Introduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example

Size: px
Start display at page:

Download "Introduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example"

Transcription

1 Introduction to Computer Engineering EECS 23 dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: Phone: TA: Nel Oz Office: Tech. Inst. L375 Phone: Emil: C TT: Dvid Bild Office: Tech. Inst. L47 Phone: Emil: A B C 3 R. Dick Introduction to Computer Engineering EECS 23 Other TG digrm TG exmple b b f 4 R. Dick Introduction to Computer Engineering EECS 23 5 R. Dick Introduction to Computer Engineering EECS 23 Impct of control on input Prctice w/ Boolen Minimiztion = = TG s resistnce Simplify this expression so tht it hs the miniml possible literl count: b b cd TG s resistnce s internl resistnce 6 R. Dick Introduction to Computer Engineering EECS 23 8 R. Dick Introduction to Computer Engineering EECS 23 Two-Level Logic nd Cnonicl Forms Cnonicl forms - SOP The previous exmple illustrted one stndrd representtion product of sums. These stndrd forms re known collectively s two-level logic: Product of Sums POS e.g. Sum of Products SOP e.g. f = b b f = b b For Sum of Products SOP the cnonicl form is constructed out of minterms. Product term in which ll vribles pper in complemented or uncomplemented forms once For n n-input function corresponds to one of of 2 n possible input combintions Use binry representtion to enumerte minterms Cn you see why these two re equivlent? Why is this known s two-level logic? 9 R. Dick Introduction to Computer Engineering EECS 23 R. Dick Introduction to Computer Engineering EECS 23

2 Cnonicl forms SOP Using Cnonicl Sum of Products Representtion x y z term symbol m m m 2 m 3 m 4 m 5 m 6 m 7 x y z m x y z m x yz m 2 x yz m 3 xy z m 4 xy z m 5 xyz m 6 xyz m 7 Convenient representtion uses opertor nd minterms: f x,...,x n = m i For given function f, list ll minterms for which the function is true: f,b,c = b c = m 6 m 7 m m 2 = m,2,6,7 R. Dick Introduction to Computer Engineering EECS 23 2 R. Dick Introduction to Computer Engineering EECS 23 Cnonicl forms POS Cnonicl forms POS For Products of Sums POS the cnonicl form is constructed out of mxterms. Sum term in which ll vribles pper in complemented or uncomplemented forms once Use binry representtion to enumerte mxterms note: function is not true for mxterms x y z term symbol M M M 2 M 3 M 4 M 5 M 6 M 7 x y z M x y z M x y z M 2 x y z M 3 x y z M 4 x y z M 5 x y z M 6 x y z M 7 3 R. Dick Introduction to Computer Engineering EECS 23 4 R. Dick Introduction to Computer Engineering EECS 23 Using Cnonicl Products of Sums Representtion More exmples of two-level logic Convenient representtion uses opertor nd minterms: f x,...,x n = M i f,b,c,d = m,4,8,,3,5 For given function f, list ll mxterms for which the function is flse: f,b,c = c b = M M 3 M 4 M 5 = M,3,4,5 f w,x,y,z = M5,3,4 f u,v = u u v 5 R. Dick Introduction to Computer Engineering EECS 23 6 R. Dick Introduction to Computer Engineering EECS 23 Logic minimiztion motivtion Logic minimiztion motivtion Wnt to reduce re, power consumption, dely of circuits Hrd to exctly predict circuit re from equtions Cn pproximte re with SOP cubes Minimize number of cubes nd literls in ech cube Algebric simplifiction difficult Hrd to gurntee optimlity K-mps work well for smll problems Too error-prone for lrge problems Don t ensure optiml prime implicnt selection Quine-McCluskey optiml nd cn be run by computer Too slow on lrge problems Some dvnced heuristics usully get good results fst on lrge problems Wnt to lern how these work nd how to use them? Tke Advnced Digitl Logic Design 7 R. Dick Introduction to Computer Engineering EECS 23 8 R. Dick Introduction to Computer Engineering EECS 23

3 Boolen function minimiztion Krnugh mps K-mps Algebric simplifiction Not systemtic How do you know when optiml solution hs been reched? Optiml lgorithm, e.g., Quine-McCluskey Only fst enough for smll problems Understnding these is foundtion for understnding more dvnced methods Not necessrily optiml heuristics Fst enough to hndle lrge problems Fundmentl ttribute is djcency Useful for logic synthesis Helps logic function visuliztion Generl Ide: Circle groups of output vlues typiclly s Result: Circled terms correspond to minimized product terms 9 R. Dick Introduction to Computer Engineering EECS 23 2 R. Dick Introduction to Computer Engineering EECS 23 Krnugh mps Sum of products SOP - Truth tble b b c b d c b bc b cd b f f = b b 22 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Sum of products SOP - KMp Some definitions Equivlent wy of expressing the sme function: implicnt - product term or sum term which covers/includes one or more minterms or mxterms prime implicnt - implicnt tht cnnot be covered by more generl implicnt i.e. one with fewer literls essentil prime implicnts - cover n output of the function tht no other prime implicnt or sum thereof is ble to cover b b 24 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Implicnts K-mp exmple For now, tret s wildcrd f,b,c bc Minimize f,b,c,d =,3,8,9,,,3 f, b, c, d = b b d c d Prime implicnts re not covered by other implicnts Essentil prime implicnts uniquely cover minterms 26 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23

4 K-mp simplifiction technique K-mp simplifiction technique For ll minterms Find mximl groupings of s nd X s djcent to tht minterm. Remember to consider top/bottom row, left/right column, nd corner djcencies. These re the prime implicnts. Revisit the s elements in the K-mp. If covered by single prime implicnt, the prime is essentil, nd prticiptes in finl cover. The s it covers do not need to be revisited. 28 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 K-mp simplifiction technique Product of sums POS If there remin s not covered by essentil prime implicnts, Then select the smllest number of prime implicnts tht cover the remining s. This cn be difficult for complicted functions. Will present n lgorithm for this in future lecture. b b 3 R. Dick Introduction to Computer Engineering EECS 23 3 R. Dick Introduction to Computer Engineering EECS 23 POS K-mp techniques POS K-mp exmple Or Direct reding by covering zeros nd inverting vribles Invert function Do SOP Invert gin Apply De Morgn s lws Minimize f,b,c = 2,4,5,6 f,b,c = b c b 32 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 SOP from Krnugh mp Six-vrible K-mp exmple z,b,c,d,e,f = 2,8,,8,24,26,34,37,42,45,5,53,58,6 34 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23

5 Six-vrible K-mp exmple Six-vrible K-mp exmple EF AB = EF AB = EF AB = EF AB = EF AB = EF AB = EF AB = EF AB = z,b,c,d,e,f = d ef de f Cd f 36 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Don t Cre logic Don t Cre vlues All specified Boolen vlues re or However, during design some vlues my be unspecified Don t cre vlues s llow circuit optimiztion, i.e., Incompletely specified functions llow optimiztion Insted, leve these vlues undefined Also clled Don t Cre vlues Allows ny function implementing the specified vlues to be used E.g., could use b b However, best to use simpler 38 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Stisfibility Don t Cres Observbility Don t Cres brke sensor wheel sensor 8 32 decision output pply brke pulse brke invlid output relese brke Input cn never occur This cn hppen within circuit Some modules will not be cpble of producing certin outputs < Output will be ignored for certin inputs 4 R. Dick Introduction to Computer Engineering EECS 23 4 R. Dick Introduction to Computer Engineering EECS 23 Don t cre K-mp exmple is necessry Minimize f w,x,y,z =,3,8,9,,,3 d5,7,5 f w,x,y,z = wx z Some Boolen functions cn not be represented with one logic level b b 42 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23

6 is sufficient f,b b Two-level well-understood As we will see lter, optiml minimiztion techniques known for two-level However, optiml two-level solution my not be optiml solution Sometimes suboptiml solution to the right problem is better thn the optiml solution to the wrong problem All Boolen functions cn be represented with two logic levels Given k vribles, 2 K minterm functions exist Select rbitrry union of minterms 44 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Two-level sometimes imprcticl f,b,c,d b cd Consider 4-term XOR prity gte: b c d b c d b cd bc d bcd bc d bcd b c d b cd Two-level wekness Two-level representtion is exponentil However, it s simple concept Is n i x i odd? Problem with representtion, not function 46 R. Dick Introduction to Computer Engineering EECS R. Dick Introduction to Computer Engineering EECS 23 Two-level wekness Reding ssignment Two-level representtions lso hve other weknesses Conversion from SOP to POS is difficult Inverting functions is difficult -ing two SOPs or ing two POSs is difficult Neither generl POS or SOP re cnonicl Equivlence checking difficult POS stisfibility N P-complete M. Morris Mno nd Chrles R. Kime. Logic nd Computer Design Fundmentls. Prentice-Hll, NJ, fourth edition, 28 Section 2.6 Also red TTL reference, Don Lncster. TTL Cookbook. Howrd W. Sms & Co., Inc., 974, s needed 48 R. Dick Introduction to Computer Engineering EECS 23 5 R. Dick Introduction to Computer Engineering EECS 23

Digital Design. Chapter 6: Optimizations and Tradeoffs

Digital Design. Chapter 6: Optimizations and Tradeoffs Digitl Design Chpter 6: Optimiztions nd Trdeoffs Slides to ccompny the tetbook Digitl Design, with RTL Design, VHDL, nd Verilog, 2nd Edition, by Frnk Vhid, John Wiley nd Sons Publishers, 2. http://www.ddvhid.com

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction

More information

Introduction to Integration

Introduction to Integration Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.

More information

CS2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014

CS2204 DIGITAL LOGIC & STATE MACHINE DESIGN SPRING 2014 CS DIGITAL LOGIC & STATE MACHINE DESIGN SPRING DUE : April 7, HOMEWOR V READ : Relted portions of Chpters III, IV, VI, VII nd VIII ASSIGNMENT : There re seven questions Solve ll homework nd exm problems

More information

Lecture T4: Pattern Matching

Lecture T4: Pattern Matching Introduction to Theoreticl CS Lecture T4: Pttern Mtching Two fundmentl questions. Wht cn computer do? How fst cn it do it? Generl pproch. Don t tlk bout specific mchines or problems. Consider miniml bstrct

More information

Advanced Digital Logic Design EECS 303

Advanced Digital Logic Design EECS 303 Advanced Digital Logic Design EECS 303 http://ziyang.eecs.northwestern.edu/eecs303/ Teacher: Robert Dick Office: L477 Tech Email: dickrp@northwestern.edu Phone: 847 467 2298 Outline 1. 2. 2 Robert Dick

More information

Basics of Logic Design Arithmetic Logic Unit (ALU)

Basics of Logic Design Arithmetic Logic Unit (ALU) Bsics of Logic Design Arithmetic Logic Unit (ALU) CPS 4 Lecture 9 Tody s Lecture Homework #3 Assigned Due Mrch 3 Project Groups ssigned & posted to lckord. Project Specifiction is on We Due April 9 Building

More information

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers

4452 Mathematical Modeling Lecture 4: Lagrange Multipliers Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl

More information

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork

MA1008. Calculus and Linear Algebra for Engineers. Course Notes for Section B. Stephen Wills. Department of Mathematics. University College Cork MA1008 Clculus nd Liner Algebr for Engineers Course Notes for Section B Stephen Wills Deprtment of Mthemtics University College Cork s.wills@ucc.ie http://euclid.ucc.ie/pges/stff/wills/teching/m1008/ma1008.html

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012

Math 464 Fall 2012 Notes on Marginal and Conditional Densities October 18, 2012 Mth 464 Fll 2012 Notes on Mrginl nd Conditionl Densities klin@mth.rizon.edu October 18, 2012 Mrginl densities. Suppose you hve 3 continuous rndom vribles X, Y, nd Z, with joint density f(x,y,z. The mrginl

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Improper Integrals. October 4, 2017

Improper Integrals. October 4, 2017 Improper Integrls October 4, 7 Introduction We hve seen how to clculte definite integrl when the it is rel number. However, there re times when we re interested to compute the integrl sy for emple 3. Here

More information

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES)

1. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) Numbers nd Opertions, Algebr, nd Functions 45. SEQUENCES INVOLVING EXPONENTIAL GROWTH (GEOMETRIC SEQUENCES) In sequence of terms involving eponentil growth, which the testing service lso clls geometric

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES

SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES SOME EXAMPLES OF SUBDIVISION OF SMALL CATEGORIES MARCELLO DELGADO Abstrct. The purpose of this pper is to build up the bsic conceptul frmework nd underlying motivtions tht will llow us to understnd ctegoricl

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

INTRODUCTION TO SIMPLICIAL COMPLEXES

INTRODUCTION TO SIMPLICIAL COMPLEXES INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min

More information

MATH 25 CLASS 5 NOTES, SEP

MATH 25 CLASS 5 NOTES, SEP MATH 25 CLASS 5 NOTES, SEP 30 2011 Contents 1. A brief diversion: reltively prime numbers 1 2. Lest common multiples 3 3. Finding ll solutions to x + by = c 4 Quick links to definitions/theorems Euclid

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015

Finite Automata. Lecture 4 Sections Robb T. Koether. Hampden-Sydney College. Wed, Jan 21, 2015 Finite Automt Lecture 4 Sections 3.6-3.7 Ro T. Koether Hmpden-Sydney College Wed, Jn 21, 2015 Ro T. Koether (Hmpden-Sydney College) Finite Automt Wed, Jn 21, 2015 1 / 23 1 Nondeterministic Finite Automt

More information

Subtracting Fractions

Subtracting Fractions Lerning Enhncement Tem Model Answers: Adding nd Subtrcting Frctions Adding nd Subtrcting Frctions study guide. When the frctions both hve the sme denomintor (bottom) you cn do them using just simple dding

More information

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras

CS 130 : Computer Systems - II. Shankar Balachandran Dept. of Computer Science & Engineering IIT Madras CS 3 : Computer Systems - II Shnkr Blchndrn (shnkr@cse.iitm.c.in) Dept. of Computer Science & Engineering IIT Mdrs Recp Differentite Between s nd s Truth Tbles b AND b OR NOT September 4, 27 Introduction

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

Theory of Computation CSE 105

Theory of Computation CSE 105 $ $ $ Theory of Computtion CSE 105 Regulr Lnguges Study Guide nd Homework I Homework I: Solutions to the following problems should be turned in clss on July 1, 1999. Instructions: Write your nswers clerly

More information

Gate-Level Minimization. BME208 Logic Circuits Yalçın İŞLER

Gate-Level Minimization. BME208 Logic Circuits Yalçın İŞLER Gate-Level Minimization BME28 Logic Circuits Yalçın İŞLER islerya@yahoo.com http://me.islerya.com Complexity of Digital Circuits Directly related to the complexity of the algebraic expression we use to

More information

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):

Before We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1): Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters

More information

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards

A Tautology Checker loosely related to Stålmarck s Algorithm by Martin Richards A Tutology Checker loosely relted to Stålmrck s Algorithm y Mrtin Richrds mr@cl.cm.c.uk http://www.cl.cm.c.uk/users/mr/ University Computer Lortory New Museum Site Pemroke Street Cmridge, CB2 3QG Mrtin

More information

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals

Double Integrals. MATH 375 Numerical Analysis. J. Robert Buchanan. Fall Department of Mathematics. J. Robert Buchanan Double Integrals Double Integrls MATH 375 Numericl Anlysis J. Robert Buchnn Deprtment of Mthemtics Fll 2013 J. Robert Buchnn Double Integrls Objectives Now tht we hve discussed severl methods for pproximting definite integrls

More information

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig

CS311H: Discrete Mathematics. Graph Theory IV. A Non-planar Graph. Regions of a Planar Graph. Euler s Formula. Instructor: Işıl Dillig CS311H: Discrete Mthemtics Grph Theory IV Instructor: Işıl Dillig Instructor: Işıl Dillig, CS311H: Discrete Mthemtics Grph Theory IV 1/25 A Non-plnr Grph Regions of Plnr Grph The plnr representtion of

More information

In the last lecture, we discussed how valid tokens may be specified by regular expressions.

In the last lecture, we discussed how valid tokens may be specified by regular expressions. LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

10/9/2012. Operator is an operation performed over data at runtime. Arithmetic, Logical, Comparison, Assignment, Etc. Operators have precedence

10/9/2012. Operator is an operation performed over data at runtime. Arithmetic, Logical, Comparison, Assignment, Etc. Operators have precedence /9/22 P f Performing i Si Simple l Clcultions C l l ti with ith C#. Opertors in C# nd Opertor Precedence 2. Arithmetic Opertors 3. Logicl Opertors 4. Bitwise Opertors 5. Comprison Opertors 6. Assignment

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Today s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued)

Today s Lecture. Basics of Logic Design: Boolean Algebra, Logic Gates. Recursive Example. Review: The C / C++ code. Recursive Example (Continued) Tod s Lecture Bsics of Logic Design: Boolen Alger, Logic Gtes Alvin R. Leeck CPS 4 Lecture 8 Homework #2 Due Ferur 3 Outline Review (sseml recursion) Building the uilding locks Logic Design Truth tles,

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

Elena Baralis, Silvia Chiusano Politecnico di Torino. Pag. 1. Query optimization. DBMS Architecture. Query optimizer. Query optimizer.

Elena Baralis, Silvia Chiusano Politecnico di Torino. Pag. 1. Query optimization. DBMS Architecture. Query optimizer. Query optimizer. DBMS Architecture SQL INSTRUCTION OPTIMIZER Dtbse Mngement Systems MANAGEMENT OF ACCESS METHODS BUFFER MANAGER CONCURRENCY CONTROL RELIABILITY MANAGEMENT Index Files Dt Files System Ctlog DATABASE 2 Query

More information

Integration. September 28, 2017

Integration. September 28, 2017 Integrtion September 8, 7 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers?

Questions About Numbers. Number Systems and Arithmetic. Introduction to Binary Numbers. Negative Numbers? Questions About Numbers Number Systems nd Arithmetic or Computers go to elementry school How do you represent negtive numbers? frctions? relly lrge numbers? relly smll numbers? How do you do rithmetic?

More information

9 Graph Cutting Procedures

9 Graph Cutting Procedures 9 Grph Cutting Procedures Lst clss we begn looking t how to embed rbitrry metrics into distributions of trees, nd proved the following theorem due to Brtl (1996): Theorem 9.1 (Brtl (1996)) Given metric

More information

A B AB CD Objectives:

A B AB CD Objectives: Objectives:. Four variables maps. 2. Simplification using prime implicants. 3. "on t care" conditions. 4. Summary.. Four variables Karnaugh maps Minterms A A m m m3 m2 A B C m4 C A B C m2 m8 C C m5 C m3

More information

Karnaugh Map (K-Map) Karnaugh Map. Karnaugh Map Examples. Ch. 2.4 Ch. 2.5 Simplification using K-map

Karnaugh Map (K-Map) Karnaugh Map. Karnaugh Map Examples. Ch. 2.4 Ch. 2.5 Simplification using K-map Karnaugh Map (K-Map) Ch. 2.4 Ch. 2.5 Simplification using K-map A graphical map method to simplify Boolean function up to 6 variables A diagram made up of squares Each square represents one minterm (or

More information

Chapter 2 Combinational Logic Circuits

Chapter 2 Combinational Logic Circuits Logic and Computer Design Fundamentals Chapter 2 Combinational Logic Circuits Part 2 Circuit Optimization Overview Part Gate Circuits and Boolean Equations Binary Logic and Gates Boolean Algebra Standard

More information

Misrepresentation of Preferences

Misrepresentation of Preferences Misrepresenttion of Preferences Gicomo Bonnno Deprtment of Economics, University of Cliforni, Dvis, USA gfbonnno@ucdvis.edu Socil choice functions Arrow s theorem sys tht it is not possible to extrct from

More information

10.5 Graphing Quadratic Functions

10.5 Graphing Quadratic Functions 0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions

More information

Lecture T1: Pattern Matching

Lecture T1: Pattern Matching Introduction to Theoreticl CS Lecture T: Pttern Mtchin Two fundmentl questions. Wht cn computer do? Wht cn computer do with limited resources? Generl pproch. Don t tlk out specific mchines or prolems.

More information

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X

a(e, x) = x. Diagrammatically, this is encoded as the following commutative diagrams / X 4. Mon, Sept. 30 Lst time, we defined the quotient topology coming from continuous surjection q : X! Y. Recll tht q is quotient mp (nd Y hs the quotient topology) if V Y is open precisely when q (V ) X

More information

Approximation by NURBS with free knots

Approximation by NURBS with free knots pproximtion by NURBS with free knots M Rndrinrivony G Brunnett echnicl University of Chemnitz Fculty of Computer Science Computer Grphics nd Visuliztion Strße der Ntionen 6 97 Chemnitz Germny Emil: mhrvo@informtiktu-chemnitzde

More information

Pointwise convergence need not behave well with respect to standard properties such as continuity.

Pointwise convergence need not behave well with respect to standard properties such as continuity. Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

CSE 401 Midterm Exam 11/5/10 Sample Solution

CSE 401 Midterm Exam 11/5/10 Sample Solution Question 1. egulr expressions (20 points) In the Ad Progrmming lnguge n integer constnt contins one or more digits, but it my lso contin embedded underscores. Any underscores must be preceded nd followed

More information

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have

P(r)dr = probability of generating a random number in the interval dr near r. For this probability idea to make sense we must have Rndom Numers nd Monte Crlo Methods Rndom Numer Methods The integrtion methods discussed so fr ll re sed upon mking polynomil pproximtions to the integrnd. Another clss of numericl methods relies upon using

More information

How to Design REST API? Written Date : March 23, 2015

How to Design REST API? Written Date : March 23, 2015 Visul Prdigm How Design REST API? Turil How Design REST API? Written Dte : Mrch 23, 2015 REpresenttionl Stte Trnsfer, n rchitecturl style tht cn be used in building networked pplictions, is becoming incresingly

More information

2014 Haskell January Test Regular Expressions and Finite Automata

2014 Haskell January Test Regular Expressions and Finite Automata 0 Hskell Jnury Test Regulr Expressions nd Finite Automt This test comprises four prts nd the mximum mrk is 5. Prts I, II nd III re worth 3 of the 5 mrks vilble. The 0 Hskell Progrmming Prize will be wrded

More information

Ray surface intersections

Ray surface intersections Ry surfce intersections Some primitives Finite primitives: polygons spheres, cylinders, cones prts of generl qudrics Infinite primitives: plnes infinite cylinders nd cones generl qudrics A finite primitive

More information

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs.

If you are at the university, either physically or via the VPN, you can download the chapters of this book as PDFs. Lecture 5 Wlks, Trils, Pths nd Connectedness Reding: Some of the mteril in this lecture comes from Section 1.2 of Dieter Jungnickel (2008), Grphs, Networks nd Algorithms, 3rd edition, which is ville online

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Digital Design. Chapter 4. Principles Of. Simplification of Boolean Functions

Digital Design. Chapter 4. Principles Of. Simplification of Boolean Functions Principles Of Digital Design Chapter 4 Simplification of Boolean Functions Karnaugh Maps Don t Care Conditions Technology Mapping Optimization, Conversions, Decomposing, Retiming Boolean Cubes for n =,

More information

University of Technology

University of Technology University of Technology Lecturer: Dr. Sinan Majid Course Title: microprocessors 4 th year Lecture 5 & 6 Minimization with Karnaugh Maps Karnaugh maps lternate way of representing oolean function ll rows

More information

Assignment (3-6) Boolean Algebra and Logic Simplification - General Questions

Assignment (3-6) Boolean Algebra and Logic Simplification - General Questions Assignment (3-6) Boolean Algebra and Logic Simplification - General Questions 1. Convert the following SOP expression to an equivalent POS expression. 2. Determine the values of A, B, C, and D that make

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

Rational Numbers---Adding Fractions With Like Denominators.

Rational Numbers---Adding Fractions With Like Denominators. Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b

More information

Gate Level Minimization Map Method

Gate Level Minimization Map Method Gate Level Minimization Map Method Complexity of hardware implementation is directly related to the complexity of the algebraic expression Truth table representation of a function is unique Algebraically

More information

Supplement to. Logic and Computer Design Fundamentals 4th Edition 1

Supplement to. Logic and Computer Design Fundamentals 4th Edition 1 Supplement to Logic and Computer esign Fundamentals 4th Edition MORE OPTIMIZTION Selected topics not covered in the fourth edition of Logic and Computer esign Fundamentals are provided here for optional

More information

Get Free notes at Module-I One s Complement: Complement all the bits.i.e. makes all 1s as 0s and all 0s as 1s Two s Complement: One s complement+1 SIGNED BINARY NUMBERS Positive integers (including zero)

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Digital Logic Lecture 7 Gate Level Minimization

Digital Logic Lecture 7 Gate Level Minimization Digital Logic Lecture 7 Gate Level Minimization By Ghada Al-Mashaqbeh The Hashemite University Computer Engineering Department Outline Introduction. K-map principles. Simplification using K-maps. Don t-care

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits

Systems I. Logic Design I. Topics Digital logic Logic gates Simple combinational logic circuits Systems I Logic Design I Topics Digitl logic Logic gtes Simple comintionl logic circuits Simple C sttement.. C = + ; Wht pieces of hrdwre do you think you might need? Storge - for vlues,, C Computtion

More information

Chapter 3. Gate-Level Minimization. Outlines

Chapter 3. Gate-Level Minimization. Outlines Chapter 3 Gate-Level Minimization Introduction The Map Method Four-Variable Map Five-Variable Map Outlines Product of Sums Simplification Don t-care Conditions NAND and NOR Implementation Other Two-Level

More information

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an

Scanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Companion Mathematica Notebook for "What is The 'Equal Weight View'?"

Companion Mathematica Notebook for What is The 'Equal Weight View'? Compnion Mthemtic Notebook for "Wht is The 'Equl Weight View'?" Dvid Jehle & Brnden Fitelson July 9 The methods used in this notebook re specil cses of more generl decision procedure

More information

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula:

50 AMC LECTURES Lecture 2 Analytic Geometry Distance and Lines. can be calculated by the following formula: 5 AMC LECTURES Lecture Anlytic Geometry Distnce nd Lines BASIC KNOWLEDGE. Distnce formul The distnce (d) between two points P ( x, y) nd P ( x, y) cn be clculted by the following formul: d ( x y () x )

More information

Floating Point Numbers and Interval Arithmetic

Floating Point Numbers and Interval Arithmetic 480: 05092008 -- floting point; intervl rith Floting Point Numbers nd Intervl Arithmetic Are floting point numbers just broken? (from http://www.cs.princeton.edu/introcs) To mthemticin like me floting

More information

Advanced Digital Logic Design EECS 303

Advanced Digital Logic Design EECS 303 Advanced Digital Logic Design EECS 303 http://ziyang.eecs.northwestern.edu/eecs303/ Teacher: Robert Dick Office: L477 Tech Email: dickrp@northwestern.edu Phone: 847 467 2298 Outline 1. Finite state machines

More information

Integration. October 25, 2016

Integration. October 25, 2016 Integrtion October 5, 6 Introduction We hve lerned in previous chpter on how to do the differentition. It is conventionl in mthemtics tht we re supposed to lern bout the integrtion s well. As you my hve

More information

CMPUT101 Introduction to Computing - Summer 2002

CMPUT101 Introduction to Computing - Summer 2002 CMPUT Introdution to Computing - Summer 22 %XLOGLQJ&RPSXWHU&LUFXLWV Chpter 4.4 3XUSRVH We hve looked t so fr how to uild logi gtes from trnsistors. Next we will look t how to uild iruits from logi gtes,

More information

IT 201 Digital System Design Module II Notes

IT 201 Digital System Design Module II Notes IT 201 Digital System Design Module II Notes BOOLEAN OPERATIONS AND EXPRESSIONS Variable, complement, and literal are terms used in Boolean algebra. A variable is a symbol used to represent a logical quantity.

More information

Scanner Termination. Multi Character Lookahead

Scanner Termination. Multi Character Lookahead If d.doublevlue() represents vlid integer, (int) d.doublevlue() will crete the pproprite integer vlue. If string representtion of n integer begins with ~ we cn strip the ~, convert to double nd then negte

More information

Specifying logic functions

Specifying logic functions CSE4: Components and Design Techniques for Digital Systems Specifying logic functions Instructor: Mohsen Imani Slides from: Prof.Tajana Simunic and Dr.Pietro Mercati We have seen various concepts: Last

More information

CHAPTER-2 STRUCTURE OF BOOLEAN FUNCTION USING GATES, K-Map and Quine-McCluskey

CHAPTER-2 STRUCTURE OF BOOLEAN FUNCTION USING GATES, K-Map and Quine-McCluskey CHAPTER-2 STRUCTURE OF BOOLEAN FUNCTION USING GATES, K-Map and Quine-McCluskey 2. Introduction Logic gates are connected together to produce a specified output for certain specified combinations of input

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Small Business Networking

Small Business Networking Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

Dr. D.M. Akbar Hussain

Dr. D.M. Akbar Hussain Dr. D.M. Akr Hussin Lexicl Anlysis. Bsic Ide: Red the source code nd generte tokens, it is similr wht humns will do to red in; just tking on the input nd reking it down in pieces. Ech token is sequence

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Switching Circuits & Logic Design

Switching Circuits & Logic Design Switching Circuits & Logic Design Jie-Hong Roland Jiang 江介宏 Department of Electrical Engineering National Taiwan University Fall 23 5 Karnaugh Maps K-map Walks and Gray Codes http://asicdigitaldesign.wordpress.com/28/9/26/k-maps-walks-and-gray-codes/

More information

1 Construct implication chart, one square for each combination of states. 2 Square labeled S i, S j, if outputs differ than square gets X (0).

1 Construct implication chart, one square for each combination of states. 2 Square labeled S i, S j, if outputs differ than square gets X (0). Advanced Digital Logic Design EECS 33 http://ziyang.eecs.northwestern.edu/eecs33/ FSM design overview Teacher: Robert Dick Office: L477 Tech Email: dickrp@northwestern.edu Phone: 847 467 2298 State diagram

More information

x )Scales are the reciprocal of each other. e

x )Scales are the reciprocal of each other. e 9. Reciprocls A Complete Slide Rule Mnul - eville W Young Chpter 9 Further Applictions of the LL scles The LL (e x ) scles nd the corresponding LL 0 (e -x or Exmple : 0.244 4.. Set the hir line over 4.

More information

Constrained Optimization. February 29

Constrained Optimization. February 29 Constrined Optimiztion Februry 9 Generl Problem min f( ) ( NLP) s.. t g ( ) i E i g ( ) i I i Modeling nd Constrints Adding constrints let s us model fr more richer set of problems. For our purpose we

More information