Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Size: px
Start display at page:

Download "Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012"

Transcription

1 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1

2 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems. Overlpping subproblems The spce of subproblem is smll so tht the recursive lgorithm hs to solve the sme problems over nd over. 2

3 Giving Optiml Chnge 3

4 Motivtion We hve discussed greedy lgorithm for giving chnge. However, the greedy lgorithm is not optiml for ll denomintions. Cn we design n lgorithm tht will give the minimum number of coins s chnge for ny given mount? Answer: Yes, using dynmic progrmming. 4

5 Dynmic Progrmming Tsk For dynmic progrmming, we hve to find some subproblems tht might help in solving the coin-chnge problem. Ide: Vry mount Restrict the vilble coins 5

6 Initil Set Up Suppose we wnt to compute the minimum number of coins with vlues v[1]>v[2]> >v[n]=1 to give chnge for n mount C. Let us cll the (i,j)-problem the problem of computing minimum number of coins with vlues v[i]>v[i+1]> >v[n]=1 to give chnge for n mount 1<= j <= C. The originl problem is the (1,C)-problem. 6

7 Tbultion Let m[i][j] denote the solution to the (i,j)-problem. Thus, m[i][j] denotes the minimum number of coins to mke chnge for the mount j using coins with vlues v[i],,v[n]. 7

8 Tbultion Exmple Denomintion v[1]=1, v[2]=6, v[3]=1 Tble of m[i][j] vlues: 8

9 A Simple Observtion In clculting m[i][j], notice tht: )Suppose we do not use the coin with vlue v[i] in the solution of the (i,j)-problem, then m[i][j] = m[i+1][j] b)suppose we use the coin with vlue v[i] in the solution of the (i,j)-problem, then m[i][j] = 1 + m[i][ j-v[i] ] 9

10 Tbultion Exmple Denomintion v[1]=1, v[2]=6, v[3]=1 Tble of m[i][j] vlues: 1

11 Recurrence We either use coin with vlue v[i] in the solution or we don t. m[i][j] = m[i+1][j] if v[i]>j min{ m[i+1][j], 1+m[i][ j-v[i] ] } otherwise 11

12 DP Coin-Chnge Algorithm Dynmic_Coin_Chnge(C,v,n) llocte rry m[1..n][..c]; for(i = ; i<=c, i++) m[n][i] = i; // mke chnge for mount i using coins of vlue v[n]=1. for(i=n-1; i=>1; i--) { // successively llow lrger number coin vlues for(j=; j<=c; j++) { // clc vlues of the rry. if( v[i]>j m[i+1][j]<1+m[i][j v[i]] ) m[i][j] = m[i+1][j]; // lrge coin does not help else m[i][j] = 1+m[i][j v[i]]; // } } return &m; 12

13 Question The previous lgorithm llows us to find the minimum number of coins. How cn you modify the lgorithm to ctully compute the chnge (i.e., the multiplicities of the coins)? 13

14 Mtrix Chin Algorithm 14

15 Mtrices An n x m mtrix A over the rel numbers is rectngulr rry of nm rel numbers tht re rrnged in n rows nd m columns. For exmple, 3 x 2 mtrix A hs 6 entries A = where ech of the entries ij is rel 15

16 Definition of Mtrix Multipliction Let A be n n x m mtrix B n m x p mtrix The product of A nd B is n x p mtrix AB whose (i,j)-th entry is k=1 m ik b kj In other words, we multiply the entries of the i-th row of A with the entries of the j-th column of B nd dd them up. 16

17 Mtrix Multipliction [Imges courtesy of Wikipedi] 17

18 Complexity of Nïve Mtrix Multiplying non-squre mtrices: A is n x m, B is m x p AB is n x p mtrix [ whose (i,j) entry is ik b kj ] Computing the product AB tkes nmp sclr multiplictions n(m-1)p sclr dditions 18 if we tke bsic mtrix multipliction lgorithm.

19 Mtrix Chin Order Problem 19

20 Mtrix Chin Order Problem Mtrix multipliction is ssocitive, mening tht (AB)C = A(BC). 19

21 Mtrix Chin Order Problem Mtrix multipliction is ssocitive, mening tht (AB)C = A(BC). Therefore, we hve choice of forming the product of severl mtrices. 19

22 Mtrix Chin Order Problem Mtrix multipliction is ssocitive, mening tht (AB)C = A(BC). Therefore, we hve choice of forming the product of severl mtrices. Wht is the lest expensive wy to form the product of severl mtrices if the nïve mtrix multipliction lgorithm is used? 19

23 Mtrix Chin Order Problem Mtrix multipliction is ssocitive, mening tht (AB)C = A(BC). Therefore, we hve choice of forming the product of severl mtrices. Wht is the lest expensive wy to form the product of severl mtrices if the nïve mtrix multipliction lgorithm is used? [Use number of sclr multiplictions s cost.] 19

24 Why Order Mtters 2

25 Why Order Mtters Suppose we hve 4 mtrices: A: 3 x 1 B: 1 x 4 C: 4 x 1 D: 1 x 25 2

26 Why Order Mtters Suppose we hve 4 mtrices: A: 3 x 1 B: 1 x 4 C: 4 x 1 D: 1 x 25 ((AB)(CD)) : requires 41,2 mults. 2

27 Why Order Mtters Suppose we hve 4 mtrices: A: 3 x 1 B: 1 x 4 C: 4 x 1 D: 1 x 25 ((AB)(CD)) : requires 41,2 mults. (A((BC)D)) : requires 14 mults. 2

28 Mtrix Chin Order Problem Given mtrices A 1, A 2,, A n, where A i is d i-1 x d i mtrix. [1] Wht is minimum number of sclr multiplictions required to compute the product A 1 A 2 A n? [2] Wht order of mtrix multiplictions chieves this minimum? We focus on question [1]; We will briefly sketch n nswer to [2]. 21

29 A Possible Solution Try ll possibilities nd choose the best one. Drwbck: There re too mny of them (exponentil in the number of mtrices to be multiplied) Need to be more clever - try dynmic progrmming! 22

30 Step 1: Develop Recursive Define M(i,j) to be the minimum number of multiplictions needed to compute A i A i+1 A j Gol: Find M(1,n). Bsis: M(i,i) =. Recursion: How cn one define M(i,j) recursively? 23

31 Defining M(i,j) Recursively Consider ll possible wys to split A i through A j into two pieces. Compre the costs of ll these splits: best cse cost for computing the product of the two pieces plus the cost of multiplying the two products Tke the best one M(i,j) = min k (M(i,k) + M(k+1,j) + d i-1 d k d j ) 24

32 Defining M(i,j) Recursively (A i A k ) (A k+1 A j ) P 1 P 2 minimum cost to compute P 1 is M(i,k) minimum cost to compute P 2 is M(k+1,j) cost to compute P 1 P 2 is d i-1 d k d j 25

33 Step 2: Find Dependencies M:

34 Step 2: Find Dependencies M: GOAL! 26

35 Step 2: Find Dependencies M: GOAL! 26

36 Step 2: Find Dependencies M: GOAL! 26

37 Step 2: Find Dependencies M: GOAL! computing the pink squre requires the purple ones: to the left nd below. 26

38 Defining the Dependencies Computing M(i,j) uses everything in sme row to the left: M(i,i), M(i,i+1),, M(i,j-1) nd everything in sme column below: M(i,j), M(i+1,j),,M(j,j) 27

39 Step 3: Identify Order for Recll the dependencies between subproblems just found Solve the subproblems (i.e., fill in the tble entries) this wy: go long the digonl strt just bove the min digonl end in the upper right corner (gol) 28

40 Order for Solving Subproblems M:

41 Order for Solving Subproblems M:

42 Order for Solving Subproblems M:

43 Order for Solving Subproblems M:

44 Order for Solving Subproblems M:

45 Pseudocode for i := 1 to n do M[i,i] := for d := 1 to n-1 do // digonls for i := 1 to n-d to // rows w/ n entry on d-th digonl j := i + d // column corresp. to row i on d-th digonl M[i,j] := infinity for k := i to j-1 to M[i,j] := min(m[i,j], M[i,k]+M[k+1,j]+d i-1 d k d j ) endfor endfor endfor 3

46 Pseudocode for i := 1 to n do M[i,i] := for d := 1 to n-1 do // digonls for i := 1 to n-d to // rows w/ n entry on d-th digonl j := i + d // column corresp. to row i on d-th digonl M[i,j] := infinity for k := i to j-1 to M[i,j] := min(m[i,j], M[i,k]+M[k+1,j]+d i-1 d k d j ) endfor endfor running time O(n 3 ) endfor 3

47 Pseudocode for i := 1 to n do M[i,i] := for d := 1 to n-1 do // digonls for i := 1 to n-d to // rows w/ n entry on d-th digonl j := i + d // column corresp. to row i on d-th digonl py ttention here M[i,j] := infinity to remember ctul for k := i to j-1 to sequence of mults. M[i,j] := min(m[i,j], M[i,k]+M[k+1,j]+d i-1 d k d j ) endfor endfor endfor running time O(n 3 ) 3

48 Exmple M: , 1: A is 3x1 2: B is 1x4 3: C is 4x1 4: D is 1x

49 Keeping Trck of the Order It's fine to know the cost of the chepest order, but wht is tht chepest order? Keep nother rry S nd updte it when computing the minimum cost in the inner loop After M nd S hve been filled in, then cll recursive lgorithm on S to print out the ctul order 32

50 Modified Pseudocode for i := 1 to n do M[i,i] := for d := 1 to n-1 do // digonls for i := 1 to n-d to // rows w/ n entry on d-th digonl j := i + d M[i,j] := infinity for k := i to j-1 to // column corresponding to row i on d-th digonl M[i,j] := min(m[i,j], M[i,k]+M[k+1,j]+d i-1 d k d j ) if previous line chnged vlue of M[i,j] then S[i,j] := k endfor endfor endfor keep trck of chepest split point found so fr: between A k nd A k+1 33

51 Exmple M: S: , : A is 3x1 2: B is 1x4 3: C is 4x1 4: D is 1x25 34

52 Using S to Print Best Ordering Cll Print(S,1,n) to get the entire ordering. Print(S,i,j): if i = j then output "A" + i //+ is string conct else k := S[i,j] output "(" + Print(S,i,k) + Print(S,k+1,j) + ")" 35

Partha Sarathi Manal

Partha Sarathi Manal MA 515: Introduction to Algorithms & MA353 : Design and Analysis of Algorithms [3-0-0-6] Lecture 29 http://www.iitg.ernet.in/psm/indexing_ma353/y09/index.html Partha Sarathi Manal psm@iitg.ernet.in Dept.

More information

Geometric transformations

Geometric transformations Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Section 10.4 Hyperbolas

Section 10.4 Hyperbolas 66 Section 10.4 Hyperbols Objective : Definition of hyperbol & hyperbols centered t (0, 0). The third type of conic we will study is the hyperbol. It is defined in the sme mnner tht we defined the prbol

More information

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex

Quiz2 45mins. Personal Number: Problem 1. (20pts) Here is an Table of Perl Regular Ex Long Quiz2 45mins Nme: Personl Numer: Prolem. (20pts) Here is n Tle of Perl Regulr Ex Chrcter Description. single chrcter \s whitespce chrcter (spce, t, newline) \S non-whitespce chrcter \d digit (0-9)

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Transparent neutral-element elimination in MPI reduction operations

Transparent neutral-element elimination in MPI reduction operations Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing

More information

Matrices and Systems of Equations

Matrices and Systems of Equations Mtrices Mtrices nd Sstems of Equtions A mtri is rectngulr rr of rel numbers. CHAT Pre-Clculus Section 8. m m m............ n n n mn We will use the double subscript nottion for ech element of the mtri.

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

ZZ - Advanced Math Review 2017

ZZ - Advanced Math Review 2017 ZZ - Advnced Mth Review Mtrix Multipliction Given! nd! find the sum of the elements of the product BA First, rewrite the mtrices in the correct order to multiply The product is BA hs order x since B is

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam. 15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X 4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-186 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

Solution of Linear Algebraic Equations using the Gauss-Jordan Method

Solution of Linear Algebraic Equations using the Gauss-Jordan Method Solution of Liner Algebric Equtions using the Guss-Jordn Method Populr pproch for solving liner equtions The Guss Jordn method depends on two properties of liner equtions: Scling one or more of ny of the

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Answer Key Lesson 6: Workshop: Angles and Lines

Answer Key Lesson 6: Workshop: Angles and Lines nswer Key esson 6: tudent Guide ngles nd ines Questions 1 3 (G p. 406) 1. 120 ; 360 2. hey re the sme. 3. 360 Here re four different ptterns tht re used to mke quilts. Work with your group. se your Power

More information

Math 142, Exam 1 Information.

Math 142, Exam 1 Information. Mth 14, Exm 1 Informtion. 9/14/10, LC 41, 9:30-10:45. Exm 1 will be bsed on: Sections 7.1-7.5. The corresponding ssigned homework problems (see http://www.mth.sc.edu/ boyln/sccourses/14f10/14.html) At

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:

cisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example: cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles

More information

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation

Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

A REINFORCEMENT LEARNING APPROACH TO SCHEDULING DUAL-ARMED CLUSTER TOOLS WITH TIME VARIATIONS

A REINFORCEMENT LEARNING APPROACH TO SCHEDULING DUAL-ARMED CLUSTER TOOLS WITH TIME VARIATIONS A REINFORCEMENT LEARNING APPROACH TO SCHEDULING DUAL-ARMED CLUSTER TOOLS WITH TIME VARIATIONS Ji-Eun Roh (), Te-Eog Lee (b) (),(b) Deprtment of Industril nd Systems Engineering, Kore Advnced Institute

More information

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1. Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Stained Glass Design. Teaching Goals:

Stained Glass Design. Teaching Goals: Stined Glss Design Time required 45-90 minutes Teching Gols: 1. Students pply grphic methods to design vrious shpes on the plne.. Students pply geometric trnsformtions of grphs of functions in order to

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

Physics 208: Electricity and Magnetism Exam 1, Secs Feb IMPORTANT. Read these directions carefully:

Physics 208: Electricity and Magnetism Exam 1, Secs Feb IMPORTANT. Read these directions carefully: Physics 208: Electricity nd Mgnetism Exm 1, Secs. 506 510 11 Feb. 2004 Instructor: Dr. George R. Welch, 415 Engineering-Physics, 845-7737 Print your nme netly: Lst nme: First nme: Sign your nme: Plese

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

12-B FRACTIONS AND DECIMALS

12-B FRACTIONS AND DECIMALS -B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn

More information

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment

File Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

PARALLEL AND DISTRIBUTED COMPUTING

PARALLEL AND DISTRIBUTED COMPUTING PARALLEL AND DISTRIBUTED COMPUTING 2009/2010 1 st Semester Teste Jnury 9, 2010 Durtion: 2h00 - No extr mteril llowed. This includes notes, scrtch pper, clcultor, etc. - Give your nswers in the ville spce

More information

Approximation by NURBS with free knots

Approximation by NURBS with free knots pproximtion by NURBS with free knots M Rndrinrivony G Brunnett echnicl University of Chemnitz Fculty of Computer Science Computer Grphics nd Visuliztion Strße der Ntionen 6 97 Chemnitz Germny Emil: mhrvo@informtiktu-chemnitzde

More information

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association

9 4. CISC - Curriculum & Instruction Steering Committee. California County Superintendents Educational Services Association 9. CISC - Curriculum & Instruction Steering Committee The Winning EQUATION A HIGH QUALITY MATHEMATICS PROFESSIONAL DEVELOPMENT PROGRAM FOR TEACHERS IN GRADES THROUGH ALGEBRA II STRAND: NUMBER SENSE: Rtionl

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

MATH 2530: WORKSHEET 7. x 2 y dz dy dx =

MATH 2530: WORKSHEET 7. x 2 y dz dy dx = MATH 253: WORKSHT 7 () Wrm-up: () Review: polr coordintes, integrls involving polr coordintes, triple Riemnn sums, triple integrls, the pplictions of triple integrls (especilly to volume), nd cylindricl

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-188 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7.

CS 241. Fall 2017 Midterm Review Solutions. October 24, Bits and Bytes 1. 3 MIPS Assembler 6. 4 Regular Languages 7. CS 241 Fll 2017 Midterm Review Solutions Octoer 24, 2017 Contents 1 Bits nd Bytes 1 2 MIPS Assemly Lnguge Progrmming 2 3 MIPS Assemler 6 4 Regulr Lnguges 7 5 Scnning 9 1 Bits nd Bytes 1. Give two s complement

More information

Topic 2: Lexing and Flexing

Topic 2: Lexing and Flexing Topic 2: Lexing nd Flexing COS 320 Compiling Techniques Princeton University Spring 2016 Lennrt Beringer 1 2 The Compiler Lexicl Anlysis Gol: rek strem of ASCII chrcters (source/input) into sequence of

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

Constrained Optimization. February 29

Constrained Optimization. February 29 Constrined Optimiztion Februry 9 Generl Problem min f( ) ( NLP) s.. t g ( ) i E i g ( ) i I i Modeling nd Constrints Adding constrints let s us model fr more richer set of problems. For our purpose we

More information

From Indexing Data Structures to de Bruijn Graphs

From Indexing Data Structures to de Bruijn Graphs From Indexing Dt Structures to de Bruijn Grphs Bstien Czux, Thierry Lecroq, Eric Rivls LIRMM & IBC, Montpellier - LITIS Rouen June 1, 201 Czux, Lecroq, Rivls (LIRMM) Generlized Suffix Tree & DBG June 1,

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

MPI Groups and Communicators

MPI Groups and Communicators MPI Groups nd Communictors We now lern techniques to modulrize communictions t more locl level so tht messges do not interfere with ech other We do this by setting up Groups of processes We then crete

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

Graphs with at most two trees in a forest building process

Graphs with at most two trees in a forest building process Grphs with t most two trees in forest uilding process rxiv:802.0533v [mth.co] 4 Fe 208 Steve Butler Mis Hmnk Mrie Hrdt Astrct Given grph, we cn form spnning forest y first sorting the edges in some order,

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

MIPS I/O and Interrupt

MIPS I/O and Interrupt MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,

More information

Misrepresentation of Preferences

Misrepresentation of Preferences Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

A dual of the rectangle-segmentation problem for binary matrices

A dual of the rectangle-segmentation problem for binary matrices A dul of the rectngle-segmenttion prolem for inry mtrices Thoms Klinowski Astrct We consider the prolem to decompose inry mtrix into smll numer of inry mtrices whose -entries form rectngle. We show tht

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Data sharing in OpenMP

Data sharing in OpenMP Dt shring in OpenMP Polo Burgio polo.burgio@unimore.it Outline Expressing prllelism Understnding prllel threds Memory Dt mngement Dt cluses Synchroniztion Brriers, locks, criticl sections Work prtitioning

More information

Slides for Data Mining by I. H. Witten and E. Frank

Slides for Data Mining by I. H. Witten and E. Frank Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully

More information

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls

More information

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples

COMPUTER SCIENCE 123. Foundations of Computer Science. 6. Tuples COMPUTER SCIENCE 123 Foundtions of Computer Science 6. Tuples Summry: This lecture introduces tuples in Hskell. Reference: Thompson Sections 5.1 2 R.L. While, 2000 3 Tuples Most dt comes with structure

More information

6.2 Volumes of Revolution: The Disk Method

6.2 Volumes of Revolution: The Disk Method mth ppliction: volumes by disks: volume prt ii 6 6 Volumes of Revolution: The Disk Method One of the simplest pplictions of integrtion (Theorem 6) nd the ccumultion process is to determine so-clled volumes

More information

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam. 15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

Lists in Lisp and Scheme

Lists in Lisp and Scheme Lists in Lisp nd Scheme Lists in Lisp nd Scheme Lists re Lisp s fundmentl dt structures, ut there re others Arrys, chrcters, strings, etc. Common Lisp hs moved on from eing merely LISt Processor However,

More information