CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
|
|
- Rosemary Bond
- 5 years ago
- Views:
Transcription
1 CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe
2 LOG STUCTUED MEGE TEES
3 Series Summtion eview Let n = k $ = #%& #. Wht is n? n = k+ - Wht is log () + log () + log () + log (8)+ + log ( k ) $ = k = Arithmetic series: i O(k ) #%& So then wht if k = log(n) s in: log () + log () + log () + log (8)+ + log ( log(n) ) O(log n) ( #%) i = (((,)) = θ n. Geometric series ( c # #%). = c(,) c = θ c(
4 Merge Trees Overview Consider list of (pointers to) rrys with the following constrints Ech rry is sorted though no ordering constrints exist etween rrys The rry t list index k is of exctly size k or empty An rry t list loction k cn e of size k or empty 0 NULL 0 Note: These re the keys for set (or key,vlue pirs for mp) Size = 8 Size = if non-empty
5 Merge Trees Size Define n s the # of keys in the entire structure k s the size of the list (i.e. positions in the list) Given k, wht is n? Let n = k = $ #%& #. Wht is n? n= k - An rry t list loction k cn e of size k or empty 0 NULL Size = 8 Size = if non-empty Note: These re the keys for set (or key,vlue pirs for mp)
6 Merge Trees Find Opertion To find n element (or check if it exists) Iterte through the rrys in order (i.e. strt with rry t list position 0, then the rry t list position, etc.) In ech rry perform inry serch If you rech the end of the list of rrys without finding the vlue it does not exist in the set/mp An rry t list loction k cn e of size k or empty 0 NULL 0 Note: These re the keys for set (or key,vlue pirs for mp) Size = 8 Size = if non-empty
7 7 Find untime Wht is the worst cse runtime of find? When the item is not present which requires, inry serch is performed on ech list T(n) = log () + log () + log ( k ) $ = k = #%& i = O(k ) But let's put tht in terms of the numer of elements in the structure (i.e. n) ecll k = log (n)+ So find is O(log (n) ) An rry t list loction k cn e of size k or empty 0 NULL 0 Note: These re the keys for set (or key,vlue pirs for mp) Size = 8 Size = if non-empty
8 8 Improving Find's untime While we might e oky with [log(n)], how might we improve the find runtime in the generl cse? Hint: I would e willing to py O() to know if key is not in prticulr rry without hving to perform find A Bloom filter could e mintined longside ech rry nd llow us to skip performing inry serch in n rry
9 9 Insertion Algorithm Let j e the smllest integer such tht rry j is empty (first empty slot in the list of rrys) An insertion will cuse Loction j's rry to ecome filled Loctions 0 through j- to ecome empty An rry t list loction k cn e of size k or empty insert(9) j= 0 NULL 0 9 Before insertion 8 0 Size = 8 0 After insertion Size = 8
10 0 Insertion Algorithm Strting t rry 0, itertively merge the previously merged rry with the next, stopping when n empty loction is encountered insert(9) 9 0 NULL 0 NULL 0 NULL Merge List 0 is full so merge two rrys of size 9 Merge List is full so merge two rrys of size Size = 8
11 Insert Exmples insert() 0 NULL insert(8) 0 NULL Cost = / 0 insert() 0 NULL Cost = / Cost = / insert() Cost = / 0 0 NULL insert(7) Cost = / 0 NULL insert(9) Cost = / 0 NULL 9 insert() Cost = / 0 0 NULL 7 8 9
12 Insertion untime: First Look 0 Best cse? First list is empty nd llows direct insertion in O() Worst cse? All list entries (rrys) re full so we hve to merge t ech loction In this cse we will end with n rry of size n= k in position k Also recll merging two rrys of size m is Θ(m) So the totl cost of ll the merges is n = *n- = Θ(n) = Θ( k ) But if the worst cse occurs how soon cn it occur gin? It seems the costs vry from one insert to the next This is good plce to use mortized nlysis insert() insert() insert() insert(9) NULL 0 NULL 0 NULL 0 NULL 9
13 Totl Cost for N insertions Totl cost of n= insertions: =*n/ + *n/ + *n/8 + 8*n/ + n =n/ + n/ + n/ + n/ + n =n/*log (n) + n Amortized cost = Totl cost / n opertions log (n)/ + = O(log (n))
14 Amortized Anlysis of Insert We hve sid when you end (plce n rry) in position k you hve to do O( k+ ) work for ll the merges How often do we end in position k The 0 th position will e free with proility ½ (p=0.) We will stop t the st position with proility ¼ (p=0.) We will stop t the nd position with proility /8 (p=0.) We will stop t the k th position with proility / k = -k So we py k+ with proility -(k+) Suppose we hve n items in the structure (i.e. mx k is log n) wht is the expected cost of inserting new element 789 (() $%& $,) ($,)) 789 (() = $%& = log (n) insert() Cost = / 0 insert() Cost = / insert() Cost = / 0 insert(9) Cost = / 0 NULL 0 NULL 0 NULL 0 NULL 9
15 Summry Vrints of log structured merge trees hve found populr usge in industry Strting rry size might e firly lrge (size of memory of single server) Lrge rrys (from merging) re stored on disk Pros: Ese of implementtion Sequentil ccess of rrys helps lower its constnt fctors Opertions: Find = log(n) Insert = Amortized log(n) emove = often not considered/supported
16 SPLAY TEES
17 7 Sources / eding Mteril for these slides ws derived from the following sources /lecture0-sply.pdf Nice Visuliztion Tool html
18 8 Sply Tree Intro Another mp/set implementtion (storing keys or key/vlue pirs) Insert, emove, Find ecll To do m inserts/finds/removes on n BTree w/ n elements would cost? O(m*log(n)) Sply trees hve worst cse find, insert, delete time of O(n) However, they gurntee tht if you do m opertions on sply tree with n elements tht the totl ("mortized" uh-oh) time is O(m*log(n)) They hve further enefit tht recently ccessed elements will e ner the top of the tree In fct, the most recently ccessed item is lwys t the top of the tree
19 9 Sply Opertion Sply mens "spred" As you serch for n item or fter you insert n item we will perform series of sply opertions These opertions will cuse the desired node to lwys end up t the top of the tree A desirle side-effect is tht ccessing key multiple times within short time window will yield fst serches ecuse it will e ner the top See next slide on principle of loclity T If we serch for or insert T T T will end up s the root node with the old root in the top level or two
20 dimensions of this principle: spce & time Sptil Loclity Future ccesses will likely cluster ner current ccesses Instructions nd dt rrys re sequentil (they re ll one fter the next) Temporl Loclity Future ccesses will likely e to recently ccessed items Sme code nd dt re repetedly ccessed (loops, suroutines, if(x > y) x++; 90/0 rule: Anlysis shows tht usully 0% of the written instructions ccount for 90% of the executed instructions Sply trees help exploit temporl loclity y gurnteeing recently ccessed items ner the top of the tree 0 Principle of Loclity
21 Sply Cses. Zig-Zig G. oot/zig Cse (Single ottion) P d P c G c c d c Left rotte of, ight rotte of,. Zig-Zg G G P d P G P G P c d d c d c c
22 Find() Zig 7 7 Zig-Zig 7 Zig-Zig esulting Tree 7
23 Find() Zig-Zg Zig-Zg esulting Tree Notice the tree is strting to look t lot more lnced
24 Worst Cse Suppose you wnt to mke the mortized time (verged time over multiple clls to find/insert/remove) look d, you might try to lwys ccess the node in the tree Deepest But sply trees hve property tht s we keep ccessing deep nodes the tree strts to lnce nd thus ccess to deep nodes strt y costing O(n) ut soon strt costing O(log n)
25 Insert() Zig-Zig 8 Zig-Zig esulting Tree
26 Insert() Zig-Zg Zig-Zig esulting Tree 8
27 7 Activity Go to html Try to e n dversry y inserting nd finding elements tht would cuse O(n) ech time
28 8 Sply Tree Supported Opertions Insert(x) Norml BST insert, then sply x Find(x) Attempt norml BST find(x) nd sply lst node visited If x is in the tree, then we sply x If x is not in the tree we sply the lef node where our serch ended FindMin(), FindMx() Wlk to fr left or right of tree, return tht node's vlue nd then sply tht node DeleteMin(), DeleteMx() Perform FindMin(), FindMx() [which splys the min/mx to the root] then delete tht node nd set root to e the non-null child of the min/mx emove(x) Find(x) splying it to the top, then overwrite its vlue with is successor/predecessor, deleting the successor/predecessor node
29 9 FindMin() / DeleteMin() FindMin() Zig-Zig Zig esulting Tree DeleteMin() esulting Tree 0
30 0 emove() Zig-Zg Zig-Zg esulting Tree 7 7 Copy successor or predecessor to root Delete successor (emove node or rettch single child)
31 Top Down Splying ther thn wlking down the tree to first find the vlue then splying ck up, we cn sply on the wy down We will e "pruning" the ig tree into two smller trees s we wlk, cutting off the unused pthwys
32 Top-Down Splying. Zig (If Trget is in nd level) oot T L T L oot. Finl Step (when rech Trget) T T L L
33 Top-Down Splying. Zig-Zig Y Z c Y Z L Y Z c L c L Z c L Y. Zig-Zg L Z c L Y Z c Y L Y Z c L Y Z c
34 Find() Zig-Zg 7 Steps tken on our journey to find - - L Y Z c L Y Z c L-Tree -Tree L-Tree -Tree 7 L Z c L Y Z c Y -Tree 7 L-Tree
35 Find() L-Tree -Tree esulting tree fter find esulting tree from ottom-up pproch. Finl Step (when rech Trget) T T L L
36 Insert() L-Tree -Tree L-Tree - -Tree L-Tree 0 8 -Tree Originl esulting Tree from Bottomup pproch
37 7 Summry Sply trees don't enforce lnce ut re selfdjusting to ttempt yield lnced tree Sply trees provide efficient mortized time opertions A single opertion my tke O(n) m opertions on tree with n elements => O(m(log n)) Uses rottions to ttempt lnce Provides fst ccess to recently used keys
CSCI 104 Log Structured Merge Trees. Mark Redekopp
1 CSCI 10 Log Structured Merge Trees Mark Redekopp Series Summation Review Let n = 1 + + + + k = σk i=0 n = k+1-1 i. What is n? What is log (1) + log () + log () + log (8)++ log ( k ) = 0 + 1 + + 3+ +
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More informationOrthogonal line segment intersection
Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl
More informationAI Adjacent Fields. This slide deck courtesy of Dan Klein at UC Berkeley
AI Adjcent Fields Philosophy: Logic, methods of resoning Mind s physicl system Foundtions of lerning, lnguge, rtionlity Mthemtics Forml representtion nd proof Algorithms, computtion, (un)decidility, (in)trctility
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationAllocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationSuffix trees, suffix arrays, BWT
ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time
More informationCS143 Handout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexical Analysis
CS143 Hndout 07 Summer 2011 June 24 th, 2011 Written Set 1: Lexicl Anlysis In this first written ssignment, you'll get the chnce to ply round with the vrious constructions tht come up when doing lexicl
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationDeletion The Two Child Case 10 Delete(5) Deletion The Two Child Case. Balanced BST. Finally
Deletion Te Two Cild Cse Delete() Deletion Te Two Cild Cse Ide: Replce te deleted node wit vlue gurnteed to e etween te two cild sutrees! Options: succ from rigt sutree: findmin(t.rigt) pred from left
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationIf you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.
Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online
More informationMATH 2530: WORKSHEET 7. x 2 y dz dy dx =
MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl
More informationP(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have
Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More informationSuffix Tries. Slides adapted from the course by Ben Langmead
Suffix Tries Slides dpted from the course y Ben Lngmed en.lngmed@gmil.com Indexing with suffixes Until now, our indexes hve een sed on extrcting sustrings from T A very different pproch is to extrct suffixes
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationPARALLEL AND DISTRIBUTED COMPUTING
PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce
More informationCS321 Languages and Compiler Design I. Winter 2012 Lecture 5
CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,
More informationInformation Retrieval and Organisation
Informtion Retrievl nd Orgnistion Suffix Trees dpted from http://www.mth.tu.c.il/~himk/seminr02/suffixtrees.ppt Dell Zhng Birkeck, University of London Trie A tree representing set of strings { } eef d
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationStack. A list whose end points are pointed by top and bottom
4. Stck Stck A list whose end points re pointed by top nd bottom Insertion nd deletion tke plce t the top (cf: Wht is the difference between Stck nd Arry?) Bottom is constnt, but top grows nd shrinks!
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationZZ - Advanced Math Review 2017
ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationCaches I. CSE 351 Spring Instructor: Ruth Anderson
L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,
More informationMidterm 2 Sample solution
Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More informationDr. D.M. Akbar Hussain
Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence
More informationOutline. Introduction Suffix Trees (ST) Building STs in linear time: Ukkonen s algorithm Applications of ST
Suffi Trees Outline Introduction Suffi Trees (ST) Building STs in liner time: Ukkonen s lgorithm Applictions of ST 2 3 Introduction Sustrings String is ny sequence of chrcters. Sustring of string S is
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationSection 10.4 Hyperbolas
66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol
More informationUnion-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation
Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem
Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationCS481: Bioinformatics Algorithms
CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in
More informationDistributed Systems Principles and Paradigms
Distriuted Systems Principles nd Prdigms Chpter 11 (version April 7, 2008) Mrten vn Steen Vrije Universiteit Amsterdm, Fculty of Science Dept. Mthemtics nd Computer Science Room R4.20. Tel: (020) 598 7784
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More informationFig.25: the Role of LEX
The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing
More informationCOMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples
COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure
More informationBasics of Logic Design Arithmetic Logic Unit (ALU)
Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building
More informationImproper Integrals. October 4, 2017
Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here
More informationRecall: Properties of B-Trees
CSE 326 Lecture 10: B-Trees and Heaps It s lunch time what s cookin? B-Trees Insert/Delete Examples and Run Time Analysis Summary of Search Trees Introduction to Heaps and Priority Queues Covered in Chapters
More informationIntegration. September 28, 2017
Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my
More informationCSCE 531, Spring 2017, Midterm Exam Answer Key
CCE 531, pring 2017, Midterm Exm Answer Key 1. (15 points) Using the method descried in the ook or in clss, convert the following regulr expression into n equivlent (nondeterministic) finite utomton: (
More informationMA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork
MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationMa/CS 6b Class 1: Graph Recap
M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/
More informationGraphs with at most two trees in a forest building process
Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,
More informationSystems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits
Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion
More informationCaches I. CSE 351 Autumn 2018
Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More informationCS412/413. Introduction to Compilers Tim Teitelbaum. Lecture 4: Lexical Analyzers 28 Jan 08
CS412/413 Introduction to Compilers Tim Teitelum Lecture 4: Lexicl Anlyzers 28 Jn 08 Outline DFA stte minimiztion Lexicl nlyzers Automting lexicl nlysis Jlex lexicl nlyzer genertor CS 412/413 Spring 2008
More information4/29/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Fibonacci function. Fibonacci (Leonardo Pisano) ? Statue in Pisa Italy
/9/8 Fioncci (Leonrdo Pisno) -? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS Spring 8 Fioncci function fi() fi() fi(n) fi(n-) + fi(n-) for n,,,,,, 8,,, In his ook in titled Lier
More informationUNIVERSITY OF CALIFORNIA Department of Electrical Engineering and Computer Sciences Computer Science Division. Balanced Searching: Tries, Treaps
UNIVERSITY OF CALIFORNIA Deprtment of Electricl Engineering nd Computer Sciences Computer Science Division CS6B Fll 999 P. N. Hilfinger Blnced Serching: Tries, Treps Blnce We ve seen tht inry serch trees
More informationASTs, Regex, Parsing, and Pretty Printing
ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,
More informationa < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1
Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the
More informationΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών. Lecture 3b Lexical Analysis Elias Athanasopoulos
ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy RecogniNon of Tokens if expressions nd relnonl opertors if è if then è then else è else relop è
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationCS 221: Artificial Intelligence Fall 2011
CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte
More informationControl-Flow Analysis and Loop Detection
! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationCSc 453. Compilers and Systems Software. 4 : Lexical Analysis II. Department of Computer Science University of Arizona
CSc 453 Compilers nd Systems Softwre 4 : Lexicl Anlysis II Deprtment of Computer Science University of Arizon collerg@gmil.com Copyright c 2009 Christin Collerg Implementing Automt NFAs nd DFAs cn e hrd-coded
More information1.5 Extrema and the Mean Value Theorem
.5 Extrem nd the Men Vlue Theorem.5. Mximum nd Minimum Vlues Definition.5. (Glol Mximum). Let f : D! R e function with domin D. Then f hs n glol mximum vlue t point c, iff(c) f(x) for ll x D. The vlue
More informationLexical analysis, scanners. Construction of a scanner
Lexicl nlysis scnners (NB. Pges 4-5 re for those who need to refresh their knowledge of DFAs nd NFAs. These re not presented during the lectures) Construction of scnner Tools: stte utomt nd trnsition digrms.
More informationGrade 7/8 Math Circles Geometric Arithmetic October 31, 2012
Fculty of Mthemtics Wterloo, Ontrio N2L 3G1 Grde 7/8 Mth Circles Geometric Arithmetic Octoer 31, 2012 Centre for Eduction in Mthemtics nd Computing Ancient Greece hs given irth to some of the most importnt
More informationMTH 146 Conics Supplement
105- Review of Conics MTH 146 Conics Supplement In this section we review conics If ou ne more detils thn re present in the notes, r through section 105 of the ook Definition: A prol is the set of points
More informationEECS 281: Homework #4 Due: Thursday, October 7, 2004
EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9
More informationRay surface intersections
Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive
More information2014 Haskell January Test Regular Expressions and Finite Automata
0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationAgenda & Reading. Class Exercise. COMPSCI 105 SS 2012 Principles of Computer Science. Arrays
COMPSCI 5 SS Principles of Computer Science Arrys & Multidimensionl Arrys Agend & Reding Agend Arrys Creting & Using Primitive & Reference Types Assignments & Equlity Pss y Vlue & Pss y Reference Copying
More informationA Heuristic Approach for Discovering Reference Models by Mining Process Model Variants
A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl
More informationFall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.
15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or
More informationCompiler-Assisted Cache Replacement
LCPC 3 Formulting The Prolem of Compiler-Assisted Cche Replcement Hongo Yng LCPC 3 Agend Bckground: Memory hierrchy, ISA with cche hints Prolem definition: How should compiler give cche hint to minimize
More informationSimplifying Algebra. Simplifying Algebra. Curriculum Ready.
Simplifying Alger Curriculum Redy www.mthletics.com This ooklet is ll out turning complex prolems into something simple. You will e le to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give this
More information