnce: Des. : Des. : Des. c: Root: Distnce: Des. : Des. : (3,,3) 3 (,,) (,,) (,,) (,,) Root: 3 Distnce: Des. : 3 Des. : 3 Root: Distnce: Des. : Des. :
20 Spnning Tree Protocol Exmple (,,) Distnce: Des. : Des. : (,,) (,,) (,,) 5 (,,) (5,,5) Distnce: Des. : Des. : (,,) c Root: Distnce: Des. : Des. : Des. c: Distnce: Des. : Des. : (3,,3) 3 (,,) (,,) (,,) (,,) Root: Distnce: Des. : Des. : Root: Distnce: Des. : Des. :
21 Spnning Tree Protocol Exmple (,,) Distnce: Des. : Des. : (,,) (,,) (,,) 5 (,,5) (,,5) Distnce: Des. : Des. : (,,) c Root: Distnce: Des. : Des. : Des. c: Distnce: Des. : Des. : (,,3) 3 (,,3) (,,) (,,) (,,) Root: Distnce: Des. : Des. : Root: Distnce: Des. : Des. :
22 Spnning Tree Protocol Exmple (,,) Distnce: Des. : Des. : 5 (,,) (,,) (,,) 5 (,,5) (,,5) Distnce: Des. : Des. : (,,) c Distnce: Des. : 3 Des. : 5 Des. c: Distnce: Des. : Des. : (,,3) 3 (,,3) (,,) (,,) (,,) Distnce: Des. : Des. : 3 Root: Distnce: Des. : 3 Des. :
23 Spnning Tree Protocol Exmple (,,) Distnce: Des. : Des. : 5 (,,) (,,) (,,) 5 (,,5) (,,5) Distnce: Des. : Des. : (,,) c Distnce: Des. : Des. : 5 Des. c: Distnce: Des. : Des. : (,,3) 3 (,,) (,3,) (,,) (,,) Distnce: Des. : Des. : 3 Root: Distnce: Des. : 3 Des. :
24 Spnning Tree Protocol Exmple (,,) Distnce: Des. : Des. : 5 (,,) (,,) (,,) 5 (,,5) (,,5) Distnce: Des. : Des. : (,,) c Distnce: Des. : Des. : 5 Des. c: Distnce: Des. : Des. : (,,3) 3 (,,) (,3,) (,,) (,,) Distnce: Des. : Des. : Distnce: 3 Des. : Des. :
25 Spnning Tree Protocol Exmple Distnce: Des. : Des. : (,,) Distnce: Des. : Des. : (,,3) 3 Distnce: Des. : Des. : Distnce: Des. : Des. : 5 5 (,,5) c Distnce: Des. : Des. : 5 Des. c: (,,) (,3,) Distnce: 3 Des. : Des. :
26 Tree Mintennce Pcket forwrding egins only fter tree construction hs converged Bridges periodiclly rodcst their triples fter convergence Detect ridge filure
27 Spnning Tree Protocol: Repir Distnce: Des. : Des. : (,,) Distnce: Des. : Des. : (,,3) 3 Distnce: Des. : Des. : Distnce: Des. : Des. : 5 5 (,,5) c Distnce: Des. : Des. : 5 Des. c: (,,) (,3,) Bridge fils Distnce: 3 Des. : Des. :
28 Spnning Tree Protocol: Repir Distnce: Des. : Des. : (,,) Distnce: Des. : Des. : (,,3) 3 Distnce: Des. : Des. : Distnce: Des. : Des. : 5 5 (,,5) c (,,3) (,3,) Distnce: 3 Des. : Des. : (,3,)
29 Spnning Tree Protocol: Repir Distnce: Des. : Des. : (,,) Distnce: Des. : Des. : (,,3) 3 Distnce: Des. : Des. : 3 Distnce: Des. : Des. : 5 5 (,,5) c (,,3) (,3,) Distnce: 3 Des. : Des. : (,3,)
30 Spnning Tree Protocol: Repir Root: Distnce: Des. : Des. : Distnce: Des. : Des. : 3 Root: 3 Distnce: Des. : 3 Des. : 3 Root: 5 Distnce: Des. : 5 Des. : 5 5 c Root: Distnce: Des. : Des. : Des. c: Root: Distnce: Des. : Des. :
31 Trnsprent Bridging: Summry End Systems: no chnge Extended LAN looks exctly like regulr LAN IS's: uild forwrding tle vi locl computtion Topology constrined to e (logiclly) tree IS's communicte to construct spnning tree overly Fctors limiting sclility Net-wide rodcst when ddress is not known Tree topology limits cpcity etween LANs IS tles eventully contin every destintion ddress
32 Bridging with Source Routes Used with IBM's Token Ring Protocol (lso in 8.5) No constrint on forwrding topology Assumptions: Ech LAN hs unique -it ID (mx 96 LANS) Ech Bridge on LAN hs -it ID (unique etween two LANs) Not trnsprent: Sources (ESs) must plce route description in ech pcket = sequence of lternting LAN nd ridge IDs Bridges (ISs) forwrd pckets from LAN to LAN sed on route description in pcket
33 Source Routing Frme Formt Source Addr RII it Dest Addr RIF Pylod FCS Routing Control LAN ID Bridge ID LAN ID Bridge ID... LAN ID Source Route Type Length Dir it "Directed" or "All-pths Explorer" MTU Bridge Algorithm for Directed Frmes:. Find ID of LAN received on in Source Route. If next Bridge ID = my ID: forwrd onto "next" LAN Direction it determines if "next" = left or right Note: Assumptions imply tht LAN-Bridge-LAN ID sequences re unique!
34 How Sources Find Pths Source rodcsts "All Pths Explorer" frme Ech ridge rodcsts explorer frme to every LAN except the one it ws received on As frme is forwrded, ridge ppends: Its own ID ID of LAN forwrded on to the source route Destintion returns explorer frmes to Source s directed frmes (reversing pth vi Direction it) Source chooses the "est" pth Looping prevention: no ridge forwrds n explorer frme more thn once
35 Pth Discovery vi Explorer Frmes A B 3 C E 5 D - F
36 Pth Discovery vi Explorer Frmes A B 3 C D//E E D//E D/5/C 5 D//F D F
37 Pth Discovery vi Explorer Frmes A D//E/3/B B D/5/C//A D//E/3/B 3 C D//F//E E 5 D//E//F D//F//E D F
38 Pth Discovery vi Explorer Frmes D//E/3/B A D/5/C//A//B D//E/3/B//A D//F//E/3/B D/5/C//A//B D//F//E/3/B 3 B C E 5 D F
39 Pth Discovery vi Explorer Frmes D//E/3/B A D//F//E/3/B//A D/5/C//A//B D//F//E/3/B B D//E/3/B//A//C D/5/C//A//B/3/E 3 C D/5/C//A//B/3/E E 5 D F
40 Pth Discovery vi Explorer Frmes D//E/3/B A D//F//E/3/B//A//C 3 D/5/C//A//B D//F//E/3/B B C E 5 D/5/C//A//B/3/E//F D/5/C//A//B/3/E//F D F
41 Pth Discovery vi Explorer Frmes D//E/3/B A D/5/C//A//B D//F//E/3/B B 3 C E 5 D F
42 Pth Discovery vi Explorer Frmes B/3/E//D A B//A//C/5/D B/3/E//F//D B 3 C E 5 D F
43 Route Selection & Cching Source is free to choose ny returned route Typiclly choose the one rriving first! Other possiilities: Ech explorer hs n MTU field tht collects the minimum MTU long the pth; choose the pth with lrgest MTU Avoid some LANs known to e hevily loded Any other policy Sources should cche routes for efficiency Re-explore periodiclly to ctch chnges
44 Source Routing Bridging Summry End Systems er the urden: Route discovery Route selection, cching But unused routes consume no overhed! Intermedite systems (Bridges): life is simple Completely stteless No "ckground" protocol etween ridges Works with ny topology Fctors limiting sclility Explorer pckets crete hevy lod, wste cpcity
Network Layer: Routing Classifications; Shortest Path Routing
igitl ommuniction in the Modern World : Routing lssifictions; Shortest Pth Routing s min prolem: To get efficiently from one point to the other in dynmic environment http://.cs.huji.c.il/~com com@cs.huji.c.il
CS 268: IP Multicast Routing
Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte
IP: Network Layer. Goals and Tasks. Routing. Switching. Switching (cont.) Datagram v/s Virtual Circuit. Overview Addressing Routing
IP: Network Lyer Overview Addressing Routing Overview Gols nd Tsks Routing Switching Issues Bsic ides TOC IP TOC IP Overview Gols nd Tsks Gols of Network Lyer Guide pckets from source to destintion Use
Distributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
Reducing a DFA to a Minimal DFA
Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,
Ma/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
COMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
Looking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
LECT-10, S-1 FP2P08, Javed I.
A Course on Foundtions of Peer-to-Peer Systems & Applictions LECT-10, S-1 CS /799 Foundtion of Peer-to-Peer Applictions & Systems Kent Stte University Dept. of Computer Science www.cs.kent.edu/~jved/clss-p2p08
Lexical Analysis: Constructing a Scanner from Regular Expressions
Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction
Fig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
Ma/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph
UT1553B BCRT True Dual-port Memory Interface
UTMC APPICATION NOTE UT553B BCRT True Dul-port Memory Interfce INTRODUCTION The UTMC UT553B BCRT is monolithic CMOS integrted circuit tht provides comprehensive MI-STD- 553B Bus Controller nd Remote Terminl
Internet Routing. IP Packet Format. IP Fragmentation & Reassembly. Principles of Internet Routing. Computer Networks 9/29/2014.
omputer Networks 9/29/2014 IP Pket Formt Internet Routing Ki Shen IP protool version numer heder length (words) for qulity of servie mx numer remining hops (deremented t eh router) upper lyer protool to
File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
McAfee Network Security Platform
10/100/1000 Copper Active Fil-Open Bypss Kit Guide Revision E McAfee Network Security Pltform This document descries the contents nd how to instll the McAfee 10/100/1000 Copper Active Fil-Open Bypss Kit
2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
CS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
What are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
PARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
Information Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
CS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
Suffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
The Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
COMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
Epson Projector Content Manager Operation Guide
Epson Projector Content Mnger Opertion Guide Contents 2 Introduction to the Epson Projector Content Mnger Softwre 3 Epson Projector Content Mnger Fetures... 4 Setting Up the Softwre for the First Time
Intermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
Efficient Algorithms For Optimizing Policy-Constrained Routing
Efficient Algorithms For Optimizing Policy-Constrined Routing Andrew R. Curtis curtis@cs.colostte.edu Ross M. McConnell rmm@cs.colostte.edu Dn Mssey mssey@cs.colostte.edu Astrct Routing policies ply n
Overview. Network characteristics. Network architecture. Data dissemination. Network characteristics (cont d) Mobile computing and databases
Overview Mobile computing nd dtbses Generl issues in mobile dt mngement Dt dissemintion Dt consistency Loction dependent queries Interfces Detils of brodcst disks thlis klfigopoulos Network rchitecture
NOTES. Figure 1 illustrates typical hardware component connections required when using the JCM ICB Asset Ticket Generator software application.
ICB Asset Ticket Genertor Opertor s Guide Septemer, 2016 Septemer, 2016 NOTES Opertor s Guide ICB Asset Ticket Genertor Softwre Instlltion nd Opertion This document contins informtion for downloding, instlling,
Summer Review Packet For Algebra 2 CP/Honors
Summer Review Pcket For Alger CP/Honors Nme Current Course Mth Techer Introduction Alger uilds on topics studied from oth Alger nd Geometr. Certin topics re sufficientl involved tht the cll for some review
The Network Layer: Routing in the Internet. The Network Layer: Routing & Addressing Outline
CPSC 852 Internetworking The Network Lyer: Routing in the Internet Mihele Weigle Deprtment of Computer Siene Clemson University mweigle@s.lemson.edu http://www.s.lemson.edu/~mweigle/ourses/ps852 1 The
COMPUTER EDUCATION TECHNIQUES, INC. (MS_W2K3_SERVER ) SA:
In order to lern which questions hve een nswered correctly: 1. Print these pges. 2. Answer the questions. 3. Send this ssessment with the nswers vi:. FAX to (212) 967-3498. Or. Mil the nswers to the following
Slides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
Presentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
Agilent Mass Hunter Software
Agilent Mss Hunter Softwre Quick Strt Guide Use this guide to get strted with the Mss Hunter softwre. Wht is Mss Hunter Softwre? Mss Hunter is n integrl prt of Agilent TOF softwre (version A.02.00). Mss
Lab 1 - Counter. Create a project. Add files to the project. Compile design files. Run simulation. Debug results
1 L 1 - Counter A project is collection mechnism for n HDL design under specifiction or test. Projects in ModelSim ese interction nd re useful for orgnizing files nd specifying simultion settings. The
CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig
CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of
CS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
Lists in Lisp and Scheme
Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,
PPS: User Manual. Krishnendu Chatterjee, Martin Chmelik, Raghav Gupta, and Ayush Kanodia
PPS: User Mnul Krishnendu Chtterjee, Mrtin Chmelik, Rghv Gupt, nd Ayush Knodi IST Austri (Institute of Science nd Technology Austri), Klosterneuurg, Austri In this section we descrie the tool fetures,
ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
Agenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
In the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
Transparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
Chapter 7. Routing with Frame Relay, X.25, and SNA. 7.1 Routing. This chapter discusses Frame Relay, X.25, and SNA Routing. Also see the following:
Chpter 7 Routing with Frme Rely, X.25, nd SNA This chpter discusses Frme Rely, X.25, nd SNA Routing. Also see the following: Section 4.2, Identifying the BANDIT in the Network Section 4.3, Defining Globl
Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
Stack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
CSCI 3130: Formal Languages and Automata Theory Lecture 12 The Chinese University of Hong Kong, Fall 2011
CSCI 3130: Forml Lnguges nd utomt Theory Lecture 12 The Chinese University of Hong Kong, Fll 2011 ndrej Bogdnov In progrmming lnguges, uilding prse trees is significnt tsk ecuse prse trees tell us the
cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
Routing: Network Layer Part II
Routing: Network Lyer Prt II Routing & orwrding: Logicl View of Router Routing lgorithms: Link stte vs. istnce Vector Routing in the Internet Intr-S vs. Inter-S routing Intr-S: RIP nd OSP Inter-S: GP nd
Graphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
Mobile IP route optimization method for a carrier-scale IP network
Moile IP route optimiztion method for crrier-scle IP network Tkeshi Ihr, Hiroyuki Ohnishi, nd Ysushi Tkgi NTT Network Service Systems Lortories 3-9-11 Midori-cho, Musshino-shi, Tokyo 180-8585, Jpn Phone:
CS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
this grammar generates the following language: Because this symbol will also be used in a later step, it receives the
LR() nlysis Drwcks of LR(). Look-hed symols s eplined efore, concerning LR(), it is possile to consult the net set to determine, in the reduction sttes, for which symols it would e possile to perform reductions.
Information regarding
Informtion regrding LANCOM Advnced VPN Client 3.13 Copyright (c) 2002-2017 LANCOM Systems GmbH, Wuerselen (Germny) LANCOM Systems GmbH does not tke ny gurntee nd libility for softwre not developed, mnufctured
A Priority-based Distributed Call Admission Protocol for Multi-hop Wireless Ad hoc Networks
A Priority-bsed Distributed Cll Admission Protocol for Multi-hop Wireless Ad hoc Networks un Sun Elizbeth M. Belding-Royer Deprtment of Computer Science University of Cliforni, Snt Brbr suny, ebelding
ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
OUTPUT DELIVERY SYSTEM
Differences in ODS formtting for HTML with Proc Print nd Proc Report Lur L. M. Thornton, USDA-ARS, Animl Improvement Progrms Lortory, Beltsville, MD ABSTRACT While Proc Print is terrific tool for dt checking
Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015
Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt
Rational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
Self-Organizing Hierarchical Routing for Scalable Ad Hoc Networking
1 Self-Orgnizing Hierrchicl Routing for Sclble Ad Hoc Networking Shu Du Ahmed Khn Sntshil PlChudhuri Ansley Post Amit Kumr Sh Peter Druschel Dvid B. Johnson Rudolf Riedi Rice University Abstrct As devices
TO REGULAR EXPRESSIONS
Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where
Section 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
CS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
The Distributed Data Access Schemes in Lambda Grid Networks
The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn
CS 340, Fall 2014 Dec 11 th /13 th Final Exam Note: in all questions, the special symbol ɛ (epsilon) is used to indicate the empty string.
CS 340, Fll 2014 Dec 11 th /13 th Finl Exm Nme: Note: in ll questions, the specil symol ɛ (epsilon) is used to indicte the empty string. Question 1. [5 points] Consider the following regulr expression;
AI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
The dictionary model allows several consecutive symbols, called phrases
A dptive Huffmn nd rithmetic methods re universl in the sense tht the encoder cn dpt to the sttistics of the source. But, dpttion is computtionlly expensive, prticulrly when k-th order Mrkov pproximtion
style type="text/css".wpb_animate_when_almost_visible { opacity: 1; }/style
style type="text/css".wpb_nimte_when_lmost_vible { opcity: 1; }/style You cn chrome homepge for internet explorer quickly chrome homepge for internet explorer get chrome homepge for internet explorer every
Data Flow on a Queue Machine. Bruno R. Preiss. Copyright (c) 1987 by Bruno R. Preiss, P.Eng. All rights reserved.
Dt Flow on Queue Mchine Bruno R. Preiss 2 Outline Genesis of dt-flow rchitectures Sttic vs. dynmic dt-flow rchitectures Pseudo-sttic dt-flow execution model Some dt-flow mchines Simple queue mchine Prioritized
Routers implementations
Routers implementtions Switching Technology S38.65 http://www.netlb.hut.fi/opetus/s3865 L - Router implementtions Generl of routers Functions of n IP router Router rchitectures Introduction to routing
CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
CS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
Premaster Course Algorithms 1 Chapter 6: Shortest Paths. Christian Scheideler SS 2018
Premster Course Algorithms Chpter 6: Shortest Pths Christin Scheieler SS 8 Bsic Grph Algorithms Overview: Shortest pths in DAGs Dijkstr s lgorithm Bellmn-For lgorithm Johnson s metho SS 8 Chpter 6 Shortest
From Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
YOU ARE: AND THIS IS:
YOU ARE: AND THIS IS: SoHE CMS Mnul As edited August 4, 015 TABLE OF CONTENTS 3 Logging in 4 Pge types within the dshord 5-6 Exploring the toolr 7-8 Adding pge 9 Editing pge 10 Pge templtes: Met Templte
Polycom RealPresence Media Editor Quick Start
Polycom RelPresence Medi Editor Quick Strt Version 5.5 Novemer 2011 3725-75201-001/A Trdemrk Informtion Polycom, the Polycom Tringles logo, nd the nmes nd mrks ssocited with Polycom s products re trdemrks
TCP/ICN: Carrying TCP over Content Centric and Named Data Networks
TCP/ICN: Crrying TCP over Content Centric nd Nmed Dt Networks Ily Moiseenko Cisco Systems Dve Orn Cisco Systems Outline I. Introduction II. Design Bsic fetching proxy Relible prefetching proxy Unrelible
Subtracting Fractions
Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding
Control-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
How to Design REST API? Written Date : March 23, 2015
Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly
Creating Flexible Interfaces. Friday, 24 April 2015
Creting Flexible Interfces 1 Requests, not Objects Domin objects re esy to find but they re not t the design center of your ppliction. Insted, they re trp for the unwry. Sequence digrms re vehicle for
George Boole. IT 3123 Hardware and Software Concepts. Switching Algebra. Boolean Functions. Boolean Functions. Truth Tables
George Boole IT 3123 Hrdwre nd Softwre Concepts My 28 Digitl Logic The Little Mn Computer 1815 1864 British mthemticin nd philosopher Mny contriutions to mthemtics. Boolen lger: n lger over finite sets
CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.
CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement
c360 Add-On Solutions
c360 Add-On Solutions Functionlity Dynmics CRM 2011 c360 Record Editor Reltionship Explorer Multi-Field Serch Alerts Console c360 Core Productivity Pck "Does your tem resist using CRM becuse updting dt
4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li
2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min
Simplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this