Page. Harsh Reality. Dynamic Memory Allocation. Malloc Package. Process Memory Image. Assumptions. Malloc Example
|
|
- Gwendolyn Sparks
- 5 years ago
- Views:
Transcription
1 Hrsh Relity Memory Mtters Memory is not unbounded It must be llocted nd mnged 1 Mny lictions re memory dominted Esecilly those bsed on comlex, grh lgorithms Memory referencing bugs esecilly ernicious Effects re distnt in both time nd sce Memory erformnce is not uniform Cche nd virtul memory effects cn gretly ffect rogrm erformnce Adting rogrm to chrcteristics of memory system cn led to mjor seed imrovements Dynmic Memory Alloction Exlicit vs. Imlicit Memory Alloctor Exlicit: liction lloctes nd frees sce E.g., mlloc nd free in C Imlicit: liction lloctes, but does not free sce E.g. grbge collection in Jv, ML or Lis Alloction In both cses the memory lloctor rovides n bstrction of memory s set of blocks Doles out free memory blocks to liction Will discuss simle exlicit memory lloction tody Aliction Dynmic Memory Alloctor He Memory Process Memory Imge %es Alloctors request dditionl he memory from the oerting system using the sbrk function. kernel virtul memory stck Memory med region for shred librries run-time he (vi mlloc) uninitilized dt (.bss) initilized dt (.dt) rogrm text (.text) memory invisible to user code the brk tr Mlloc Pckge #include <stdlib.h> void *mlloc(_t ) If successful: Returns ointer to memory block of t lest bytes, (tyiclly) ligned to 8-byte boundry. If == 0, returns NULL If unsuccessful: returns NULL (0) nd sets errno. void free(void *) Returns the block ointed t by to ool of vilble memory must come from revious cll to mlloc or relloc. void *relloc(void *, _t ) Chnges of block nd returns ointer to new block. Contents of new block unchnged u to min of old nd new. 3 0 Mlloc Exmle void foo(int n, int m) { int i, *; /* llocte block of n ints */ if (( = (int *) mlloc(n * of(int))) == NULL) { error("mlloc"); exit(0); for (i=0; i<n; i++) [i] = i; /* dd m bytes to end of block */ if (( = (int *) relloc(, (n+m) * of(int))) == NULL) { error("relloc"); exit(0); for (i=n; i < n+m; i++) [i] = i; Assumtions Assumtions mde in this lecture Memory is word ddressed (ech word cn hold ointer) Allocted block ( words) Free block (3 words) Free word Allocted word 5 /* rint new rry */ for (i=0; i<n+m; i++) rintf("%d\n", [i]); free(); /* return to vilble memory ool */ 6
2 Alloction Exmles 7 1 = mlloc() = mlloc(5) 3 = mlloc(6) free() = mlloc() Constrints Alictions: Cn issue rbitrry sequence of lloction nd free requests Free requests must corresond to n llocted block Alloctors Cn t control number or of llocted blocks Must resond immeditely to ll lloction requests i.e., cn t reorder or buffer requests Must llocte blocks from free memory i.e., cn only lce llocted blocks in free memory Must lign blocks so they stisfy ll lignment requirements 8 byte lignment for GNU mlloc (libc mlloc) on Linux boxes Cn only mniulte nd modify free memory Cn t move the llocted blocks once they re llocted i.e., comction is not llowed 8 Gols of Good mlloc/free Primry gols 9 Good time erformnce for mlloc nd free Idelly should tke constnt time (not lwys ossible) Should certinly not tke liner time in the number of blocks Good sce utiliztion User llocted structures should be lrge frction of the he. Wnt to minimize frgmenttion. Some other gols Good loclity roerties Structures llocted close in time should be close in sce Similr objects should be llocted close in sce Robust Cn check tht free(1) is on vlid llocted object 1 Cn check tht memory references re to llocted sce Performnce Gols: Throughut Given some sequence of mlloc nd free requests: 10 R 0, R 1,..., R k,..., R n-1 Wnt to mximize throughut nd ek memory utiliztion. These gols re often conflicting Throughut: Number of comleted requests er unit time Exmle: 5,000 mlloc clls nd 5,000 free clls i0 seconds Throughut is 1,000 oertions/second. Performnce Gols: Pek Memory Utiliztion Given some sequence of mlloc nd free requests: 11 R 0, R 1,..., R k,..., R n-1 Def: Aggregte ylod P k : mlloc() results in block with ylod of bytes.. After request R k hs comleted, the ggregte ylod P k is the sum of currently llocted ylods. Def: Current he is denoted by H k Assume tht H k is monotoniclly nondecresing Def: Pek memory utiliztion: After k requests, ek memory utiliztion is: U k = ( mx i<k P i ) / H k 1 Internl Frgmenttion Poor memory utiliztion cused by frgmenttion. Comes in two forms: internl nd externl frgmenttion Internl frgmenttion For some block, internl frgmenttion is the difference between the block nd the ylod. block Internl frgmenttion ylod Internl frgmenttion Cused by overhed of mintining he dt structures, dding for lignment uroses, or exlicit olicy decisions (e.g., not to slit the block). Deends only on the ttern of revious requests, nd thus is esy to mesure.
3 Externl Frgmenttion 13 Occurs when there is enough ggregte he memory, but no single free block is lrge enough 1 = mlloc() = mlloc(5) 3 = mlloc(6) free() = mlloc(6) oos! Externl frgmenttion deends on the ttern of future requests, nd thus is difficult to mesure. Imlementtion Issues How do we know how much memory to free just given ointer? How do we kee trck of the free blocks? Wht do we do with the extr sce when llocting structure tht is smller thn the free block it is lced in? How do we ick block to use for lloction -- mny might fit? How do we reinsert freed block? 1 free(0) 1 = mlloc(1) 0 Knowing How Much to Free Stndrd method Kee the length of block in the word receding the block. This word is often clled the heder field or heder Requires n extr word for every llocted block Keeing Trck of Free Blocks Method 1: 1 Imlicit list using lengths -- links ll blocks 5 6 Method : Exlicit list mong the free blocks using ointers within the free blocks 0 = mlloc() free(0) 5 Block dt Method 3: 3 Segregted free list Different free lists for different clsses Method : Blocks sorted by Cn use blnced tree (e.g. Red-Blck tree) with ointers within ech free block, nd the length used s key Method 1: Imlicit List 17 Need to identify whether ech block is free or llocted Cn use extr bit Bit cn be ut in the sme word s the if block s re lwys multiles of two (msk out low order bit when reding ). Formt of llocted nd free blocks 1 word ylod otionl dding = 1: llocted block = 0: free block : block ylod: liction dt (llocted blocks only) Imlicit List: Finding Free Block First fit: 18 Serch list from beginning, choose first free block tht fits Cn tke liner time in totl number of blocks (llocted nd free) In rctice it cn cuse slinters t beginning of list Next fit: Like first-fit, but serch list from loction of end of revious serch Reserch suggests tht frgmenttion is worse Best fit: = strt; while (( < end) (* & 1) (* <= len)); \\ not ssed end \\ lredy llocted \\ too smll Serch the list, choose the free block with the closest tht fits Kees frgments smll --- usully hels frgmenttion Will tyiclly run slower thn first-fit
4 Imlicit List: Allocting in Free Block Allocting in free block - slitting Since llocted sce might be smller thn free sce, we might wnt to slit the block 6 Imlicit List: Freeing Block Simlest imlementtion: Only need to cler llocted flg void free_block(tr ) { * = * & - But cn led to flse frgmenttion void ddblock(tr, int len) { int new = ((len + 1) >> 1) << 1; // dd 1 nd round u int old = * & -; // msk out low bit * = new 1; // set new length if (new < old) *(+new) = old - new; // set length in remining // rt of block free() mlloc(5) Oos! 19 ddblock(, ) 0 There is enough free sce, but the lloctor won t be ble to find it Imlicit List: Colescing Join (colesce( colesce) ) with next nd/or revious block if they re free Colescing with next block free() void free_block(tr ) { * = * & -; // cler llocted flg next = + *; // find next block if ((*next & 1) == 0) * = * + *next; // dd to this block if // not llocted Imlicit List: Bidirectionl Colescing Boundry tgs [Knuth73] Relicte /llocted word t bottom of free blocks Allows us to trverse the list bckwrds, but requires extr sce Imortnt nd generl technique! Formt of llocted nd free blocks Heder Boundry tg (footer) 1 word ylod nd dding = 1: llocted block = 0: free block : totl block ylod: liction dt (llocted blocks only) 1 6 But how do we colesce with revious block? 6 6 Constnt Time Colescing Constnt Time Colescing (Cse 1) block being freed Cse 1 Cse Cse 3 Cse llocted llocted free free llocted free llocted free m 1 n 0 n 0 m 1 m 1 m 1 3
5 Constnt Time Colescing (Cse ) Constnt Time Colescing (Cse 3) n+ n+m 0 m 0 m 1 n+ m 1 m 0 n+m 0 m 1 m Constnt Time Colescing (Cse ) 7 m 0 m 0 n+m1+m 0 n+m1+m 0 Summry of Key Alloctor Policies Plcement olicy: 8 First fit, next fit, best fit, etc. Trdes off lower throughut for less frgmenttion Interesting observtion: segregted free lists (next lecture) roximte best fit lcement olicy without hving the serch entire free list. Slitting olicy: When do we go hed nd slit free blocks? How much internl frgmenttion re we willing to tolerte? Colescing olicy: Immedite colescing: colesce djcent blocks ech time free is clled Deferred colescing: try to imrove erformnce of free by deferring colescing until needed. e.g., Colesce s you scn the free list for mlloc. Colesce when the mount of externl frgmenttion reches some threshold. Imlicit Lists: Summry Imlementtion: very simle Allocte: liner time worst cse Free: constnt time worst cse -- even with colescing Memory usge: will deend on lcement olicy First fit, next fit or best fit Not used in rctice for mlloc/free becuse of liner time llocte. Used in mny secil urose lictions. However, the concets of slitting nd boundry tg colescing re generl to ll lloctors. 9
Allocator Basics. Dynamic Memory Allocation in the Heap (malloc and free) Allocator Goals: malloc/free. Internal Fragmentation
Alloctor Bsics Dynmic Memory Alloction in the Hep (mlloc nd free) Pges too corse-grined for llocting individul objects. Insted: flexible-sized, word-ligned blocks. Allocted block (4 words) Free block (3
More informationOutlines. Dynamic Memory Dynamic Memory Dynamic Memory The malloc Package. malloc Example
Outlines Dynmic Memory Alloc@on CSCI 01: Mchine Architecture nd Orgniz@on Bsic concepts Implicit free lists Explicit free lists Pen- Chung Yew Deprtment Computer Science nd Engineering University of Minnesot
More informationDynamic Memory Allocation I Nov 5, 2002
15-213 The course that gives CMU its Zip! Dynamic Memory Allocation I Nov 5, 2002 Topics Simple explicit allocators Data structures Mechanisms Policies class21.ppt Harsh Reality Memory is not unbounded
More informationDynamic Memory Allocation I
Dynamic Memory Allocation I William J. Taffe Plymouth State University Using the Slides of Randall E. Bryant Carnegie Mellon University Topics Simple explicit allocators Data structures Mechanisms Policies
More informationDynamic Memory Allocation. Gerson Robboy Portland State University. class20.ppt
Dynamic Memory Allocation Gerson Robboy Portland State University class20.ppt Harsh Reality Memory is not unbounded It must be allocated and managed Many applications are memory dominated Especially those
More informationPage 1. Memory Allocation and Usage CSE 361S. Different free lists for different size classes
Keeping Trck o Free Blocks Method 1: : Implicit list using lengths -- links ll blocks Memory Alloction nd Usge Method : : Explicit list mong the ree blocks using pointers within the ree blocks CSE 361S
More informationPointer Analysis. CSE 501 Spring 15
Pointer Anlysis CSE 501 Sring 15 Course Outline St8c nlysis Dtflow nd strct interret8on Alic8ons We re here Beyond generl- urose lnguges Progrm Verific8on Dynmic nlysis New comilers Tody Intro to ointer
More informationUninformed Search. Hal Daumé III. Computer Science University of Maryland CS 421: Introduction to Artificial Intelligence 31 Jan 2012
1 Hl Dumé III (me@hl3.nme) Uninformed Serch Hl Dumé III Comuter Science University of Mrylnd me@hl3.nme CS 421: Introduction to Artificil Intelligence 31 Jn 2012 Mny slides courtesy of Dn Klein, Sturt
More informationIntroduction to Computer Systems /18 243, fall th Lecture, Oct. 22 th
Introduction to Computer Systems 15 213/18 243, fall 2009 16 th Lecture, Oct. 22 th Instructors: Gregory Kesden and Markus Püschel Today Dynamic memory allocation Process Memory Image %esp kernel virtual
More informationOutline. Tiling, formally. Expression tile as rule. Statement tiles as rules. Function calls. CS 412 Introduction to Compilers
CS 412 Introduction to Compilers Andrew Myers Cornell University Lectur8 Finishing genertion 9 Mr 01 Outline Tiling s syntx-directed trnsltion Implementing function clls Implementing functions Optimizing
More informationMid-term exam. Scores. Fall term 2012 KAIST EE209 Programming Structures for EE. Thursday Oct 25, Student's name: Student ID:
Fll term 2012 KAIST EE209 Progrmming Structures for EE Mid-term exm Thursdy Oct 25, 2012 Student's nme: Student ID: The exm is closed book nd notes. Red the questions crefully nd focus your nswers on wht
More informationHigh Priority Traffic in HCF on Wireless Networks
High Priority Trffic in HC on Wireless Networks Mo Add, Amnd Pert, Gordon Erly School of Comuting, University of Portsmouth, Lion Terrce, Portsmouth, UK {mo.dd, mnd.ert, gordon.erly }@ort.c.uk Abstrct
More informationOutline CS 412/413. Function calls. Stack layout. Tiling a call. Two translations
CS 412/413 Introduction to Compilers nd Trnsltors Cornell University Andrew Myers Outline Implementing function clls Implementing functions Optimizing wy the pointer Dynmiclly-llocted structures strings
More informationToday. Dynamic Memory Allocation: Basic Concepts. Dynamic Memory Allocation. Dynamic Memory Allocation. malloc Example. The malloc Package
Today Dynamic Memory Allocation: Basic Concepts Basic concepts Performance concerns Approach 1: implicit free lists CSci 01: Machine Architecture and Organization October 17th-nd, 018 Your instructor:
More informationDynamic Programming. Andreas Klappenecker. [partially based on slides by Prof. Welch] Monday, September 24, 2012
Dynmic Progrmming Andres Klppenecker [prtilly bsed on slides by Prof. Welch] 1 Dynmic Progrmming Optiml substructure An optiml solution to the problem contins within it optiml solutions to subproblems.
More informationDynamic Memory Allocation: Basic Concepts
Dynamic Memory Allocation: Basic Concepts CSE 238/2038/2138: Systems Programming Instructor: Fatma CORUT ERGİN Slides adapted from Bryant & O Hallaron s slides 1 Today Basic concepts Implicit free lists
More informationKeeping Track of Free Blocks The course that gives CMU its Zip! Dynamic Memory Allocation II Nov 7, Allocating From Explicit Free Lists
Dynmic Memory Alloction II Nov 7, 2002 clss22.ppt 15-213 The course tht gives CMU its Zip! Topics Explicit doubly-linked ree lists Segregted ree lists Grbge collection Memory-relted perils nd pitlls Keeping
More informationMIPS I/O and Interrupt
MIPS I/O nd Interrupt Review Floting point instructions re crried out on seprte chip clled coprocessor 1 You hve to move dt to/from coprocessor 1 to do most common opertions such s printing, clling functions,
More informationITEC2620 Introduction to Data Structures
ITEC0 Introduction to Dt Structures Lecture 7 Queues, Priority Queues Queues I A queue is First-In, First-Out = FIFO uffer e.g. line-ups People enter from the ck of the line People re served (exit) from
More informationDynamic Memory Allocation: Basic Concepts
Dynamic Memory Allocation: Basic Concepts 15-213: Introduction to Computer Systems 19 th Lecture, March 30, 2017 Instructor: Franz Franchetti & Seth Copen Goldstein 1 Today Basic concepts Implicit free
More informationCSCI 104. Rafael Ferreira da Silva. Slides adapted from: Mark Redekopp and David Kempe
CSCI 0 fel Ferreir d Silv rfsilv@isi.edu Slides dpted from: Mrk edekopp nd Dvid Kempe LOG STUCTUED MEGE TEES Series Summtion eview Let n = + + + + k $ = #%& #. Wht is n? n = k+ - Wht is log () + log ()
More informationTransparent neutral-element elimination in MPI reduction operations
Trnsprent neutrl-element elimintion in MPI reduction opertions Jesper Lrsson Träff Deprtment of Scientific Computing University of Vienn Disclimer Exploiting repetition nd sprsity in input for reducing
More informationToday. Dynamic Memory Allocation: Basic Concepts. Dynamic Memory Allocation. Dynamic Memory Allocation. malloc Example. The malloc Package
Today Dynamic Memory Allocation: Basic Concepts Basic concepts Performance concerns Approach 1: implicit free lists CSci 01: Machine Architecture and Organization Lecture #9, April th, 016 Your instructor:
More informationGeometric transformations
Geometric trnsformtions Computer Grphics Some slides re bsed on Shy Shlom slides from TAU mn n n m m T A,,,,,, 2 1 2 22 12 1 21 11 Rows become columns nd columns become rows nm n n m m A,,,,,, 1 1 2 22
More information2 Computing all Intersections of a Set of Segments Line Segment Intersection
15-451/651: Design & Anlysis of Algorithms Novemer 14, 2016 Lecture #21 Sweep-Line nd Segment Intersection lst chnged: Novemer 8, 2017 1 Preliminries The sweep-line prdigm is very powerful lgorithmic design
More informationCaches I. CSE 351 Autumn Instructor: Justin Hsia
L01: Intro, L01: L16: Combintionl Introduction Cches I Logic CSE369, CSE351, Autumn 2016 Cches I CSE 351 Autumn 2016 Instructor: Justin Hsi Teching Assistnts: Chris M Hunter Zhn John Kltenbch Kevin Bi
More informationCOMP 423 lecture 11 Jan. 28, 2008
COMP 423 lecture 11 Jn. 28, 2008 Up to now, we hve looked t how some symols in n lphet occur more frequently thn others nd how we cn sve its y using code such tht the codewords for more frequently occuring
More informationDynamic Memory Alloca/on: Basic Concepts
Dynamic Memory Alloca/on: Basic Concepts 15-213 / 18-213: Introduc2on to Computer Systems 18 th Lecture, March. 26, 2013 Instructors: Anthony Rowe, Seth Goldstein, and Gregory Kesden 1 Today Basic concepts
More informationCaches I. CSE 351 Spring Instructor: Ruth Anderson
L16: Cches I Cches I CSE 351 Spring 2017 Instructor: Ruth Anderson Teching Assistnts: Dyln Johnson Kevin Bi Linxing Preston Jing Cody Ohlsen Yufng Sun Joshu Curtis L16: Cches I Administrivi Homework 3,
More informationLecture 10 Evolutionary Computation: Evolution strategies and genetic programming
Lecture 10 Evolutionry Computtion: Evolution strtegies nd genetic progrmming Evolution strtegies Genetic progrmming Summry Negnevitsky, Person Eduction, 2011 1 Evolution Strtegies Another pproch to simulting
More information520 Principles of Programming Languages. Memory Management. Memory Management... 35: Garbage Collection
Dynmic Memory Mngement 50 Principles of Progrmming Lnguges 35: Grbge Collection Christin Collberg collberg@cs.rizon.edu Deprtment of Computer Science University of Arizon The run-time system linked in
More informationWhat are suffix trees?
Suffix Trees 1 Wht re suffix trees? Allow lgorithm designers to store very lrge mount of informtion out strings while still keeping within liner spce Allow users to serch for new strings in the originl
More informationAlignment of Long Sequences. BMI/CS Spring 2012 Colin Dewey
Alignment of Long Sequences BMI/CS 776 www.biostt.wisc.edu/bmi776/ Spring 2012 Colin Dewey cdewey@biostt.wisc.edu Gols for Lecture the key concepts to understnd re the following how lrge-scle lignment
More informationPresentation Martin Randers
Presenttion Mrtin Rnders Outline Introduction Algorithms Implementtion nd experiments Memory consumption Summry Introduction Introduction Evolution of species cn e modelled in trees Trees consist of nodes
More informationCoprocessor memory definition. Loic Pallardy / Arnaud Pouliquen
Coprocessor memory definition Loic Pllrdy / Arnud Pouliquen Objective 2 The gol of following slides is to sum up on-going discussion in OpenAP weekly bout Remoteproc/Rpmsg memory lloction. Following proposl
More informationDynamic Memory Allocation. Basic Concepts. Computer Organization 4/3/2012. CSC252 - Spring The malloc Package. Kai Shen
Dynamic Memory Allocation: Basic Concepts Kai Shen Dynamic Memory Allocation Programmers use dynamic memory allocators (such as malloc) to acquire memory at run time. For data structures whose size is
More informationToday. Search Problems. Uninformed Search Methods. Depth-First Search Breadth-First Search Uniform-Cost Search
Uninformed Serch [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.] Tody Serch Problems Uninformed Serch Methods
More informationDynamic Memory Alloca/on: Basic Concepts
Dynamic Memory Alloca/on: Basic Concepts Fall 2015 Instructor: James Griffioen Adapted from slides by R. Bryant and D. O Hallaron (hip://csapp.cs.cmu.edu/public/instructors.html) 1 Today Basic concepts
More informationPointer Analysis. What is Points-to Analysis? Outline. What is Points-to Analysis? What is Points-to Analysis? What is Pointer Analysis? Rupesh Nasre.
Pointer Anlysis Wht is? Ruesh Nsre. CS6843 Anlysis IIT Mdrs Jn 2014 = &x; = ; if ( == *) { } else { } oints to x 4 Outline Wht is? Introduction Pointer nlysis s DFA rolem Design decisions nlysis, Steensgrd's
More informationLooking up objects in Pastry
Review: Pstry routing tbles 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 1 2 3 4 7 8 9 b c d e f 0 2 3 4 7 8 9 b c d e f Row0 Row 1 Row 2 Row 3 Routing tble of node with ID i =1fc s - For ech
More informationCS201 Discussion 10 DRAWTREE + TRIES
CS201 Discussion 10 DRAWTREE + TRIES DrwTree First instinct: recursion As very generic structure, we could tckle this problem s follows: drw(): Find the root drw(root) drw(root): Write the line for the
More informationDynamic Memory Allocation
1 Dynamic Memory Allocation Anne Bracy CS 3410 Computer Science Cornell University Note: these slides derive from those by Markus Püschel at CMU 2 Recommended Approach while (TRUE) { code a little; test
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationUNIT 11. Query Optimization
UNIT Query Optimiztion Contents Introduction to Query Optimiztion 2 The Optimiztion Process: An Overview 3 Optimiztion in System R 4 Optimiztion in INGRES 5 Implementing the Join Opertors Wei-Png Yng,
More informationCaches I. CSE 351 Autumn 2018
Cches I CSE 351 Autumn 2018 Instructors: Mx Willsey Luis Ceze Teching Assistnts: Britt Henderson Luks Joswik Josie Lee Wei Lin Dniel Snitkovsky Luis Veg Kory Wtson Ivy Yu Alt text: I looked t some of the
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationFrom Dependencies to Evaluation Strategies
From Dependencies to Evlution Strtegies Possile strtegies: 1 let the user define the evlution order 2 utomtic strtegy sed on the dependencies: use locl dependencies to determine which ttriutes to compute
More informationCSEP 573 Artificial Intelligence Winter 2016
CSEP 573 Artificil Intelligence Winter 2016 Luke Zettlemoyer Problem Spces nd Serch slides from Dn Klein, Sturt Russell, Andrew Moore, Dn Weld, Pieter Abbeel, Ali Frhdi Outline Agents tht Pln Ahed Serch
More informationIn the last lecture, we discussed how valid tokens may be specified by regular expressions.
LECTURE 5 Scnning SYNTAX ANALYSIS We know from our previous lectures tht the process of verifying the syntx of the progrm is performed in two stges: Scnning: Identifying nd verifying tokens in progrm.
More informationCS 188: Artificial Intelligence Fall 2008
CS 188: Artificil Intelligence Fll 2008 Lecture 2: Queue-Bsed Serc 9/2/2008 Dn Klein UC Berkeley Mny slides from eiter Sturt Russell or Andrew Moore Announcements Written ssignments: One mini-omework ec
More informationReal-Time Programming in Java
ARTIST2 Summer School 2008 in Europe Autrns (ner Grenole), Frnce Septemer 8-12, 8 2008 Rel-Time Progrmming in Jv Rel-Time in the Age of Complex Systems Invited Speker: Dvid F. Bcon IBM Reserch 0 Clssicl
More informationCSCI 446: Artificial Intelligence
CSCI 446: Artificil Intelligence Serch Instructor: Michele Vn Dyne [These slides were creted by Dn Klein nd Pieter Abbeel for CS188 Intro to AI t UC Berkeley. All CS188 mterils re vilble t http://i.berkeley.edu.]
More informationIntermediate Information Structures
CPSC 335 Intermedite Informtion Structures LECTURE 13 Suffix Trees Jon Rokne Computer Science University of Clgry Cnd Modified from CMSC 423 - Todd Trengen UMD upd Preprocessing Strings We will look t
More information1 Quad-Edge Construction Operators
CS48: Computer Grphics Hndout # Geometric Modeling Originl Hndout #5 Stnford University Tuesdy, 8 December 99 Originl Lecture #5: 9 November 99 Topics: Mnipultions with Qud-Edge Dt Structures Scribe: Mike
More informationUnit #9 : Definite Integral Properties, Fundamental Theorem of Calculus
Unit #9 : Definite Integrl Properties, Fundmentl Theorem of Clculus Gols: Identify properties of definite integrls Define odd nd even functions, nd reltionship to integrl vlues Introduce the Fundmentl
More informationParallel and Concurrent Real-time Garbage Collection
Prllel nd Concurrent Rel-time Grge Collection Prt II: Memory Alloction nd Sweeping Dvid F. Bcon T.J. Wtson Reserch Center 0 Pge Dt Synchroniztion, Tke 1 16 64 256 1 Pge Dt, Tke 2 16 64 256 Thred 1 16 64
More informationPointwise convergence need not behave well with respect to standard properties such as continuity.
Chpter 3 Uniform Convergence Lecture 9 Sequences of functions re of gret importnce in mny res of pure nd pplied mthemtics, nd their properties cn often be studied in the context of metric spces, s in Exmples
More informationExam #1 for Computer Simulation Spring 2005
Exm # for Computer Simultion Spring 005 >>> SOLUTION
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence Winter 2016
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence Winter 2016 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationCOMBINATORIAL PATTERN MATCHING
COMBINATORIAL PATTERN MATCHING Genomic Repets Exmple of repets: ATGGTCTAGGTCCTAGTGGTC Motivtion to find them: Genomic rerrngements re often ssocited with repets Trce evolutionry secrets Mny tumors re chrcterized
More informationRational Numbers---Adding Fractions With Like Denominators.
Rtionl Numbers---Adding Frctions With Like Denomintors. A. In Words: To dd frctions with like denomintors, dd the numertors nd write the sum over the sme denomintor. B. In Symbols: For frctions c nd b
More informationCPSC 213. Polymorphism. Introduction to Computer Systems. Readings for Next Two Lectures. Back to Procedure Calls
Redings for Next Two Lectures Text CPSC 213 Switch Sttements, Understnding Pointers - 2nd ed: 3.6.7, 3.10-1st ed: 3.6.6, 3.11 Introduction to Computer Systems Unit 1f Dynmic Control Flow Polymorphism nd
More informationCopyright (C) 1997, 1998 by the Association for Computing Machinery, Inc. Permission to make digital or hard copies of part or all of this work for
Coyright (C) 1997, 1998 by the Assocition for Comuting Mchinery, Inc. Permission to mke digitl or hrd coies of rt or ll of this work for ersonl or clssroom use is grnted without fee rovided tht coies re
More informationINTRODUCTION TO SIMPLICIAL COMPLEXES
INTRODUCTION TO SIMPLICIAL COMPLEXES CASEY KELLEHER AND ALESSANDRA PANTANO 0.1. Introduction. In this ctivity set we re going to introduce notion from Algebric Topology clled simplicil homology. The min
More informationVery sad code. Abstraction, List, & Cons. CS61A Lecture 7. Happier Code. Goals. Constructors. Constructors 6/29/2011. Selectors.
6/9/ Abstrction, List, & Cons CS6A Lecture 7-6-9 Colleen Lewis Very sd code (define (totl hnd) (if (empty? hnd) (+ (butlst (lst hnd)) (totl (butlst hnd))))) STk> (totl (h c d)) 7 STk> (totl (h ks d)) ;;;EEEK!
More information9.1 apply the distance and midpoint formulas
9.1 pply the distnce nd midpoint formuls DISTANCE FORMULA MIDPOINT FORMULA To find the midpoint between two points x, y nd x y 1 1,, we Exmple 1: Find the distnce between the two points. Then, find the
More informationIntroduction to Integration
Introduction to Integrtion Definite integrls of piecewise constnt functions A constnt function is function of the form Integrtion is two things t the sme time: A form of summtion. The opposite of differentition.
More informationAnnouncements. CS 188: Artificial Intelligence Fall Recap: Search. Today. General Tree Search. Uniform Cost. Lecture 3: A* Search 9/4/2007
CS 88: Artificil Intelligence Fll 2007 Lecture : A* Serch 9/4/2007 Dn Klein UC Berkeley Mny slides over the course dpted from either Sturt Russell or Andrew Moore Announcements Sections: New section 06:
More informationToday. CS 188: Artificial Intelligence Fall Recap: Search. Example: Pancake Problem. Example: Pancake Problem. General Tree Search.
CS 88: Artificil Intelligence Fll 00 Lecture : A* Serch 9//00 A* Serch rph Serch Tody Heuristic Design Dn Klein UC Berkeley Multiple slides from Sturt Russell or Andrew Moore Recp: Serch Exmple: Pncke
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More information2-3 search trees red-black BSTs B-trees
2-3 serch trees red-lck BTs B-trees 3 2-3 tree llow 1 or 2 keys per node. 2-node: one key, two children. 3-node: two keys, three children. ymmetric order. Inorder trversl yields keys in scending order.
More informationSection 3.1: Sequences and Series
Section.: Sequences d Series Sequences Let s strt out with the definition of sequence: sequence: ordered list of numbers, often with definite pttern Recll tht in set, order doesn t mtter so this is one
More informationThe Structure of Forward, Reverse, and Transverse Path Graphs in The Pattern Recognition Algorithms of Sellers
The Structure of Forwrd, Reverse, nd Trnsverse Pth Grhs in The Pttern Recognition Algorithms of Sellers Lewis Lsser Dertment of Mthemtics nd Comuter Science York College/CUNY Jmic, New York 11451 llsser@york.cuny.edu
More informationFile Manager Quick Reference Guide. June Prepared for the Mayo Clinic Enterprise Kahua Deployment
File Mnger Quick Reference Guide June 2018 Prepred for the Myo Clinic Enterprise Khu Deployment NVIGTION IN FILE MNGER To nvigte in File Mnger, users will mke use of the left pne to nvigte nd further pnes
More informationPhylogeny and Molecular Evolution
Phylogeny nd Moleculr Evolution Chrcter Bsed Phylogeny 1/50 Credit Ron Shmir s lecture notes Notes by Nir Friedmn Dn Geiger, Shlomo Morn, Sgi Snir nd Ron Shmir Durbin et l. Jones nd Pevzner s presenttion
More informationOn the Interactions between Non-Cooperative P2P Overlay and Traffic Engineering Behaviors
On the Interctions between Non-Cooertive P2P Overly nd Trffic Engineering Behviors Chojiong Wng, Ning Wng, Michel Howrth University of Surrey Guildford, United Kingdom {C.Wng, N.Wng, M.Howrth}@surrey.c.uk
More informationLING/C SC/PSYC 438/538. Lecture 21 Sandiway Fong
LING/C SC/PSYC 438/538 Lecture 21 Sndiwy Fong Tody's Topics Homework 8 Review Optionl Homework 9 (mke up on Homework 7) Homework 8 Review Question1: write Prolog regulr grmmr for the following lnguge:
More informationpdfapilot Server 2 Manual
pdfpilot Server 2 Mnul 2011 by clls softwre gmbh Schönhuser Allee 6/7 D 10119 Berlin Germny info@cllssoftwre.com www.cllssoftwre.com Mnul clls pdfpilot Server 2 Pge 2 clls pdfpilot Server 2 Mnul Lst modified:
More informationTries. Yufei Tao KAIST. April 9, Y. Tao, April 9, 2013 Tries
Tries Yufei To KAIST April 9, 2013 Y. To, April 9, 2013 Tries In this lecture, we will discuss the following exct mtching prolem on strings. Prolem Let S e set of strings, ech of which hs unique integer
More informationSlides for Data Mining by I. H. Witten and E. Frank
Slides for Dt Mining y I. H. Witten nd E. Frnk Simplicity first Simple lgorithms often work very well! There re mny kinds of simple structure, eg: One ttriute does ll the work All ttriutes contriute eqully
More information12-B FRACTIONS AND DECIMALS
-B Frctions nd Decimls. () If ll four integers were negtive, their product would be positive, nd so could not equl one of them. If ll four integers were positive, their product would be much greter thn
More informationRegular Expression Matching with Multi-Strings and Intervals. Philip Bille Mikkel Thorup
Regulr Expression Mtching with Multi-Strings nd Intervls Philip Bille Mikkel Thorup Outline Definition Applictions Previous work Two new problems: Multi-strings nd chrcter clss intervls Algorithms Thompson
More informationScanner Termination. Multi Character Lookahead. to its physical end. Most parsers require an end of file token. Lex and Jlex automatically create an
Scnner Termintion A scnner reds input chrcters nd prtitions them into tokens. Wht hppens when the end of the input file is reched? It my be useful to crete n Eof pseudo-chrcter when this occurs. In Jv,
More information10.5 Graphing Quadratic Functions
0.5 Grphing Qudrtic Functions Now tht we cn solve qudrtic equtions, we wnt to lern how to grph the function ssocited with the qudrtic eqution. We cll this the qudrtic function. Grphs of Qudrtic Functions
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationSolving Problems by Searching. CS 486/686: Introduction to Artificial Intelligence
Solving Prolems y Serching CS 486/686: Introduction to Artificil Intelligence 1 Introduction Serch ws one of the first topics studied in AI - Newell nd Simon (1961) Generl Prolem Solver Centrl component
More informationcisc1110 fall 2010 lecture VI.2 call by value function parameters another call by value example:
cisc1110 fll 2010 lecture VI.2 cll y vlue function prmeters more on functions more on cll y vlue nd cll y reference pssing strings to functions returning strings from functions vrile scope glol vriles
More informationCHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE
CHAPTER III IMAGE DEWARPING (CALIBRATION) PROCEDURE 3.1 Scheimpflug Configurtion nd Perspective Distortion Scheimpflug criterion were found out to be the best lyout configurtion for Stereoscopic PIV, becuse
More informationOn the Detection of Step Edges in Algorithms Based on Gradient Vector Analysis
On the Detection of Step Edges in Algorithms Bsed on Grdient Vector Anlysis A. Lrr6, E. Montseny Computer Engineering Dept. Universitt Rovir i Virgili Crreter de Slou sin 43006 Trrgon, Spin Emil: lrre@etse.urv.es
More information4452 Mathematical Modeling Lecture 4: Lagrange Multipliers
Mth Modeling Lecture 4: Lgrnge Multipliers Pge 4452 Mthemticl Modeling Lecture 4: Lgrnge Multipliers Lgrnge multipliers re high powered mthemticl technique to find the mximum nd minimum of multidimensionl
More informationThe Greedy Method. The Greedy Method
Lists nd Itertors /8/26 Presenttion for use with the textook, Algorithm Design nd Applictions, y M. T. Goodrich nd R. Tmssi, Wiley, 25 The Greedy Method The Greedy Method The greedy method is generl lgorithm
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More informationBefore We Begin. Introduction to Spatial Domain Filtering. Introduction to Digital Image Processing. Overview (1): Administrative Details (1):
Overview (): Before We Begin Administrtive detils Review some questions to consider Winter 2006 Imge Enhncement in the Sptil Domin: Bsics of Sptil Filtering, Smoothing Sptil Filters, Order Sttistics Filters
More informationWhat do all those bits mean now? Number Systems and Arithmetic. Introduction to Binary Numbers. Questions About Numbers
Wht do ll those bits men now? bits (...) Number Systems nd Arithmetic or Computers go to elementry school instruction R-formt I-formt... integer dt number text chrs... floting point signed unsigned single
More informationAlgorithm Design (5) Text Search
Algorithm Design (5) Text Serch Tkshi Chikym School of Engineering The University of Tokyo Text Serch Find sustring tht mtches the given key string in text dt of lrge mount Key string: chr x[m] Text Dt:
More informationStack Manipulation. Other Issues. How about larger constants? Frame Pointer. PowerPC. Alternative Architectures
Other Issues Stck Mnipultion support for procedures (Refer to section 3.6), stcks, frmes, recursion mnipulting strings nd pointers linkers, loders, memory lyout Interrupts, exceptions, system clls nd conventions
More information3.5.1 Single slit diffraction
3..1 Single slit diffrction ves pssing through single slit will lso diffrct nd produce n interference pttern. The reson for this is to do with the finite width of the slit. e will consider this lter. Tke
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd processes. Introducing technology
More informationSmall Business Networking
Why network is n essentil productivity tool for ny smll business Effective technology is essentil for smll businesses looking to increse the productivity of their people nd business. Introducing technology
More information