Phylogeny and Molecular Evolution

Size: px
Start display at page:

Download "Phylogeny and Molecular Evolution"

Transcription

1 Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50

2 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion Bioinformtics Algorithms book by Phillip Compeu nd Pvel Pvzner ll book photos shown in this lecture re from there. 2/50

3 Type of Tree Reconstruction Chrcter-bsed Input is multiple lignment of sequences (one sequence per species). Distnce-bsed Input is mtrix of distnces between species Distnce cn be the reltive length of the sequence which the two sequences disgree on, or lignment score between them, or (whtever) 3/62

4 Distnce Bsed Tree Reconstruction 4/62

5 Distnce Bsed Tree Reconstruction 5/62

6 UPGMA Algorithm (cont d) /62

7 Type of Tree Reconstruction Chrcter-bsed Input is multiple lignment of sequences (one sequence per species). Distnce-bsed Input is mtrix of distnces between species Distnce cn be the reltive length of the sequence which the two sequences disgree on, or lignment score between them, or (whtever) 8/62

8 Chrcter-bsed tble of winged nd wingless insects 9/62

9 Evolutionry Tree of Winged (red) nd Wingless (blue) Stick Insects bsed on 18S RiboxomlsRNA 10/50

10 11/50

11 Chrcter-Bsed Tree Reconstruction Chrcters my be nucleotides, where A, G, C, T re sttes of this chrcter. Other chrcters my be the # of eyes or legs or the shpe of bek or mouth By setting the length of n edge in the tree to the Hmming distnce, we my define the score of the tree s the sum of the lengths (weights) of the edges 12/50

12 Exmple With Single Letter Sequences Suppose we hve five species, such tht three hve C nd two T t specified position Miniml tree hs only one evolutionry chnge: C C C C C T T T T C 13/50

13 Prsimony Approch to Evolutionry Tree Reconstruction Applies Occm s rzor principle to identify the simplest explntion for the dt Assumes observed chrcter differences resulted from the fewest possible muttions Seeks the tree tht yields lowest possible prsimony score - sum of cost of ll muttions found in the tree

14 Prsimony nd Tree Reconstruction

15 Prsimony nd Tree Reconstruction

16 Prsimony nd Tree Reconstruction

17 Smll Prsimony Problem Input: Tree T with ech lef lbeled by n m- chrcter string. Output: Lbeling of internl vertices of the tree T minimizing the prsimony score. We cn ssume tht every lef is lbeled by single chrcter, becuse the chrcters in string re independent. 18/50

18 Phylogenetic Trees 19/62

19 Chrcter-Bsed Smll Prsimony 20/50

20 Chrcter-Bsed Smll Prsimony 21/50

21 Chrcter-Bsed Smll Prsimony 22/50

22 Chrcter-Bsed Smll Prsimony 23/50

23 Extension to Mny Letters Wht is the prsimony score of Ardvrk Bison Chimp Dog Elephnt A: CAGGTA B: CAGACA C: CGGGTA D: TGCACT E: TGCGTA When the tree is known, we cn do it chrcter fter chrcter; ech score is computed independently of the others. 24/50

24 Smll Prsimony Minimizing Totl Hmming Distnce A T G C /50

25 Fitch Algorithm (Tree is Given) Work on ech position in string independently. Strt t the leves. If two children hve common chrcter, prent inherits it. Record union nd go up. After reching root, go down to fix sets of size > 1. A A A/C A/T A A C T A 26/50

26 Fitch s Algorithm, More Formlly trverse tree from leves to root determining set of possible sttes (e.g. nucleotides) for ech internl node trverse tree from root to leves picking ncestrl sttes for internl nodes 27/50

27 Fitch s Algorithm Step 1 do post-order (from leves to root) trversl of tree Determine possible sttes R i of internl node i with children j nd k R i R R j j R R k k if R j R otherwise k 28/50

28 C T G T A T 29/50

29 Fitch s Algorithm Step 1 # of chnges = # union opertions C T G T A T 30/50

30 Fitch s Algorithm Step 1 # of chnges = # union opertions T T AGT CT GT C T G T A T 31/50

31 Fitch s Algorithm Step 2 do pre-order (from root to leves) trversl of tree select stte r j of internl node j with prent i s follows: r j ri if ri rbitrry R j stte R j otherwise 32/50

32 Fitch s Algorithm Step 1 # of chnges = # union opertions T T AGT CT GT C T G T A T 33/50

33 Fitch s Algorithm Step 2 T T AGT CT GT C T A G T T 34/50

34 Fitch s Algorithm (cont d) Another exmple: c t 35/50

35 Fitch s Algorithm (cont d) Another exmple: c t {,c} {t,} c t

36 Fitch s Algorithm (cont d) Another exmple: c t {,c} {t,} {,c} c t {t,} c t

37 Fitch s Algorithm (cont d) Another exmple: c t {,c} {t,} {,c} c t {t,} c t c t 38/50

38 39/50

39 Weighted Prsimony Weighted Prsimony score: Ech chnge is weighted by score c(,b). The weighted prsimony score reduces to the prsimony score when c(,)=0 nd c(,b)=1 for ll b. A T G C /50

40 Weighted Prsimony on Given Tree (Snkoff) Ech position is independent nd computed by itself. Use Dynmic progrmming on given tree. if k is node with children i nd j, then S(k,) = min b (S(i,b)+c(,b)) + min d (S(j,d)+c(,d)) S(i,b) i k S(k,) j S(j,d) S(j,d) the score of subtree rooted t j when j hs the chrcter d. 41/50

41 Evluting Prsimony Scores Dynmic progrmming on given tree Initiliztion: For ech lef i set S(i,) = 0 if i is lbeled by, otherwise S(i,) = Itertion: if k is node with children i nd j, then S(k,) = min x (S(i,x)+c(,x)) + min y (S(j,y)+c(,y)) Termintion: The cost of the tree is min x S(r,x) where r is the root Comment: If we keep in ech node for ech chrcter the two chrcters x, y tht bring bout the minimum, then we cn trce the best ssignment to ll internl nodes. 42/50

42 Snkoff s Algorithm An exmple A T G C A C T G For ech lef i set S(i,) = 0 if i is lbeled by, otherwise S(i,) =

43 Snkoff s Algorithm An exmple 0 A T G C A C T G if k is node with children i nd j, then S(k,) = min x (S(i,x)+c(,x)) + min y (S(j,y)+c(,y)) /50

44 Snkoff s Algorithm An exmple 0 A T G C if k is node with children i nd j, then S(k,) = min x (S(i,x)+c(,x)) + min y (S(j,y)+c(,y)) T T G A C T G /50

45 Complexity of Evluting (Smll) Prsimony If there re n nodes, m chrcters, nd s possible vlues for ech chrcter, then wht is the complexity of Snkoff s lgorithm for Smll Prsimony? 46/50

46 Complexity of Evluting (Smll) Prsimony If there re n nodes, m chrcters, nd s possible vlues for ech chrcter, then complexity is O(nms 2 ). Of course, in Lrge Prsimony we still need to serch over possible trees nd find the best one. One usully resorts to heuristic serch techniques. 47/50

47 48/50

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline

CSCI1950 Z Computa4onal Methods for Biology Lecture 2. Ben Raphael January 26, hhp://cs.brown.edu/courses/csci1950 z/ Outline CSCI1950 Z Comput4onl Methods for Biology Lecture 2 Ben Rphel Jnury 26, 2009 hhp://cs.brown.edu/courses/csci1950 z/ Outline Review of trees. Coun4ng fetures. Chrcter bsed phylogeny Mximum prsimony Mximum

More information

binary trees, expression trees

binary trees, expression trees COMP 250 Lecture 21 binry trees, expression trees Oct. 27, 2017 1 Binry tree: ech node hs t most two children. 2 Mximum number of nodes in binry tree? Height h (e.g. 3) 3 Mximum number of nodes in binry

More information

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey

Alignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment

More information

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries

Tries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer

More information

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:

Mid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID: Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht

More information

COMP 423 lecture 11 Jan. 28, 2008

COMP 423 lecture 11 Jan. 28, 2008 COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring

More information

Midterm 2 Sample solution

Midterm 2 Sample solution Nme: Instructions Midterm 2 Smple solution CMSC 430 Introduction to Compilers Fll 2012 November 28, 2012 This exm contins 9 pges, including this one. Mke sure you hve ll the pges. Write your nme on the

More information

Better Hill-Climbing Searches for Parsimony

Better Hill-Climbing Searches for Parsimony Better Hill-Climbing Serches for Prsimony Gneshkumr Gnpthy, Vijy Rmchndrn, nd Tndy Wrnow Deprtment of Computer Sciences, University of Texs, Austin, TX 78712; gsgk, vlr, tndy @cs.utexs.edu Abstrct. The

More information

CS481: Bioinformatics Algorithms

CS481: Bioinformatics Algorithms CS481: Bioinformtics Algorithms Cn Alkn EA509 clkn@cs.ilkent.edu.tr http://www.cs.ilkent.edu.tr/~clkn/teching/cs481/ EXACT STRING MATCHING Fingerprint ide Assume: We cn compute fingerprint f(p) of P in

More information

CSEP 573 Artificial Intelligence Winter 2016

CSEP 573 Artificial Intelligence Winter 2016 CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch

More information

COMBINATORIAL PATTERN MATCHING

COMBINATORIAL PATTERN MATCHING COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Adm Sheffer. Office hour: Tuesdys 4pm. dmsh@cltech.edu TA: Victor Kstkin. Office hour: Tuesdys 7pm. 1:00 Mondy, Wednesdy, nd Fridy. http://www.mth.cltech.edu/~2014-15/2term/m006/

More information

CS201 Discussion 10 DRAWTREE + TRIES

CS201 Discussion 10 DRAWTREE + TRIES CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the

More information

CS 268: IP Multicast Routing

CS 268: IP Multicast Routing Motivtion CS 268: IP Multicst Routing Ion Stoic April 5, 2004 Mny pplictions requires one-to-mny communiction - E.g., video/udio conferencing, news dissemintion, file updtes, etc. Using unicst to replicte

More information

Suffix trees, suffix arrays, BWT

Suffix trees, suffix arrays, BWT ALGORITHMES POUR LA BIO-INFORMATIQUE ET LA VISUALISATION COURS 3 Rluc Uricru Suffix trees, suffix rrys, BWT Bsed on: Suffix trees nd suffix rrys presenttion y Him Kpln Suffix trees course y Pco Gomez Liner-Time

More information

Presentation Martin Randers

Presentation Martin Randers Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes

More information

The Distributed Data Access Schemes in Lambda Grid Networks

The Distributed Data Access Schemes in Lambda Grid Networks The Distributed Dt Access Schemes in Lmbd Grid Networks Ryot Usui, Hiroyuki Miygi, Yutk Arkw, Storu Okmoto, nd Noki Ymnk Grdute School of Science for Open nd Environmentl Systems, Keio University, Jpn

More information

Orthogonal line segment intersection

Orthogonal line segment intersection Computtionl Geometry [csci 3250] Line segment intersection The prolem (wht) Computtionl Geometry [csci 3250] Orthogonl line segment intersection Applictions (why) Algorithms (how) A specil cse: Orthogonl

More information

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam.

Spring 2018 Midterm Exam 1 March 1, You may not use any books, notes, or electronic devices during this exam. 15-112 Spring 2018 Midterm Exm 1 Mrch 1, 2018 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for lnguge

More information

Ma/CS 6b Class 1: Graph Recap

Ma/CS 6b Class 1: Graph Recap M/CS 6 Clss 1: Grph Recp By Adm Sheffer Course Detils Instructor: Adm Sheffer. TA: Cosmin Pohot. 1pm Mondys, Wednesdys, nd Fridys. http://mth.cltech.edu/~2015-16/2term/m006/ Min ook: Introduction to Grph

More information

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup

Regular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson

More information

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming

Lecture 10 Evolutionary Computation: Evolution strategies and genetic programming Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting

More information

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation

Union-Find Problem. Using Arrays And Chains. A Set As A Tree. Result Of A Find Operation Union-Find Problem Given set {,,, n} of n elements. Initilly ech element is in different set. ƒ {}, {},, {n} An intermixed sequence of union nd find opertions is performed. A union opertion combines two

More information

What are suffix trees?

What are suffix trees? Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl

More information

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications.

Fall 2018 Midterm 1 October 11, ˆ You may not ask questions about the exam except for language clarifications. 15-112 Fll 2018 Midterm 1 October 11, 2018 Nme: Andrew ID: Recittion Section: ˆ You my not use ny books, notes, extr pper, or electronic devices during this exm. There should be nothing on your desk or

More information

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012

Dynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012 Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.

More information

Unit 5 Vocabulary. A function is a special relationship where each input has a single output.

Unit 5 Vocabulary. A function is a special relationship where each input has a single output. MODULE 3 Terms Definition Picture/Exmple/Nottion 1 Function Nottion Function nottion is n efficient nd effective wy to write functions of ll types. This nottion llows you to identify the input vlue with

More information

9.1 apply the distance and midpoint formulas

9.1 apply the distance and midpoint formulas 9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the

More information

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam.

Fall 2017 Midterm Exam 1 October 19, You may not use any books, notes, or electronic devices during this exam. 15-112 Fll 2017 Midterm Exm 1 October 19, 2017 Nme: Andrew ID: Recittion Section: You my not use ny books, notes, or electronic devices during this exm. You my not sk questions bout the exm except for

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016 Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl

More information

From Dependencies to Evaluation Strategies

From Dependencies to Evaluation Strategies From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute

More information

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants

A Heuristic Approach for Discovering Reference Models by Mining Process Model Variants A Heuristic Approch for Discovering Reference Models by Mining Process Model Vrints Chen Li 1, Mnfred Reichert 2, nd Andres Wombcher 3 1 Informtion System Group, University of Twente, The Netherlnds lic@cs.utwente.nl

More information

Chapter Spline Method of Interpolation More Examples Electrical Engineering

Chapter Spline Method of Interpolation More Examples Electrical Engineering Chpter. Spline Method of Interpoltion More Exmples Electricl Engineering Exmple Thermistors re used to mesure the temperture of bodies. Thermistors re bsed on mterils chnge in resistnce with temperture.

More information

CS 321 Programming Languages and Compilers. Bottom Up Parsing

CS 321 Programming Languages and Compilers. Bottom Up Parsing CS 321 Progrmming nguges nd Compilers Bottom Up Prsing Bottom-up Prsing: Shift-reduce prsing Grmmr H: fi ; fi b Input: ;;b hs prse tree ; ; b 2 Dt for Shift-reduce Prser Input string: sequence of tokens

More information

The Structure of Forward, Reverse, and Transverse Path Graphs in The Pattern Recognition Algorithms of Sellers

The Structure of Forward, Reverse, and Transverse Path Graphs in The Pattern Recognition Algorithms of Sellers The Structure of Forwrd, Reverse, nd Trnsverse Pth Grhs in The Pttern Recognition Algorithms of Sellers Lewis Lsser Dertment of Mthemtics nd Comuter Science York College/CUNY Jmic, New York 11451 llsser@york.cuny.edu

More information

Assignment 4. Due 09/18/17

Assignment 4. Due 09/18/17 Assignment 4. ue 09/18/17 1. ). Write regulr expressions tht define the strings recognized by the following finite utomt: b d b b b c c b) Write FA tht recognizes the tokens defined by the following regulr

More information

CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION

CIS 1068 Program Design and Abstraction Spring2015 Midterm Exam 1. Name SOLUTION CIS 1068 Progrm Design nd Astrction Spring2015 Midterm Exm 1 Nme SOLUTION Pge Points Score 2 15 3 8 4 18 5 10 6 7 7 7 8 14 9 11 10 10 Totl 100 1 P ge 1. Progrm Trces (41 points, 50 minutes) Answer the

More information

Parsimony-Based Approaches to Inferring Phylogenetic Trees

Parsimony-Based Approaches to Inferring Phylogenetic Trees Parsimony-Based Approaches to Inferring Phylogenetic Trees BMI/CS 576 www.biostat.wisc.edu/bmi576.html Mark Craven craven@biostat.wisc.edu Fall 0 Phylogenetic tree approaches! three general types! distance:

More information

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method

A New Learning Algorithm for the MAXQ Hierarchical Reinforcement Learning Method A New Lerning Algorithm for the MAXQ Hierrchicl Reinforcement Lerning Method Frzneh Mirzzdeh 1, Bbk Behsz 2, nd Hmid Beigy 1 1 Deprtment of Computer Engineering, Shrif University of Technology, Tehrn,

More information

Looking up objects in Pastry

Looking up objects in Pastry Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech

More information

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence

Solving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component

More information

Intermediate Information Structures

Intermediate Information Structures CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t

More information

Algorithm Design (5) Text Search

Algorithm Design (5) Text Search Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:

More information

ECE 468/573 Midterm 1 September 28, 2012

ECE 468/573 Midterm 1 September 28, 2012 ECE 468/573 Midterm 1 September 28, 2012 Nme:! Purdue emil:! Plese sign the following: I ffirm tht the nswers given on this test re mine nd mine lone. I did not receive help from ny person or mteril (other

More information

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search

Today. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods

More information

EECS 281: Homework #4 Due: Thursday, October 7, 2004

EECS 281: Homework #4 Due: Thursday, October 7, 2004 EECS 28: Homework #4 Due: Thursdy, October 7, 24 Nme: Emil:. Convert the 24-bit number x44243 to mime bse64: QUJD First, set is to brek 8-bit blocks into 6-bit blocks, nd then convert: x44243 b b 6 2 9

More information

UNIT 11. Query Optimization

UNIT 11. Query Optimization UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,

More information

On String Matching in Chunked Texts

On String Matching in Chunked Texts On String Mtching in Chunked Texts Hnnu Peltol nd Jorm Trhio {hpeltol, trhio}@cs.hut.fi Deprtment of Computer Science nd Engineering Helsinki University of Technology P.O. Box 5400, FI-02015 HUT, Finlnd

More information

CSCI 446: Artificial Intelligence

CSCI 446: Artificial Intelligence CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]

More information

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.

Today. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search. CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke

More information

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1.

Fig.1. Let a source of monochromatic light be incident on a slit of finite width a, as shown in Fig. 1. Answer on Question #5692, Physics, Optics Stte slient fetures of single slit Frunhofer diffrction pttern. The slit is verticl nd illuminted by point source. Also, obtin n expression for intensity distribution

More information

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials

Product of polynomials. Introduction to Programming (in C++) Numerical algorithms. Product of polynomials. Product of polynomials Product of polynomils Introduction to Progrmming (in C++) Numericl lgorithms Jordi Cortdell, Ricrd Gvldà, Fernndo Orejs Dept. of Computer Science, UPC Given two polynomils on one vrile nd rel coefficients,

More information

Eliminating left recursion grammar transformation. The transformed expression grammar

Eliminating left recursion grammar transformation. The transformed expression grammar Eliminting left recursion grmmr trnsformtion Originl! rnsformed! 0 0! 0 α β α α α α α α α α β he two grmmrs generte the sme lnguge, but the one on the right genertes the rst, nd then string of s, using

More information

such that the S i cover S, or equivalently S

such that the S i cover S, or equivalently S MATH 55 Triple Integrls Fll 16 1. Definition Given solid in spce, prtition of consists of finite set of solis = { 1,, n } such tht the i cover, or equivlently n i. Furthermore, for ech i, intersects i

More information

Definition of Regular Expression

Definition of Regular Expression Definition of Regulr Expression After the definition of the string nd lnguges, we re redy to descrie regulr expressions, the nottion we shll use to define the clss of lnguges known s regulr sets. Recll

More information

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe

CSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()

More information

2 Computing all Intersections of a Set of Segments Line Segment Intersection

2 Computing all Intersections of a Set of Segments Line Segment Intersection 15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design

More information

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1

a < a+ x < a+2 x < < a+n x = b, n A i n f(x i ) x. i=1 i=1 Mth 33 Volume Stewrt 5.2 Geometry of integrls. In this section, we will lern how to compute volumes using integrls defined by slice nlysis. First, we recll from Clculus I how to compute res. Given the

More information

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.

Very sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors. 6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!

More information

The Greedy Method. The Greedy Method

The Greedy Method. The Greedy Method Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm

More information

ASTs, Regex, Parsing, and Pretty Printing

ASTs, Regex, Parsing, and Pretty Printing ASTs, Regex, Prsing, nd Pretty Printing CS 2112 Fll 2016 1 Algeric Expressions To strt, consider integer rithmetic. Suppose we hve the following 1. The lphet we will use is the digits {0, 1, 2, 3, 4, 5,

More information

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong

LING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:

More information

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins.

Problem Set 2 Fall 16 Due: Wednesday, September 21th, in class, before class begins. Problem Set 2 Fll 16 Due: Wednesdy, September 21th, in clss, before clss begins. 1. LL Prsing For the following sub-problems, consider the following context-free grmmr: S T$ (1) T A (2) T bbb (3) A T (4)

More information

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers

What do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single

More information

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution

Tree Structured Symmetrical Systems of Linear Equations and their Graphical Solution Proceedings of the World Congress on Engineering nd Computer Science 4 Vol I WCECS 4, -4 October, 4, Sn Frncisco, USA Tree Structured Symmetricl Systems of Liner Equtions nd their Grphicl Solution Jime

More information

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation

Representation of Numbers. Number Representation. Representation of Numbers. 32-bit Unsigned Integers 3/24/2014. Fixed point Integer Representation Representtion of Numbers Number Representtion Computer represent ll numbers, other thn integers nd some frctions with imprecision. Numbers re stored in some pproximtion which cn be represented by fixed

More information

Engineer To Engineer Note

Engineer To Engineer Note Engineer To Engineer Note EE-169 Technicl Notes on using Anlog Devices' DSP components nd development tools Contct our technicl support by phone: (800) ANALOG-D or e-mil: dsp.support@nlog.com Or visit

More information

Lexical Analysis: Constructing a Scanner from Regular Expressions

Lexical Analysis: Constructing a Scanner from Regular Expressions Lexicl Anlysis: Constructing Scnner from Regulr Expressions Gol Show how to construct FA to recognize ny RE This Lecture Convert RE to n nondeterministic finite utomton (NFA) Use Thompson s construction

More information

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv

Compression Outline :Algorithms in the Real World. Lempel-Ziv Algorithms. LZ77: Sliding Window Lempel-Ziv Compression Outline 15-853:Algorithms in the Rel World Dt Compression III Introduction: Lossy vs. Lossless, Benchmrks, Informtion Theory: Entropy, etc. Proility Coding: Huffmn + Arithmetic Coding Applictions

More information

Enginner To Engineer Note

Enginner To Engineer Note Technicl Notes on using Anlog Devices DSP components nd development tools from the DSP Division Phone: (800) ANALOG-D, FAX: (781) 461-3010, EMAIL: dsp_pplictions@nlog.com, FTP: ftp.nlog.com Using n ADSP-2181

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007 CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:

More information

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li

Complete Coverage Path Planning of Mobile Robot Based on Dynamic Programming Algorithm Peng Zhou, Zhong-min Wang, Zhen-nan Li, Yang Li 2nd Interntionl Conference on Electronic & Mechnicl Engineering nd Informtion Technology (EMEIT-212) Complete Coverge Pth Plnning of Mobile Robot Bsed on Dynmic Progrmming Algorithm Peng Zhou, Zhong-min

More information

Angle Properties in Polygons. Part 1 Interior Angles

Angle Properties in Polygons. Part 1 Interior Angles 2.4 Angle Properties in Polygons YOU WILL NEED dynmic geometry softwre OR protrctor nd ruler EXPLORE A pentgon hs three right ngles nd four sides of equl length, s shown. Wht is the sum of the mesures

More information

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem

Announcements. CS 188: Artificial Intelligence Fall Recap: Search. Today. Example: Pancake Problem. Example: Pancake Problem Announcements Project : erch It s live! Due 9/. trt erly nd sk questions. It s longer thn most! Need prtner? Come up fter clss or try Pizz ections: cn go to ny, ut hve priority in your own C 88: Artificil

More information

Essential Question What are some of the characteristics of the graph of a rational function?

Essential Question What are some of the characteristics of the graph of a rational function? 8. TEXAS ESSENTIAL KNOWLEDGE AND SKILLS A..A A..G A..H A..K Grphing Rtionl Functions Essentil Question Wht re some of the chrcteristics of the grph of rtionl function? The prent function for rtionl functions

More information

Knowledge States: A Tool in Randomized Online Algorithms

Knowledge States: A Tool in Randomized Online Algorithms : A Tool in Rndomized Online Algorithms Center for the Advnced Study of Algorithms School of Computer Science University of Nevd, Ls Vegs ADS 2007 couthors: Lwrence L. Lrmore, John Nog, Rüdiger Reischuk

More information

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization

An Efficient Divide and Conquer Algorithm for Exact Hazard Free Logic Minimization An Efficient Divide nd Conquer Algorithm for Exct Hzrd Free Logic Minimiztion J.W.J.M. Rutten, M.R.C.M. Berkelr, C.A.J. vn Eijk, M.A.J. Kolsteren Eindhoven University of Technology Informtion nd Communiction

More information

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM

Topic: Software Model Checking via Counter-Example Guided Abstraction Refinement. Having a BLAST with SLAM. Combining Strengths. SLAM Overview SLAM Hving BLAST with SLAM Topic: Softwre Model Checking vi Counter-Exmple Guided Abstrction Refinement There re esily two dozen SLAM/BLAST/MAGIC ppers; I will skim. # # Theorem Proving Combining Strengths

More information

CS 221: Artificial Intelligence Fall 2011

CS 221: Artificial Intelligence Fall 2011 CS 221: Artificil Intelligence Fll 2011 Lecture 2: Serch (Slides from Dn Klein, with help from Sturt Russell, Andrew Moore, Teg Grenger, Peter Norvig) Problem types! Fully observble, deterministic! single-belief-stte

More information

11/28/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Announcements. Announcements. Announcements

11/28/18 FIBONACCI NUMBERS GOLDEN RATIO, RECURRENCES. Announcements. Announcements. Announcements Fiboncci (Leonrdo Pisno) 0-0? Sttue in Pis Itly FIBONACCI NUERS GOLDEN RATIO, RECURRENCES Lecture CS0 Fll 08 Announcements A: NO LATE DAYS. No need to put in time nd comments. We hve to grde quickly. No

More information

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms

Paradigm 5. Data Structure. Suffix trees. What is a suffix tree? Suffix tree. Simple applications. Simple applications. Algorithms Prdigm. Dt Struture Known exmples: link tble, hep, Our leture: suffix tree Will involve mortize method tht will be stressed shortly in this ourse Suffix trees Wht is suffix tree? Simple pplitions History

More information

TO REGULAR EXPRESSIONS

TO REGULAR EXPRESSIONS Suject :- Computer Science Course Nme :- Theory Of Computtion DA TO REGULAR EXPRESSIONS Report Sumitted y:- Ajy Singh Meen 07000505 jysmeen@cse.iit.c.in BASIC DEINITIONS DA:- A finite stte mchine where

More information

Section 3.1: Sequences and Series

Section 3.1: Sequences and Series Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one

More information

Fig.25: the Role of LEX

Fig.25: the Role of LEX The Lnguge for Specifying Lexicl Anlyzer We shll now study how to uild lexicl nlyzer from specifiction of tokens in the form of list of regulr expressions The discussion centers round the design of n existing

More information

1 Quad-Edge Construction Operators

1 Quad-Edge Construction Operators CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike

More information

Network Layer: Routing Classifications; Shortest Path Routing

Network Layer: Routing Classifications; Shortest Path Routing igitl ommuniction in the Modern World : Routing lssifictions; Shortest Pth Routing s min prolem: To get efficiently from one point to the other in dynmic environment http://.cs.huji.c.il/~com com@cs.huji.c.il

More information

Control-Flow Analysis and Loop Detection

Control-Flow Analysis and Loop Detection ! Control-Flow Anlysis nd Loop Detection!Lst time! PRE!Tody! Control-flow nlysis! Loops! Identifying loops using domintors! Reducibility! Using loop identifiction to identify induction vribles CS553 Lecture

More information

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus

Unit #9 : Definite Integral Properties, Fundamental Theorem of Calculus Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl

More information

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve.

If f(x, y) is a surface that lies above r(t), we can think about the area between the surface and the curve. Line Integrls The ide of line integrl is very similr to tht of single integrls. If the function f(x) is bove the x-xis on the intervl [, b], then the integrl of f(x) over [, b] is the re under f over the

More information

Hyperbolas. Definition of Hyperbola

Hyperbolas. Definition of Hyperbola CHAT Pre-Clculus Hyperols The third type of conic is clled hyperol. For n ellipse, the sum of the distnces from the foci nd point on the ellipse is fixed numer. For hyperol, the difference of the distnces

More information

Introduction to Computer Engineering EECS 203 dickrp/eecs203/ CMOS transmission gate (TG) TG example

Introduction to Computer Engineering EECS 203  dickrp/eecs203/ CMOS transmission gate (TG) TG example Introduction to Computer Engineering EECS 23 http://ziyng.eecs.northwestern.edu/ dickrp/eecs23/ CMOS trnsmission gte TG Instructor: Robert Dick Office: L477 Tech Emil: dickrp@northwestern.edu Phone: 847

More information

OPERATION MANUAL. DIGIFORCE 9307 PROFINET Integration into TIA Portal

OPERATION MANUAL. DIGIFORCE 9307 PROFINET Integration into TIA Portal OPERATION MANUAL DIGIFORCE 9307 PROFINET Integrtion into TIA Portl Mnufcturer: 2018 burster präzisionsmesstechnik gmbh & co kg burster präzisionsmesstechnik gmbh & co kg Alle Rechte vorbehlten Tlstrße

More information

CMSC 331 First Midterm Exam

CMSC 331 First Midterm Exam 0 00/ 1 20/ 2 05/ 3 15/ 4 15/ 5 15/ 6 20/ 7 30/ 8 30/ 150/ 331 First Midterm Exm 7 October 2003 CMC 331 First Midterm Exm Nme: mple Answers tudent ID#: You will hve seventy-five (75) minutes to complete

More information

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών

ΕΠΛ323 - Θεωρία και Πρακτική Μεταγλωττιστών ΕΠΛ323 - Θωρία και Πρακτική Μταγλωττιστών Lecture 3 Lexicl Anlysis Elis Athnsopoulos elisthn@cs.ucy.c.cy Recognition of Tokens if expressions nd reltionl opertors if è if then è then else è else relop

More information

SIMPLIFYING ALGEBRA PASSPORT.

SIMPLIFYING ALGEBRA PASSPORT. SIMPLIFYING ALGEBRA PASSPORT www.mthletics.com.u This booklet is ll bout turning complex problems into something simple. You will be ble to do something like this! ( 9- # + 4 ' ) ' ( 9- + 7-) ' ' Give

More information

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure

Lecture Overview. Knowledge-based systems in Bioinformatics, 1MB602. Procedural abstraction. The sum procedure. Integration as a procedure Lecture Overview Knowledge-bsed systems in Bioinformtics, MB6 Scheme lecture Procedurl bstrction Higher order procedures Procedures s rguments Procedures s returned vlues Locl vribles Dt bstrction Compound

More information

Tool Vendor Perspectives SysML Thus Far

Tool Vendor Perspectives SysML Thus Far Frontiers 2008 Pnel Georgi Tec, 05-13-08 Tool Vendor Perspectives SysML Thus Fr Hns-Peter Hoffmnn, Ph.D Chief Systems Methodologist Telelogic, Systems & Softwre Modeling Business Unit Peter.Hoffmnn@telelogic.com

More information

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5

CS321 Languages and Compiler Design I. Winter 2012 Lecture 5 CS321 Lnguges nd Compiler Design I Winter 2012 Lecture 5 1 FINITE AUTOMATA A non-deterministic finite utomton (NFA) consists of: An input lphet Σ, e.g. Σ =,. A set of sttes S, e.g. S = {1, 3, 5, 7, 11,

More information

Reducing a DFA to a Minimal DFA

Reducing a DFA to a Minimal DFA Lexicl Anlysis - Prt 4 Reducing DFA to Miniml DFA Input: DFA IN Assume DFA IN never gets stuck (dd ded stte if necessry) Output: DFA MIN An equivlent DFA with the minimum numer of sttes. Hrry H. Porter,

More information

Suffix trees. December Computational Genomics

Suffix trees. December Computational Genomics Computtionl Genomics Prof Irit Gt-Viks, Prof. Ron Shmir, Prof. Roded Shrn School of Computer Science, Tel Aviv University גנומיקה חישובית פרופ' עירית גת-ויקס, פרופ' רון שמיר, פרופ' רודד שרן ביה"ס למדעי

More information